ID: 1079254849

View in Genome Browser
Species Human (GRCh38)
Location 11:18819128-18819150
Sequence CAGAATTAGGAGAAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079254849_1079254857 24 Left 1079254849 11:18819128-18819150 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1079254857 11:18819175-18819197 AGGATGTCTCTCCCTAACAAAGG 0: 20
1: 63
2: 43
3: 36
4: 241
1079254849_1079254858 29 Left 1079254849 11:18819128-18819150 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1079254858 11:18819180-18819202 GTCTCTCCCTAACAAAGGAGTGG No data
1079254849_1079254859 30 Left 1079254849 11:18819128-18819150 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1079254859 11:18819181-18819203 TCTCTCCCTAACAAAGGAGTGGG No data
1079254849_1079254853 4 Left 1079254849 11:18819128-18819150 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1079254853 11:18819155-18819177 TAATGGCCCCTGCTTTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079254849 Original CRISPR CAGAATTAGGAGAAGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr