ID: 1079260380

View in Genome Browser
Species Human (GRCh38)
Location 11:18872879-18872901
Sequence CTCTGCCATGCGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079260376_1079260380 24 Left 1079260376 11:18872832-18872854 CCAACATCTATTTTTTTTGTAGA No data
Right 1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 235
1079260375_1079260380 29 Left 1079260375 11:18872827-18872849 CCATGCCAACATCTATTTTTTTT 0: 91
1: 529
2: 1458
3: 3107
4: 6604
Right 1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079260380 Original CRISPR CTCTGCCATGCGATGGTGGA AGG Intergenic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
901416395 1:9119724-9119746 CTCCTCCATGAGCTGGTGGAGGG - Intronic
901782481 1:11602904-11602926 CTCTCCCATAGGATGGTGGTAGG + Intergenic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
903161291 1:21490992-21491014 CTCTGCCCTCTGCTGGTGGAGGG + Intergenic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
904144556 1:28379515-28379537 CTCTGGCAGGCCAAGGTGGATGG - Intronic
911281596 1:95936212-95936234 CTCGGCCATGAGATGGGGGAGGG - Intergenic
914312845 1:146482600-146482622 CTCTGCGATGCCAAGGTGGGTGG - Intergenic
914501502 1:148250773-148250795 CTCTGCGATGCCAAGGTGGGTGG + Intergenic
918177784 1:182060595-182060617 CTCTGCCATGTGATGGGTGAGGG - Intronic
919434386 1:197538920-197538942 CTGTGTCATCCCATGGTGGAAGG - Intronic
922783418 1:228271193-228271215 CTGTGCCATCCAATGCTGGATGG - Intronic
1066063333 10:31743754-31743776 CACTGCCATACCATGTTGGATGG - Intergenic
1067137405 10:43623488-43623510 CTATGTCATCCCATGGTGGAAGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1068044136 10:51863666-51863688 CTCTACCATCTCATGGTGGAAGG - Intronic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG + Intergenic
1072106785 10:92282117-92282139 CTGGGCCATGCAATGGTCGAGGG - Intronic
1072209241 10:93231504-93231526 CACTTCCATTTGATGGTGGAAGG + Intergenic
1072523838 10:96254155-96254177 CTATTCCAGGCTATGGTGGATGG - Intronic
1074536930 10:114334770-114334792 CTCTGCCATGTGCTGGAGAAGGG - Intronic
1079260380 11:18872879-18872901 CTCTGCCATGCGATGGTGGAAGG + Intergenic
1083074238 11:60020263-60020285 CTCAGCCCTTGGATGGTGGATGG + Intergenic
1083851814 11:65372395-65372417 CTTTGCCATGGATTGGTGGAAGG + Intergenic
1084182545 11:67454131-67454153 CTCTGCAGTGGGATGGTGGTGGG + Intronic
1084730926 11:71073094-71073116 CTGTCCCATGCAGTGGTGGAAGG + Intronic
1088106212 11:106209498-106209520 CTCTTCCATGTTAAGGTGGATGG + Intergenic
1088369904 11:109077700-109077722 CTCTTTCATGAGATGGTGGGAGG - Intergenic
1089007255 11:115102564-115102586 CTATGCCATAACATGGTGGAGGG + Intergenic
1089942359 11:122431718-122431740 CTATGTCATCCCATGGTGGAAGG - Intergenic
1090254149 11:125271467-125271489 CTCTGCCTTGGGATGGAGGTAGG - Intronic
1091051106 11:132373553-132373575 CACTGCCAGGAGATGGGGGAGGG - Intergenic
1091294304 11:134462083-134462105 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1091599332 12:1908506-1908528 CTCTCCCACGCGGTGTTGGAGGG + Intronic
1093959978 12:25261832-25261854 CTGCACCATGCCATGGTGGAAGG - Intergenic
1094080084 12:26525096-26525118 CTCTTCCCTGAGATGGTGAATGG - Intronic
1095181836 12:39154864-39154886 CACTGCCATGGGATGAGGGAGGG + Intergenic
1095529850 12:43174142-43174164 CTATGTCATCCCATGGTGGAAGG - Intergenic
1095702846 12:45208286-45208308 TGCTGCCATCCCATGGTGGAAGG - Intergenic
1095882035 12:47148081-47148103 CTATGCCATCGCATGGTGGAAGG + Intronic
1096618813 12:52849604-52849626 CTGTCCCATGCGATCCTGGATGG - Intergenic
1097552450 12:61091177-61091199 CACTGCCAAGAGATGGTGGAGGG + Intergenic
1101451698 12:104785695-104785717 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1101711243 12:107268830-107268852 TTCTGCTATGAGGTGGTGGAAGG - Intergenic
1101966299 12:109284499-109284521 CTTGGCCATGCTCTGGTGGATGG + Intronic
1102151165 12:110689596-110689618 TTCTGCCATGCAGGGGTGGAGGG + Intronic
1103234176 12:119358392-119358414 CTGTGTCATCCCATGGTGGAAGG - Intronic
1104046244 12:125165007-125165029 CCCTGGCATGCTATGGAGGAGGG - Intergenic
1105934143 13:25083172-25083194 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1106146025 13:27050589-27050611 GTATGCCATGACATGGTGGAAGG - Intergenic
1108039347 13:46324770-46324792 CTCTGCCATGAGATGGAGGCTGG + Intergenic
1109881020 13:68476574-68476596 CTCTGCCATCCTCTTGTGGAGGG - Intergenic
1110487300 13:76061551-76061573 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1110915529 13:81016135-81016157 CTCTGCATTGGGATGGTGGCTGG + Intergenic
1112646813 13:101342460-101342482 CTCTGCCTTGTGATGCTGCATGG + Intronic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115736698 14:36339316-36339338 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1115878801 14:37891996-37892018 CTCTGCTAGGGGATTGTGGAAGG + Intronic
1116071775 14:40056156-40056178 CTCTGCCATGTGGTAGGGGAAGG - Intergenic
1116204005 14:41837431-41837453 CTCTGTCCTGAGATGGTGCATGG + Intronic
1118878451 14:69805023-69805045 CTGTGCCCTTAGATGGTGGAGGG - Intergenic
1120960437 14:90119841-90119863 CTCTGCGATGCCAAGGTGGGCGG - Intronic
1121020219 14:90575435-90575457 CTGTGCCCTTCGATGGAGGAAGG - Intronic
1121150259 14:91626656-91626678 CTCCGTCATCCCATGGTGGAAGG - Intronic
1122138361 14:99647353-99647375 CTCTGCTATGTGATGGGGGTAGG - Intronic
1122350348 14:101085974-101085996 CTGGGCCATCCTATGGTGGAAGG - Intergenic
1122394220 14:101411387-101411409 TTCTGCCATGGGGTGTTGGACGG + Intergenic
1122976761 14:105174059-105174081 CTCTGCCATGCTACGGGGGGTGG - Intronic
1123950938 15:25274260-25274282 CTCTGTCATCCTATGGTAGAAGG + Intergenic
1125753626 15:42047353-42047375 CTGTGTCATTCCATGGTGGAGGG + Intronic
1126508033 15:49430635-49430657 CTGTGTCATTCCATGGTGGAAGG + Intronic
1128367212 15:67012934-67012956 CTCACCCATGTGATGGGGGAGGG + Intergenic
1128705956 15:69837611-69837633 CTCTGACCTGGGATGCTGGAGGG + Intergenic
1130052182 15:80493081-80493103 CTGTGTCATCCCATGGTGGAAGG + Intronic
1132379136 15:101353993-101354015 CTCTGCCCAGGGATGGTGGGAGG - Intronic
1133256460 16:4519536-4519558 CTGTGTCATCCCATGGTGGAAGG - Intronic
1135089663 16:19503279-19503301 CTCTGGCATGCCATGGTGCATGG + Exonic
1136059031 16:27712142-27712164 CTTTGCCATGTGATGGTCCACGG + Intronic
1138516356 16:57537133-57537155 CTCTGCATTGCGATGGTGGTTGG + Intergenic
1140469008 16:75204482-75204504 CTCTGCCATGCACTCTTGGAGGG + Intronic
1140554656 16:75907997-75908019 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1141160706 16:81627680-81627702 CTCTGCTATGAGATGGGGGAGGG - Intronic
1142044949 16:87919410-87919432 ATCAGCCATGGGATGGTGGCTGG + Intronic
1143287916 17:5805002-5805024 CTGTGTCATTCCATGGTGGAAGG + Intronic
1143774257 17:9187337-9187359 CTCTACCATGAGCTGCTGGAAGG - Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144889716 17:18487638-18487660 CTCTGGCAGGTGATGGTGAACGG + Exonic
1145142495 17:20456658-20456680 CTCTGGCAGGTGATGGTGAACGG - Exonic
1145793410 17:27642229-27642251 CTCTGGCAGGTGATGGTGAACGG + Exonic
1145808215 17:27749775-27749797 CTCTGGCAGGTGATGGTGAACGG + Intergenic
1146837696 17:36125540-36125562 CTCTGCCCTCTGCTGGTGGAAGG - Intergenic
1149555810 17:57572723-57572745 CTCTGCCCTGAGCTGGTGGGTGG - Intronic
1152126217 17:78448803-78448825 CTGTGTCATCCCATGGTGGAAGG - Intronic
1152168249 17:78724777-78724799 CACTGCCATGCCATGGGGGTTGG + Intronic
1152957457 18:51200-51222 CTCTGCCTTGGGATGGTCAAGGG + Intronic
1159285052 18:66337615-66337637 CACTGCCAGGGCATGGTGGAAGG + Intergenic
1159488569 18:69099174-69099196 CTGTGCCATGATATGGTAGAGGG - Intergenic
1165521333 19:36316652-36316674 CTGTGCCGTCCTATGGTGGAAGG + Intergenic
1165622728 19:37261936-37261958 CTGTGCCGTCCTATGGTGGAAGG - Intergenic
1165869396 19:38960357-38960379 CTTTGCCGTCAGATGGTGGATGG + Intronic
1168261458 19:55197348-55197370 CTCAGTCATGCTGTGGTGGAAGG - Exonic
925015983 2:524533-524555 CTATGCCATGTCCTGGTGGAAGG - Intergenic
925088107 2:1128672-1128694 TACTGCCATGATATGGTGGAGGG + Intronic
925269293 2:2590978-2591000 CACTGCCAGGAGATGGGGGAGGG - Intergenic
926899289 2:17732453-17732475 CTCTGCGAGGCCAAGGTGGATGG + Intronic
928521223 2:32091112-32091134 CTCTACCATACGTTGGTGGATGG + Intronic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
929066641 2:37982446-37982468 CTCTGTCATGAGAGAGTGGAAGG + Intronic
929525184 2:42694621-42694643 CTCTGCCAGGGGATGGGAGAGGG + Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931582885 2:63796497-63796519 CACTGCCAGGGGATGGGGGAGGG - Intronic
931637127 2:64351069-64351091 TGCTGCCAGGTGATGGTGGAGGG - Intergenic
932517436 2:72367675-72367697 CACTGCCAGGGGATGGGGGAGGG - Intronic
932639762 2:73432594-73432616 CTGTGCCCTCCCATGGTGGAAGG + Intronic
936997078 2:118426803-118426825 CCCTGCCATGGGGTGGTGGTTGG + Intergenic
942594551 2:177580582-177580604 CACTGCCATGCCCTGGTGCAGGG + Intergenic
943204804 2:184880758-184880780 CTGTGTCATCCCATGGTGGAAGG + Intronic
945771144 2:214044668-214044690 CTCTGCCAGGGGATGAAGGAGGG - Intronic
945837959 2:214854662-214854684 CTATGTCATCCCATGGTGGAAGG + Intergenic
947821647 2:233075674-233075696 CTCTGCCAAGCGGTGGAGGAAGG - Intronic
948108949 2:235439079-235439101 CTATGCCATGTCATGGTGGGGGG - Intergenic
948612905 2:239180942-239180964 CGCTGCCATGGGACAGTGGACGG - Intronic
1169286930 20:4316824-4316846 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170373638 20:15677358-15677380 CTCGGGCATGCGGTGGTGGGGGG + Intronic
1170509772 20:17064748-17064770 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1170899994 20:20453335-20453357 CTATGGCATGAGATGGGGGAAGG + Intronic
1171258266 20:23708523-23708545 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171275489 20:23853566-23853588 CTCTGACATGAGCAGGTGGATGG - Intergenic
1173730738 20:45326820-45326842 CTCTGCCAGGAAATGGGGGAAGG - Exonic
1174172452 20:48625895-48625917 CTCTGCCAGCCGCCGGTGGATGG - Exonic
1175126497 20:56756102-56756124 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1177701980 21:24651087-24651109 CTATGTCATACTATGGTGGAAGG - Intergenic
1178360868 21:31947726-31947748 CACTGACAGGGGATGGTGGAGGG - Intronic
1178417458 21:32415360-32415382 CTCTGCCCTGTGAAGGAGGAGGG + Intronic
1178701894 21:34840944-34840966 CTCAGCCTTGGGATGGTAGAGGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1183452681 22:37905663-37905685 CCCTGCCAAGCTATGGGGGAGGG + Intronic
1184007149 22:41718797-41718819 CTCTGTCATCCCATGGTGGAAGG + Intronic
1184449004 22:44571753-44571775 CTCTGCTGTGCTATGGTGTAAGG - Intergenic
952968073 3:38633218-38633240 CTCTGCCATGCGCTTCTCGATGG + Exonic
953666072 3:44927552-44927574 CTTTGCCATGCCATGCTGGCTGG - Intronic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
957114339 3:76005053-76005075 CTGTGCCATCTCATGGTGGAAGG - Intronic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
960859391 3:122136061-122136083 CTGTGTCATCCCATGGTGGAAGG + Intergenic
961342596 3:126238463-126238485 CTCTGCTAGGGGATTGTGGAAGG - Intergenic
962015024 3:131430886-131430908 CACTGCCAGGGGATGGAGGAGGG - Intergenic
963399716 3:144782438-144782460 CTCTTTCCTGCGATGATGGAAGG - Intergenic
964102248 3:153001307-153001329 CTGTGTCATCCCATGGTGGAAGG + Intergenic
965145126 3:164890875-164890897 CACTGCCAAGGGATGGGGGAGGG + Intergenic
967774742 3:193374936-193374958 CTGTGTCATTCCATGGTGGAAGG - Intronic
968913363 4:3486633-3486655 CGCTGCCCTGCCATGCTGGATGG + Intronic
969490449 4:7496477-7496499 CACTGCCCTGAGATGGGGGATGG - Intronic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
975740396 4:77424007-77424029 CTCTGTCCTCCCATGGTGGAAGG + Intronic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
978287693 4:107098272-107098294 TGCTGCCAGGGGATGGTGGAGGG - Intronic
979860366 4:125686100-125686122 CTGTGTCATCCGATGGTGAAAGG + Intergenic
984526666 4:180866397-180866419 AGCTGCCTAGCGATGGTGGAAGG + Intergenic
984753258 4:183299132-183299154 CTGTGTCATCCCATGGTGGAGGG + Intronic
986085214 5:4438006-4438028 CACTGCCAGGAGATAGTGGAGGG + Intergenic
987738076 5:21870458-21870480 CTGTGCTATCCTATGGTGGAAGG - Intronic
988956475 5:36324746-36324768 CACTGCCAGGGGATGGAGGAGGG + Intergenic
990055517 5:51572344-51572366 CTGTGTCCTCCGATGGTGGAAGG + Intergenic
992881744 5:81117360-81117382 CTCTGTCATAACATGGTGGAAGG + Intronic
993363344 5:87004528-87004550 ATCTGCCAGGAGATGGTGGCAGG - Intergenic
994533633 5:100999613-100999635 CTCTGCCTCGGGTTGGTGGAGGG - Intergenic
994869911 5:105334565-105334587 CACTGCCATGGGATTGGGGAAGG + Intergenic
997059728 5:130487439-130487461 CTCTGCCAGGAGATGGGGGTTGG - Intergenic
997502506 5:134387620-134387642 CTGTGACATCCCATGGTGGAAGG + Intronic
1000052672 5:157575856-157575878 CTCCGCCAGGGGATGGAGGAGGG + Intergenic
1001191275 5:169634049-169634071 CTGTGCCATCCCGTGGTGGAAGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001415528 5:171542678-171542700 CCCTGGCATGGGCTGGTGGAAGG + Intergenic
1001838547 5:174853295-174853317 CTTTGCCATACTATGGAGGAAGG + Intergenic
1003263109 6:4541155-4541177 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1003499687 6:6694295-6694317 CTCTACCTTGCGATGCTGCAGGG + Intergenic
1009375389 6:62961773-62961795 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1009516250 6:64622243-64622265 TTCTGCCTAGAGATGGTGGAGGG + Intronic
1010006974 6:71006257-71006279 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1010123267 6:72404770-72404792 CTCTGCCTTACGATGGGGGTGGG + Intergenic
1011567648 6:88694851-88694873 CTGGGCCATGCTGTGGTGGAAGG - Intronic
1014077876 6:117257530-117257552 CTCTCACATGACATGGTGGAAGG + Intergenic
1014840919 6:126219064-126219086 CGCTGCCAGGGGATGGAGGAGGG + Intergenic
1015497080 6:133893223-133893245 CTCTGCCTGGCCATGGAGGAAGG + Exonic
1016054856 6:139567581-139567603 CACTGCCAGGGGATGGAGGAAGG + Intergenic
1017112859 6:150949109-150949131 CTCTGCCACGTGATGGTAGATGG - Exonic
1018644600 6:165935838-165935860 CTGTGTCATCCCATGGTGGAAGG - Intronic
1018731722 6:166656595-166656617 CTCTGGGATGCGAAGATGGATGG + Intronic
1018873666 6:167802179-167802201 CTCTGACATCCCATGGTGGGTGG - Intergenic
1019180076 6:170181214-170181236 CTCTGCCCTGCCCTGCTGGAGGG - Intergenic
1020440481 7:8211857-8211879 CTCTGCCATGGTATTGTGAAAGG + Intronic
1022157908 7:27678762-27678784 ATCTGCCATGTCATGGTGGGTGG - Intergenic
1022470370 7:30678328-30678350 CTCTGTCACTCGATGGTGCAAGG + Intronic
1022581360 7:31558158-31558180 CTGTGTCATTCCATGGTGGAAGG - Intronic
1023137768 7:37070221-37070243 CTCTGCCATCCAATGGTGCCAGG - Intronic
1024285957 7:47757734-47757756 CTCTGGCTTGAGATGTTGGATGG + Intronic
1024833110 7:53484885-53484907 CTGTGCCCTGCCATGGAGGAAGG - Intergenic
1024930362 7:54662670-54662692 CTCTGGAACGCGACGGTGGAAGG - Intergenic
1026439946 7:70435432-70435454 CTCTACCCTGCCATGGTGGGAGG + Intronic
1026804669 7:73422403-73422425 ATCTGCCATGTGCTGGTGTAAGG + Intergenic
1027699111 7:81447620-81447642 ATCTGCTATGTGATGGTGGTGGG + Intergenic
1027890065 7:83961723-83961745 CTCTGCCATGCGGTGGAACATGG - Exonic
1029673044 7:102047223-102047245 CTCTGTTAAGTGATGGTGGATGG + Intronic
1029870772 7:103690431-103690453 CTCTGTCATGTGGTTGTGGATGG - Intronic
1033616502 7:143021561-143021583 CTGTGTCATTCCATGGTGGAAGG - Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034397999 7:150842028-150842050 CACTGCCAGGGGATGGGGGAAGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1035813671 8:2515154-2515176 CTCTGCCCTGGGATGGAGGTGGG + Intergenic
1036535194 8:9643337-9643359 CTGTGTCATCCCATGGTGGAAGG + Intronic
1038725296 8:30076781-30076803 CTGTGTCATCCCATGGTGGAAGG - Intronic
1039146022 8:34448212-34448234 CTCTGCCAGGCTTTGGTGTAAGG + Intergenic
1042056907 8:64773763-64773785 CTCTGTCATAACATGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1047134583 8:122061949-122061971 CTCTTCCTTGCAATGGTGTAAGG - Intergenic
1047471827 8:125181676-125181698 CTCTGACCTGCTAGGGTGGAGGG + Intronic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1052866217 9:33466134-33466156 CTCTGCCAGGCGCAGCTGGAAGG + Exonic
1053754145 9:41286091-41286113 CAGTGGCATGCGATTGTGGATGG - Intergenic
1056735988 9:89209714-89209736 CTCAGCCATTGGGTGGTGGATGG - Intergenic
1058349822 9:104008874-104008896 CTTTGCAGTGCGATGGTGGTTGG + Intergenic
1058371644 9:104275899-104275921 TTCTGTCATGTGATGGAGGATGG - Intergenic
1060937444 9:127523889-127523911 CTCTGACATCCTCTGGTGGAGGG - Intronic
1061527491 9:131178896-131178918 CTCTGCCATGCCATGTTTGAGGG + Intronic
1061785666 9:133026522-133026544 CTGTGCCATAACATGGTGGAGGG + Intergenic
1061935139 9:133853318-133853340 CTCGGCCAAGAGAGGGTGGAAGG + Intronic
1062145176 9:134985074-134985096 ATCTGCCATGAGATGGGGCAAGG + Intergenic
1062589837 9:137268677-137268699 CTGTGTCATCCCATGGTGGAAGG + Intronic
1062740688 9:138173370-138173392 CTCTGCCTTGGGATGGTCAAGGG - Intergenic
1186236828 X:7521102-7521124 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1188520075 X:31029146-31029168 CTGTGTCATCCCATGGTGGAAGG - Intergenic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188760391 X:34021157-34021179 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1189619323 X:42818730-42818752 CTCTGCCCTCTGCTGGTGGAGGG - Intergenic
1192172592 X:68866260-68866282 CTCTGCCATGTGCTTGGGGAGGG - Intergenic
1192272808 X:69599346-69599368 TTCTGCCATGGGATGGATGATGG - Intergenic
1193219781 X:78910516-78910538 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193596542 X:83452309-83452331 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193902284 X:87196069-87196091 CTATGTCATCCCATGGTGGAAGG - Intergenic
1194065098 X:89252206-89252228 CACTGCCAGGGGATGGTGAATGG - Intergenic
1194109304 X:89812602-89812624 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1194633248 X:96312391-96312413 CTGTGTCATCCCATGGTGGAAGG + Intergenic
1194704021 X:97152572-97152594 CTCTGTCATCCCATGGCGGAAGG + Intronic
1195363175 X:104104643-104104665 CTCTGCCAGGCCATCCTGGATGG + Exonic
1200370106 X:155715928-155715950 CACTGCCAGGGGATGGAGGAGGG + Intergenic
1200461967 Y:3467344-3467366 CTGTGTCATTCCATGGTGGAAGG + Intergenic