ID: 1079264149

View in Genome Browser
Species Human (GRCh38)
Location 11:18913864-18913886
Sequence AGGATGAGTGCAACTCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079264143_1079264149 25 Left 1079264143 11:18913816-18913838 CCTATCATGCTGGAATGCTAGTG No data
Right 1079264149 11:18913864-18913886 AGGATGAGTGCAACTCTCTAGGG No data
1079264147_1079264149 -8 Left 1079264147 11:18913849-18913871 CCATGTAAGATCACAAGGATGAG No data
Right 1079264149 11:18913864-18913886 AGGATGAGTGCAACTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079264149 Original CRISPR AGGATGAGTGCAACTCTCTA GGG Intergenic
No off target data available for this crispr