ID: 1079268342

View in Genome Browser
Species Human (GRCh38)
Location 11:18957393-18957415
Sequence GACACACTCGTGACTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079268338_1079268342 29 Left 1079268338 11:18957341-18957363 CCTGAAATTTTCTCTCAGGTGGA No data
Right 1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079268342 Original CRISPR GACACACTCGTGACTAGGAC TGG Intergenic
No off target data available for this crispr