ID: 1079269771

View in Genome Browser
Species Human (GRCh38)
Location 11:18973082-18973104
Sequence GACACCCTCATGACTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079269766_1079269771 28 Left 1079269766 11:18973031-18973053 CCTGAAATTTCTCTCAGGTGGAG No data
Right 1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079269771 Original CRISPR GACACCCTCATGACTAGGAC TGG Intergenic
No off target data available for this crispr