ID: 1079273679

View in Genome Browser
Species Human (GRCh38)
Location 11:19013392-19013414
Sequence CTACCACAGCTGATGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079273679_1079273683 -1 Left 1079273679 11:19013392-19013414 CCAGAGAACATCAGCTGTGGTAG No data
Right 1079273683 11:19013414-19013436 GTATGGTGAGGAACTTGTGGTGG No data
1079273679_1079273684 0 Left 1079273679 11:19013392-19013414 CCAGAGAACATCAGCTGTGGTAG No data
Right 1079273684 11:19013415-19013437 TATGGTGAGGAACTTGTGGTGGG No data
1079273679_1079273682 -4 Left 1079273679 11:19013392-19013414 CCAGAGAACATCAGCTGTGGTAG No data
Right 1079273682 11:19013411-19013433 GTAGTATGGTGAGGAACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079273679 Original CRISPR CTACCACAGCTGATGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr