ID: 1079274977

View in Genome Browser
Species Human (GRCh38)
Location 11:19027003-19027025
Sequence AAGTGTGGCAAGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079274969_1079274977 12 Left 1079274969 11:19026968-19026990 CCAGATGGAGTTTTGTCTGGCAA No data
Right 1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079274977 Original CRISPR AAGTGTGGCAAGGAGGTGGA GGG Intergenic
No off target data available for this crispr