ID: 1079277769

View in Genome Browser
Species Human (GRCh38)
Location 11:19057650-19057672
Sequence TGCAGGGCTTTGAGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079277765_1079277769 -9 Left 1079277765 11:19057636-19057658 CCATGTCTACACTGTGCAGGGCT 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1079277769 11:19057650-19057672 TGCAGGGCTTTGAGGGGAAAAGG 0: 1
1: 0
2: 3
3: 35
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079277769 Original CRISPR TGCAGGGCTTTGAGGGGAAA AGG Intronic
900175829 1:1290991-1291013 AGGGGGGCTTTGAGGGGAGAGGG - Intronic
900383943 1:2400776-2400798 TCCAAAGCCTTGAGGGGAAAAGG + Intronic
902252430 1:15163130-15163152 TTCCAGGCTTTGGGGGGAAACGG + Intronic
902488292 1:16762482-16762504 TGCAGGGCTTTAAGGAGAGAGGG - Intronic
902558565 1:17261494-17261516 TGCAGGGCTCTGAGGTCAGATGG - Intronic
903077178 1:20780177-20780199 CTCAGGAATTTGAGGGGAAAGGG + Intronic
903304394 1:22402475-22402497 GGCAGGGCTTGCAGGGGAATGGG - Intergenic
903504687 1:23825185-23825207 TCAAAGGATTTGAGGGGAAAAGG + Intronic
903672554 1:25045367-25045389 AGCAGGGCTTTGGGGCCAAAAGG - Intergenic
904045395 1:27605279-27605301 TGCAGGGCTTGCAAGGGACACGG + Intergenic
904611766 1:31729696-31729718 AGCAGCGCTTTGAGGGGTCAAGG - Intronic
904768871 1:32870276-32870298 TGCAGGGCTTTGAGAGGTCCTGG + Intronic
905170112 1:36104957-36104979 AGCAGGGATTCGAGGGGAAGTGG - Intronic
905650880 1:39656154-39656176 TGCAGGGCTTGTTGGGGAAGTGG + Intergenic
906048049 1:42847465-42847487 TGCAGAGATCTGGGGGGAAAAGG - Intronic
906716384 1:47972817-47972839 TGAAGGGCATTGAGGGGAGTGGG - Intronic
907490978 1:54808625-54808647 TGGAGGGCTTTGACAGGAAGAGG + Intronic
907501421 1:54884404-54884426 TGCATCACTTTGAGGGGAAGAGG + Intronic
907701058 1:56788749-56788771 TGCAGTGCTCTCAGGGGAAGTGG + Intronic
908399501 1:63757519-63757541 TACAGTTCTCTGAGGGGAAAAGG + Intergenic
908406601 1:63820258-63820280 TGCAGGGCTTGCAGGGGGACAGG - Intronic
910731796 1:90405947-90405969 TGAAGGGCCCTGAGGGTAAATGG + Intergenic
910836171 1:91514015-91514037 TGCAGGGCTCTCATGTGAAATGG - Exonic
912576921 1:110680601-110680623 AGAAGGGCTTGGAGGGGGAATGG - Intergenic
912704551 1:111902264-111902286 TGCAGGGATTAAAGGGGTAACGG + Intronic
913179900 1:116311285-116311307 TGCAGAGCATGGAGGAGAAATGG + Intergenic
913473398 1:119213422-119213444 TGTCGGGGTTTGGGGGGAAAGGG + Intergenic
914306680 1:146426348-146426370 AGCAGGGGTTTGGGGGGAACTGG - Intergenic
914595369 1:149146454-149146476 AGCAGGGGTTTGGGGGGAACTGG + Intergenic
915597688 1:156904790-156904812 CGCAGGGCTCTGAGGGGAGCAGG - Exonic
916595390 1:166237432-166237454 TGCACTGCTTTAAGGCGAAAAGG - Intergenic
917476011 1:175369691-175369713 TTCAGGGCTTTTAGGAGGAATGG + Intronic
917910607 1:179641017-179641039 GGCAGAGCTTTGAGGTGGAATGG + Intronic
920191557 1:204197079-204197101 CGCAGGGTTTTGAGGTGAATAGG + Intergenic
921303794 1:213775029-213775051 AGAAGGTCTTTGAGGGGACATGG + Intergenic
922213494 1:223502657-223502679 GGAAGGGCTTTCAGGGGAATGGG + Intergenic
922505846 1:226125120-226125142 GGCTGGGATTTGAGGGGAAGAGG + Intergenic
923532150 1:234820031-234820053 TGCAGGGCTTTAAGGAGAGAGGG + Intergenic
924299865 1:242626431-242626453 TGAAGGGCTCCAAGGGGAAAGGG - Intergenic
1063403596 10:5771704-5771726 TTCAGGGCTTTGATATGAAAGGG - Intronic
1063674864 10:8131846-8131868 TGCAGTGCTATGAAGGGAATGGG + Intergenic
1064637937 10:17387704-17387726 TGCAGAGAAATGAGGGGAAATGG + Intronic
1065101157 10:22334669-22334691 TGGAGGGCTTCGGCGGGAAAAGG - Intergenic
1065356208 10:24844532-24844554 TGCAGGGCTTTGGGAGGCCAGGG + Intergenic
1065495146 10:26319888-26319910 TGCGGGGCAGTGAGGGGCAAGGG - Intergenic
1067294557 10:44967828-44967850 TGCAGGGCCCAGTGGGGAAATGG + Intronic
1067412746 10:46079184-46079206 GGCAGGTCTTTATGGGGAAAAGG + Intergenic
1071450281 10:85787033-85787055 TGCAAGGCATTGATGGGAGATGG - Intronic
1072717854 10:97763291-97763313 GGCAGGGCTGAGAGGGGAGAAGG + Intergenic
1072865664 10:99058386-99058408 TTCAGGTCTTTGTGAGGAAATGG - Intronic
1073207646 10:101777055-101777077 AGTGGGGCTTTGAGGGGGAAAGG - Intronic
1073472477 10:103731464-103731486 TGAAGGTCTTTAAGGAGAAAAGG + Intronic
1073805024 10:107088234-107088256 TGCAGAGTATTCAGGGGAAAGGG - Intronic
1073964864 10:108977747-108977769 TGCAGGCCTAGGAGGGAAAATGG + Intergenic
1074237645 10:111602018-111602040 TGCAGGTCTTTTAGGGAAAAGGG - Intergenic
1074702427 10:116104305-116104327 AGCAGGGATTTGAGGGGAGCAGG - Intronic
1074853749 10:117458294-117458316 TGCAGGGCTTCCTGGGGGAAGGG + Intergenic
1075065007 10:119283405-119283427 TGCAGGGCTTGGAGGGGTGCAGG - Intronic
1075220322 10:120579132-120579154 TGCAGGGACTTGAGGGGTCAGGG - Intronic
1075298700 10:121300842-121300864 TGCAGAGCTGAGAGGGGAGAGGG + Intergenic
1075767356 10:124904218-124904240 TGCAGGGCTGTAATGGGATAAGG - Intergenic
1076577498 10:131479454-131479476 TGCATGGCTCTGAGGGGAGGAGG - Intergenic
1077031453 11:469765-469787 GCCAGGGCTCTGAGGAGAAATGG + Intronic
1077051646 11:569242-569264 TGCCGGTCTTTGAGGGGACGAGG + Intergenic
1077302581 11:1854105-1854127 GGTAGGGCTTTGAGGGGCAGAGG + Intronic
1077347756 11:2071983-2072005 TGCAGGGCTCTGAGCAGAAGAGG - Intergenic
1077400285 11:2352257-2352279 TCTAGGGCTTTGAGGGCAGAAGG - Intergenic
1077702976 11:4458708-4458730 TCCAGGTAATTGAGGGGAAAAGG + Intergenic
1077846772 11:6033719-6033741 TGAATGGCTATTAGGGGAAAAGG + Intergenic
1078491626 11:11774841-11774863 AGCAGGGGTCTGAAGGGAAAAGG - Intergenic
1078551815 11:12286263-12286285 TGGGGGGCTCTGTGGGGAAAGGG + Intronic
1079027488 11:16960637-16960659 TGCAGGGCAAAGAGGAGAAAGGG + Intronic
1079029733 11:16977567-16977589 TGCTGGGCACTGAGGGGATATGG - Intronic
1079277769 11:19057650-19057672 TGCAGGGCTTTGAGGGGAAAAGG + Intronic
1084189987 11:67494470-67494492 GGCGGGGCATTGAGGGAAAAGGG + Intronic
1084215733 11:67645937-67645959 TTCAGTGGTTTAAGGGGAAAGGG + Intronic
1084272352 11:68036130-68036152 AGGAGGCCTTTGAGGGGAGAGGG + Intronic
1086943181 11:92819041-92819063 TGCAGGGCTATTATGAGAAATGG - Intronic
1088715712 11:112547430-112547452 TCCAGGGCTCTGAGAGGAAGGGG - Intergenic
1091394504 12:145576-145598 TGCTGGGCTTTGCTGGGAAGGGG + Intronic
1091454999 12:600198-600220 GTCAAGGCTATGAGGGGAAAAGG + Intronic
1091473552 12:752036-752058 TGCAGGGCTGTGAGGGTGGAAGG - Intergenic
1093445376 12:19250887-19250909 CGCAGGGCTTGGGGGGAAAATGG + Intronic
1095978654 12:47957567-47957589 TGGAGGCCTTGGAGGGAAAATGG + Intergenic
1097284702 12:57868507-57868529 GGCAGGGCAGTGAGGGGAAAGGG + Intergenic
1100138718 12:91589341-91589363 TGCAGCACTTTGAAGGTAAAAGG - Intergenic
1101092827 12:101305077-101305099 TGCAGGGAGTTGTGGGGAGACGG - Intronic
1103996177 12:124831655-124831677 GGCAGGGGGTTGAGGGGACAGGG - Intronic
1104000014 12:124854434-124854456 GTCAGGGCTTTGAGGGGAGGAGG + Intronic
1104688988 12:130810492-130810514 AGCAGGGCTTCCTGGGGAAATGG + Intronic
1105546947 13:21357634-21357656 TGCAGGTTTTTGTGTGGAAAAGG - Intergenic
1105932583 13:25066992-25067014 TGCAGGGCTCAGCGGGGAAATGG - Intergenic
1106717880 13:32409806-32409828 TGGAGGGCTTGTAGGGGAGAAGG + Intronic
1106911116 13:34464625-34464647 AGCAGGACTTTGAGGACAAAAGG + Intergenic
1107564635 13:41589584-41589606 TCCAGTGCTTTGTGGGGAGAGGG - Intronic
1107955613 13:45508137-45508159 AGCACAGATTTGAGGGGAAAGGG - Intronic
1108756944 13:53514526-53514548 TGGAGGGCTCGGAGGGGAAATGG - Intergenic
1111935295 13:94551021-94551043 TGCAGTGTTTTGAGGAGAATGGG - Intergenic
1112051988 13:95652241-95652263 AGCAGGGCTTAGAGGGAAATTGG + Intergenic
1112308834 13:98300124-98300146 TACAGTGCTCTCAGGGGAAAGGG - Intronic
1113330764 13:109325010-109325032 TGCAGGGCCATGCGAGGAAAGGG - Intergenic
1113834156 13:113317938-113317960 TCCAGGGCTTTGAGAGGCCAAGG - Intronic
1114666655 14:24381399-24381421 TGCAGCACTTTGTGGGGAATTGG - Intergenic
1114826290 14:26084494-26084516 TGCAGAACTAAGAGGGGAAAAGG - Intergenic
1115080027 14:29439034-29439056 TGCTAGTCTTTGTGGGGAAAGGG - Intergenic
1115804070 14:37031301-37031323 TGAAAGGCTTTAAGAGGAAAAGG - Intronic
1118578543 14:67269635-67269657 TGCAGTGTTTTGGGGGGTAAAGG - Intronic
1119527522 14:75334075-75334097 TCCAGGGCTTTAGGGGAAAAGGG + Intergenic
1120378342 14:83739970-83739992 TCCGGTACTTTGAGGGGAAAAGG + Intergenic
1120571483 14:86122636-86122658 TAGAGGGATTGGAGGGGAAAAGG + Intergenic
1120646603 14:87081931-87081953 AGCAGGCATTTGAAGGGAAAGGG - Intergenic
1121526906 14:94625506-94625528 TGGAAGGCTTTGAGGAGAATGGG + Intergenic
1121956402 14:98217521-98217543 TGAAGGGGTTTCAGGGGGAAAGG - Intergenic
1122166763 14:99831224-99831246 AGCAGGGCTTTGAAGTGGAAAGG + Intronic
1122249360 14:100427252-100427274 TGGAGGGCTTCGTGGGAAAAGGG - Intronic
1123678187 15:22734137-22734159 TGCAGGGCAGTGAGGTGAGAAGG + Intergenic
1124330382 15:28808404-28808426 TGCAGGGCAGTGAGGTGAGAAGG + Intergenic
1125995148 15:44152234-44152256 TGCAGGTTTTTGACTGGAAAAGG - Intronic
1126337895 15:47606382-47606404 TCCAGGGGTTTGAGGGAACAGGG + Intronic
1126404941 15:48314046-48314068 TACAGGGCACTGAGGGGACATGG + Intergenic
1128412698 15:67415179-67415201 TGCAGGGCTTTGGGGCGATCAGG + Intronic
1128521328 15:68376780-68376802 TTCAGGGTTTTGAGGGGCAGTGG + Intronic
1128638313 15:69317372-69317394 TGCAGGGCACAGATGGGAAAGGG - Intronic
1128746755 15:70120178-70120200 TGCAGAGCTCTGAGGGAAACAGG + Intergenic
1129091277 15:73153427-73153449 TCCAGGGTTTTGGGGAGAAATGG - Intronic
1129151782 15:73693688-73693710 TGCAGGGCTTTGATAAGGAAGGG + Intronic
1129242359 15:74259185-74259207 GGCAGGTCTTTGGGGGGACAGGG + Intronic
1129892585 15:79081464-79081486 TGCAGGGCTCTGAGTGGGAAAGG - Intronic
1130105719 15:80927215-80927237 TGAAGGGCATTTAGGGGAAGGGG + Intronic
1130863432 15:87910804-87910826 TGCAGGGGGTGCAGGGGAAAGGG + Intronic
1131206433 15:90452284-90452306 TGCAGGACAATGAGGGAAAAAGG + Intronic
1131441113 15:92460539-92460561 TGGGAGGCTTTGAGGGGCAAAGG - Intronic
1132015634 15:98314034-98314056 TGTCGGGGGTTGAGGGGAAAAGG - Intergenic
1132117157 15:99145843-99145865 TCCTGGGCTTTGCAGGGAAATGG + Intronic
1134139594 16:11706504-11706526 TGCTGTGCTTTGAGCAGAAATGG + Intronic
1135404545 16:22189109-22189131 TGCAGGGCTTTGGGGAGCACAGG - Intronic
1135932898 16:26754320-26754342 TGCAGGGCTTTGCAGGGCATGGG + Intergenic
1136135974 16:28257147-28257169 TCCAGGGCTTTGAGGAGGAAGGG - Intergenic
1136247213 16:28982992-28983014 GGCTGGGCTTTGAGGGGTAGAGG - Intronic
1136615016 16:31393333-31393355 AGCAGCGCGTTGAGGGGAAGTGG - Exonic
1136617903 16:31410046-31410068 TCCATGGCTTTGATGGGGAAGGG + Intronic
1137251813 16:46746842-46746864 TGCAGGGCAGGGAGGGGAAGGGG + Intronic
1137390535 16:48077577-48077599 TGCAGGGTTTTACGGGGACAGGG + Intergenic
1138180643 16:54938225-54938247 TGCAGGGTTATTAGGGGAAAGGG + Intergenic
1138446954 16:57070579-57070601 TGAGGGCCCTTGAGGGGAAATGG + Exonic
1138455282 16:57117388-57117410 TCCAGGGCTAGGAGGGGGAAGGG - Intronic
1139267439 16:65653186-65653208 AGCATGGGTTTGGGGGGAAAGGG + Intergenic
1140032924 16:71352784-71352806 GGCAAGGCTGTCAGGGGAAATGG + Intergenic
1141355772 16:83345336-83345358 AGCAGGGCTTTGATGAGAATTGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142997460 17:3769291-3769313 TGCAGGGCCTGGAGGGGATCAGG - Intronic
1143644787 17:8223268-8223290 TGCAGAGCTTTGAAGAGAAGCGG + Intergenic
1144283146 17:13746482-13746504 GGCAGGGCGGTGAGTGGAAATGG + Intergenic
1144449228 17:15361764-15361786 TGCAGGGCAGTGAGAAGAAAGGG + Intergenic
1144519331 17:15944028-15944050 GGCAGGACTTTGGGGGTAAAAGG + Intergenic
1144637306 17:16918406-16918428 GGAAGGGTTTTGAGGGGAAGGGG + Intergenic
1145071144 17:19809259-19809281 ATCAGGGCCTTGAGGGGAAGGGG + Intronic
1145952224 17:28827806-28827828 TGAAGGGCTTTAAAGGGAAAGGG + Intronic
1146436938 17:32859013-32859035 ATCAGGGCTTTGTGGAGAAATGG - Intronic
1147046929 17:37759523-37759545 TGCAGGACAGTGATGGGAAAAGG - Intergenic
1147794266 17:43031464-43031486 GGCAGGTCCTTGTGGGGAAAGGG - Intergenic
1148128929 17:45250998-45251020 TGCAGGGGATTCTGGGGAAAGGG + Intergenic
1148385272 17:47229861-47229883 ACCAGGGCTTTTAGGGAAAACGG + Intergenic
1148454830 17:47805539-47805561 TGTGGTGCTCTGAGGGGAAAGGG + Intergenic
1148869556 17:50648405-50648427 TGCCTGGCTTTGAGAGGAGATGG - Intronic
1149457179 17:56797420-56797442 TGCAGGATATTGAGGGGAAGAGG - Intronic
1149665424 17:58361820-58361842 TGCAGGTATCTGAGGAGAAAGGG - Intronic
1152249836 17:79206567-79206589 AGCAGGGCTTAGAGGAGACAAGG - Intronic
1152703212 17:81829746-81829768 TGGAAGACTTTGAGGGGAAGGGG - Intronic
1153226411 18:2903298-2903320 TGCTTGGATTAGAGGGGAAAGGG + Intronic
1155380557 18:25217829-25217851 CACAGGGCATTGAGGGGATAGGG + Intronic
1155383958 18:25256697-25256719 TGCAGTCCTTTGTGAGGAAATGG + Intronic
1156048771 18:32906998-32907020 TGCAGGGCTTTGCAGGGTTAGGG - Intergenic
1156297584 18:35806935-35806957 TGTAGGGAACTGAGGGGAAATGG - Intergenic
1156409825 18:36817121-36817143 TGATGGGCTATGAGTGGAAATGG + Intronic
1156463491 18:37334593-37334615 GGGAGGGCTTGGAGGGGGAAGGG - Intronic
1156849622 18:41711358-41711380 TGCAAGGTTTGGTGGGGAAAGGG - Intergenic
1157317330 18:46603279-46603301 AGCAGGGAGTTGAGGGGAGAGGG + Intronic
1157445430 18:47743130-47743152 TTCAAAGCTCTGAGGGGAAATGG - Intergenic
1157585579 18:48799043-48799065 AGCAGGGCTATGAGTGGAGAAGG + Intronic
1157802483 18:50632136-50632158 TTCATGCCGTTGAGGGGAAAAGG + Intronic
1159838227 18:73366803-73366825 TGCCAGGCATTCAGGGGAAATGG + Intergenic
1159942201 18:74416988-74417010 TGGGAGGCTTTTAGGGGAAAGGG - Intergenic
1160214301 18:76914108-76914130 TTCTGGGCATTGAGGGGAAATGG - Intronic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162548794 19:11346815-11346837 TGGGAGGCTTGGAGGGGAAAAGG - Intronic
1163407000 19:17128998-17129020 TGCATGGCCTTGACGGGACAGGG + Intronic
1163414923 19:17180694-17180716 GGCAGGGCTTTGAGGCAAATTGG - Intronic
1163529396 19:17841065-17841087 CGCAGCGCTTTGAGGGGCCAAGG - Intronic
1164360027 19:27496004-27496026 CGGAGGGCTTTGAGTGAAAAAGG + Intergenic
1164454998 19:28399552-28399574 TGCATGGCTTTCTGGGGAGAAGG - Intergenic
1164615515 19:29665123-29665145 TGCGGGACTTGGCGGGGAAAGGG - Exonic
1164716193 19:30392101-30392123 TCCAGGACTCTGAGGGGAGAAGG + Intronic
1164802844 19:31092010-31092032 TCCAGGGCTTTGGGGGGACTGGG - Intergenic
1165160897 19:33815557-33815579 GGCAGGGGTTTGGTGGGAAACGG - Intronic
1167442045 19:49514112-49514134 TTCAAAGCTTTGGGGGGAAAAGG + Exonic
1167658763 19:50783434-50783456 TGGAGGGCTGTGAGGAGAAAGGG + Intergenic
1167792336 19:51689978-51690000 TGCGGGGCTTTGAGGGGTCAAGG + Intergenic
1168187516 19:54709479-54709501 TGCAGGGCCAGGAGGGGAGAAGG + Intergenic
1168686555 19:58352660-58352682 TGGAGGGCATTGCTGGGAAAAGG + Intronic
1202702905 1_KI270713v1_random:1758-1780 TGCAGGGCTTTAAGGAGAGAGGG + Intergenic
926123715 2:10258479-10258501 GGCAGGACCTTGAGGGGAAGGGG - Intergenic
926660766 2:15463527-15463549 TGAGGGACTTTGAGGGGAAATGG - Intronic
927991900 2:27453946-27453968 TGCAGGGCCATGAGGGGAGGGGG - Intronic
928023330 2:27720897-27720919 TGAAGGGCATTGAGGGGACACGG + Intergenic
928432428 2:31232081-31232103 TGCAGGGATTTCAGGGGAGGGGG - Intronic
929045072 2:37781127-37781149 TGCACGGCTTTCAGGGGAGATGG + Intergenic
929655180 2:43723784-43723806 TGGAGGGCTTTGAGCGGAACAGG + Intronic
930385881 2:50694255-50694277 TCCAGAAATTTGAGGGGAAAAGG + Intronic
930711860 2:54557675-54557697 TGCAAGGCATTGTGGGAAAAAGG - Intronic
931620729 2:64206956-64206978 TGCTCTGCTTTGAAGGGAAAAGG - Intergenic
931622803 2:64228301-64228323 TGAAGGGATTTGAGGGGCGAAGG - Intergenic
931772260 2:65507769-65507791 TGCAGGTCTTTGTGTGGACATGG + Intergenic
931972701 2:67607057-67607079 AGCAGGGCTTTGAGCAAAAAAGG - Intergenic
932105318 2:68936495-68936517 TCCAGGGCTTTGAGGGTTACAGG - Intergenic
932474711 2:71995679-71995701 TGAAGGGTTTTAAGGGGATAAGG + Intergenic
932657907 2:73626350-73626372 TGCCAGGGTTTGAGGGGAAGGGG - Intergenic
932664587 2:73686689-73686711 TGCCAGGGTTTGAGGGGAAGGGG - Intergenic
932875396 2:75445850-75445872 TGCAAGACTTAGAGGGTAAAGGG - Intergenic
933403428 2:81827802-81827824 TGCATTGCTTTTAGGGGACAAGG - Intergenic
933448376 2:82412618-82412640 TGCAGTGTTTTGAAGTGAAAAGG + Intergenic
934308765 2:91845170-91845192 TGCAGGGGCTTGGGGGGAACTGG + Intergenic
938116880 2:128608327-128608349 GGCAGGGCTCTGAGTGGAAAGGG - Intergenic
938380897 2:130836186-130836208 TGCAGGGGTTTAAGGAGACAGGG - Intergenic
938770834 2:134499453-134499475 TCCAGGGCTGTGTGGGCAAATGG - Intronic
939953256 2:148501385-148501407 AGCAGGGGTTGGAGGAGAAATGG + Intronic
941201947 2:162523288-162523310 TGAAGGGCTTTGGTGGGAGAAGG - Intronic
941203691 2:162545492-162545514 TGCTGGGCCATGAGAGGAAAGGG + Intronic
942187437 2:173437849-173437871 AGCAGGCCCTTGAGGAGAAACGG + Intergenic
943289881 2:186055676-186055698 TGCTGGTCTTCCAGGGGAAATGG - Intergenic
943386458 2:187208561-187208583 AGCATGGCTTTGAGGGGAGGGGG - Intergenic
944282187 2:197910688-197910710 TTAAGGGAATTGAGGGGAAAGGG - Intronic
944475118 2:200095673-200095695 TGCAGAGCGAAGAGGGGAAAAGG - Intergenic
945017288 2:205532476-205532498 GGCAGTGCTTGGGGGGGAAATGG + Intronic
945992382 2:216406968-216406990 TGCAATGCTTTGGGTGGAAAAGG - Intergenic
946513955 2:220391573-220391595 TGAATGGCTTTGAAGGGAGAGGG + Intergenic
947389343 2:229623366-229623388 GGCAAGGATTTGAGGGGAAATGG - Intronic
947949743 2:234136827-234136849 TGCAGGGCTTGGAGTGGAGGAGG - Intergenic
947976314 2:234369227-234369249 TGCAGTGCTTTTAAGGGAACTGG + Intergenic
948971392 2:241430320-241430342 GGCTGGGCTCTGTGGGGAAATGG - Intronic
1168909807 20:1438725-1438747 TGGAGGGCTTTGAGTGCACAGGG - Intergenic
1170605828 20:17874468-17874490 TGCAGGGCTCTAAAGGGATAAGG - Intergenic
1171942504 20:31345012-31345034 TACAGCCCTTTGAGGTGAAATGG - Intergenic
1172126608 20:32628276-32628298 TGCAGGGCCCTGAGGGGCAGTGG - Intergenic
1172646608 20:36474267-36474289 TGCAGGGCTCTTATGGGGAAAGG + Intronic
1172825394 20:37778762-37778784 TGGAGGGCTTTGAGGGGAGTTGG + Intronic
1172967268 20:38845879-38845901 CGCAGGGCTGTGAGGGGAGCAGG + Intronic
1173403704 20:42746876-42746898 TGCAGGGCTCTTGGGGGAATGGG + Intronic
1174280747 20:49437381-49437403 TGGAGGGCTTTGAGCAGAAGAGG + Intronic
1174304415 20:49605023-49605045 GGCAGGGCTTTGAGAGGACAGGG - Intergenic
1174411690 20:50340661-50340683 TGCAGGGTTTTGTGGTGAGAAGG + Intergenic
1175136759 20:56830036-56830058 TGCAGGGATGTGTGGAGAAATGG - Intergenic
1175160232 20:57002880-57002902 TCCATGGCTTTGAGGGGAGATGG - Intergenic
1175538035 20:59729087-59729109 CACAGGGCTTTGAGGGCCAAAGG + Intronic
1177327833 21:19615211-19615233 TTCAGGGCTGATAGGGGAAAGGG - Intergenic
1178998110 21:37426055-37426077 TGTAGGGCTTTGACTGGGAATGG - Intronic
1179001829 21:37468355-37468377 TGCAGGGCTTTGGGAGGCCAAGG - Intronic
1181988822 22:26821093-26821115 TGAAGGGCTATGAGGGAAAAGGG + Intergenic
1183118735 22:35713131-35713153 AGCAGGGCTTTGGGAGGAAGAGG - Intergenic
1183476647 22:38039364-38039386 TGCAGGGCTGTGAGGGGACGTGG - Intronic
1184037559 22:41925983-41926005 AGAAGGGCTTTAAGGGGAAACGG - Intronic
1184383593 22:44161699-44161721 TACAGGGCTGGGAGGGGAAAGGG + Intronic
1184569293 22:45311647-45311669 TGAAGGGCTTTGGGAGGAGAGGG + Intronic
1184974692 22:48052679-48052701 TGCAGGGTTTTCAGGGGAAATGG + Intergenic
1185011389 22:48316560-48316582 GGCAGGGATATGGGGGGAAAGGG + Intergenic
1185075853 22:48681871-48681893 GGCTGGACATTGAGGGGAAATGG + Intronic
1185082869 22:48719289-48719311 TGGAGGGCTCCGAGGGGAACGGG - Intronic
1185229506 22:49672108-49672130 TGCCAGGCTGTGAGGGGAGAGGG + Intergenic
949510386 3:4761836-4761858 TGCAGGGCTTGGGTGGGGAATGG - Intronic
949605581 3:5649640-5649662 TGCTGGGAGTTGAGGGGAGAGGG + Intergenic
950021487 3:9791144-9791166 TACAGGGGTTTGTGGGGAGAGGG - Intronic
950250301 3:11459649-11459671 TAATGGGCTTTGTGGGGAAAAGG + Intronic
950503613 3:13379441-13379463 TTCAGACCGTTGAGGGGAAACGG + Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
952329104 3:32347488-32347510 GGCAGGGCTTGGAGGGGGCAGGG + Intronic
952636393 3:35537854-35537876 TACTGGGTTTTGAGAGGAAATGG + Intergenic
953971161 3:47348133-47348155 TGCTGGACTTTGGGGTGAAATGG - Intergenic
954337983 3:49931057-49931079 TGTAGGGCTTAGAGAGGAAAAGG - Intergenic
954693031 3:52405925-52405947 TCCAGGGCTCAGAGGAGAAAGGG + Intronic
955872162 3:63450783-63450805 TGCAGGGCTTTGCCAGGAGATGG + Intronic
956002087 3:64740290-64740312 AGGAGGGCTTTGTTGGGAAATGG + Intergenic
956036590 3:65099547-65099569 TGCAGAGATTTAAGGGGAAGTGG + Intergenic
956747367 3:72320437-72320459 TGGAGGACCTTGAGGGGAAAAGG + Intergenic
960052552 3:113252317-113252339 AGCAGGGCTTTCAGGGATAACGG - Intronic
960666050 3:120109869-120109891 GTCAGGGTTTTGATGGGAAATGG + Intergenic
961240835 3:125409920-125409942 ATCAGGGCTTCTAGGGGAAATGG - Intergenic
961265048 3:125634914-125634936 CGCAGGGCTTGGTGGGGAGAAGG + Intergenic
961511589 3:127407037-127407059 TGGAGGGCTCTGAGAGGAGAGGG - Intergenic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
962464031 3:135640075-135640097 CCCAGTGCTTTGAGGGGACAAGG - Intergenic
962881233 3:139578799-139578821 TGCAGAGCTTACAGGGTAAAAGG - Intronic
963924446 3:150936792-150936814 TGCTGGGTAGTGAGGGGAAATGG - Intronic
965361134 3:167739622-167739644 TCCAGGGCCTTGAGGTTAAATGG - Intronic
965771300 3:172184168-172184190 AAAAGGGCTTTGAGGGGAATGGG - Intronic
966090610 3:176130939-176130961 TGCAATGAATTGAGGGGAAATGG + Intergenic
966179128 3:177171754-177171776 TCCAGGGCTTTTTGGAGAAATGG + Intronic
967043246 3:185713510-185713532 GGCAGGGGTTTGAGGGGAGTGGG + Intronic
967135352 3:186508549-186508571 TGCAGGGCATTCAGGGCGAAGGG - Intergenic
967810544 3:193757004-193757026 TGCAGGGATTAGAGGGGAAATGG - Intergenic
967858015 3:194133023-194133045 TGCAGGGCTTGGAGGCAGAAAGG - Intergenic
969520365 4:7674658-7674680 GGCAGGGCAGTGAGGGGAAGGGG + Intronic
970100953 4:12521905-12521927 GGCAGAGCATTGAGGGGAATGGG - Intergenic
970609875 4:17714980-17715002 TGCAGGGAGGTGAGGGGAAGGGG - Intronic
970996610 4:22274857-22274879 TTCGGGGACTTGAGGGGAAAGGG + Intergenic
971589485 4:28449261-28449283 TGCATTGCATTGTGGGGAAAAGG - Intergenic
971615824 4:28789226-28789248 GCCAGGGTTTTGAGGGGAAGAGG - Intergenic
972835720 4:42867835-42867857 AGCTGGGCTTTTATGGGAAATGG - Intergenic
974379577 4:61121449-61121471 TGGAGGGCATGGAGGGGGAAAGG - Intergenic
974624921 4:64413233-64413255 TCCAGGGCTTAGAGGGGCTAAGG - Intergenic
976938170 4:90665624-90665646 TGCTGAGATTTGAGGGGTAAAGG + Intronic
976981068 4:91229829-91229851 TGTCGGGGGTTGAGGGGAAAAGG + Intronic
979572352 4:122242780-122242802 AGCAGGGTTGTGAGGGTAAAAGG - Intronic
980218783 4:129886691-129886713 AGCAGAGCTTTCAAGGGAAATGG + Intergenic
982719971 4:158849202-158849224 TGGCGGGCTTTGGGGGAAAAGGG + Intronic
985190466 4:187367039-187367061 TGCAGGGCTGTGATGAGGAATGG - Intergenic
986028200 5:3870944-3870966 TGCAGGGCTCTGTGTGGAACAGG + Intergenic
989731376 5:44654158-44654180 TGGAGGTCTTGGAGGGAAAATGG - Intergenic
990737777 5:58882229-58882251 TTCAGGGCTAGGAGTGGAAATGG + Intergenic
991193874 5:63908848-63908870 TGCAAGGCATTGAGGGAAAAAGG - Intergenic
991632428 5:68669712-68669734 TGCAGGAATGTGAGGGGCAATGG - Intergenic
992882709 5:81126556-81126578 TGCTGGGGTTGGAGGGGGAATGG - Intronic
992910071 5:81387793-81387815 TCCAGTGCTTTGAGGGGCCAAGG - Intronic
994256314 5:97600584-97600606 TGCAGTCCTTTGAGTGGAAGTGG + Intergenic
995486761 5:112647547-112647569 TCCATGGCTGTGAGGAGAAAGGG - Intergenic
995732710 5:115263051-115263073 TCGAGGGCTTTGAGTAGAAAAGG - Intergenic
998185367 5:139975230-139975252 TGCAGTGCTTTCTGGTGAAAAGG + Intronic
998936974 5:147239780-147239802 TGTAGGGCCTTGAAGGAAAAAGG + Intronic
999952708 5:156667426-156667448 TGCTGGGGTGTGTGGGGAAAGGG - Intronic
1000021256 5:157321215-157321237 GGCAGAACTTTTAGGGGAAAGGG - Intronic
1001068590 5:168562306-168562328 GGCAGGGCTTTCAGAGCAAAAGG + Intronic
1002757077 6:172415-172437 TTCAGGGCTGTGATGGGAAGGGG - Intergenic
1002988739 6:2217792-2217814 TCCAGGGCTTTGGGGGGCACTGG - Intronic
1003404742 6:5819083-5819105 TGCAGGTTTTTGTGTGGAAAAGG + Intergenic
1003816412 6:9846026-9846048 TCCAGGGCATTTGGGGGAAAGGG + Intronic
1003962769 6:11224413-11224435 TGCTGGGCTCTGAGTGGAGAGGG + Intronic
1004146486 6:13071813-13071835 TGCATGTCGTTGTGGGGAAAAGG + Intronic
1005252986 6:23968755-23968777 TGTATGGCTTTGAAGTGAAATGG - Intergenic
1006170286 6:32088163-32088185 TGGTGGGCTTGGAGGGGAATGGG - Intronic
1006360208 6:33583467-33583489 GGCAGGGATTTTGGGGGAAAGGG - Intergenic
1007384182 6:41509624-41509646 TGCAGAGCTTTAAATGGAAATGG - Intergenic
1007621170 6:43215496-43215518 TGCAGGCCTCTGATTGGAAAGGG - Intronic
1010422437 6:75690518-75690540 TACTGGGATTTGAGGGGAAGGGG + Intronic
1010651062 6:78455828-78455850 TGGAGGGCTCGGAGGGAAAATGG - Intergenic
1012145254 6:95672260-95672282 TGCAGGCCTTTGAAGGGAGAAGG + Intergenic
1012278969 6:97305901-97305923 TTCTGGGCTTTGATGAGAAAGGG + Intergenic
1012426199 6:99117338-99117360 TGCAGGTGTTTGGGAGGAAAGGG + Intergenic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1015678417 6:135777474-135777496 TTCAAGGGATTGAGGGGAAATGG + Intergenic
1017942185 6:159062712-159062734 TGTAGGGCTTTGGCAGGAAATGG - Intergenic
1018009129 6:159653464-159653486 CCCAGGGCTCTGAGGAGAAATGG + Intergenic
1019665105 7:2248010-2248032 TGCAGGGACTGGAGAGGAAACGG - Intronic
1019752758 7:2742650-2742672 TGCAGGTGTTTGCGGGGACAGGG - Intronic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1022153295 7:27632686-27632708 TGAAGGGAGTTGAGGGTAAAAGG + Intronic
1022865271 7:34411513-34411535 TGCAGGATTCTGAAGGGAAAAGG - Intergenic
1023513746 7:40979824-40979846 TGGAAGTCTTTGCGGGGAAAAGG + Intergenic
1023852039 7:44155841-44155863 TGCAGGGCTGTGGGGAGAACTGG + Intronic
1024132142 7:46364025-46364047 GGCAGGGCATTGAGGAGGAATGG - Intergenic
1024309482 7:47956341-47956363 TGCAGTGCTTCCAGGGGGAAAGG - Intronic
1024347833 7:48330870-48330892 TGAAGTGCATTGAGGGGAATCGG + Intronic
1026374185 7:69733734-69733756 TGCAGGGATTTGGGTAGAAAAGG - Intronic
1026827377 7:73593064-73593086 TGGAGGGCTTTGAGTGGAGGTGG - Intergenic
1026936465 7:74259296-74259318 GGAAGGGCTTTGATGGGAAGGGG + Intergenic
1028591518 7:92500961-92500983 TGCTGGGATTTGAGCAGAAATGG - Intronic
1028808732 7:95059881-95059903 TGCAAGACTTGGAGGGGAGACGG + Intronic
1029452055 7:100646868-100646890 TGCAGGGGTCTGGGGGGAAGGGG - Intronic
1030343498 7:108407565-108407587 GGCAGGGCTGTGATGGGAGAAGG - Intronic
1030364504 7:108630135-108630157 TGCAGGCCTTGGAGGGGAAAGGG + Intergenic
1031172853 7:118313442-118313464 TGTAGGGGGTTGAGGGGCAAGGG - Intergenic
1033653707 7:143360250-143360272 TGCAGGGATATAAGAGGAAATGG - Intronic
1034949310 7:155286210-155286232 TGCAGGGCCTTGAAGAGATACGG - Intergenic
1035635034 8:1138136-1138158 AGAATGGATTTGAGGGGAAACGG + Intergenic
1035963218 8:4159924-4159946 TTTCGGGCCTTGAGGGGAAAGGG + Intronic
1036099444 8:5761847-5761869 AGCAAGGTCTTGAGGGGAAAAGG + Intergenic
1036125211 8:6056166-6056188 TTCAGGGCCTTGAGGTGAATGGG - Intergenic
1036655636 8:10675320-10675342 TGCAGGGCTTGCATGAGAAAAGG + Intronic
1037979707 8:23243412-23243434 TGCAGGGCATTTAGGGGAGGGGG - Intergenic
1038347411 8:26745088-26745110 TGCTGTGCTTTGCAGGGAAAGGG + Intergenic
1040991807 8:53359988-53360010 TGGAGGGGTTTGAGAGGAAATGG - Intergenic
1041765598 8:61415137-61415159 AGAAGTGTTTTGAGGGGAAAAGG - Intronic
1042455141 8:68992724-68992746 TCCTGGGCTTTAAAGGGAAAAGG - Intergenic
1043678420 8:82991355-82991377 TGCAGGGCATTATGGGGAACTGG + Intergenic
1044827741 8:96214421-96214443 GTCAAGACTTTGAGGGGAAATGG + Intergenic
1045525542 8:102938534-102938556 TGGTGGGCTTTGAGAGAAAAGGG - Intronic
1046841138 8:118858520-118858542 TGCAGGGCTTTGTGGGCAATTGG - Intergenic
1048013315 8:130475987-130476009 AGCTGGGCCTTGAAGGGAAAGGG + Intergenic
1048210935 8:132453604-132453626 TGGAGGGTTTGGAGGGGAAGAGG - Intronic
1051094410 9:13449509-13449531 TCCAGGGCTTAGAGAAGAAAGGG - Intergenic
1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG + Exonic
1051503838 9:17806469-17806491 TGTGGGGCTTTGAGGTTAAAGGG + Intergenic
1053170176 9:35872953-35872975 TGGAGGAGGTTGAGGGGAAAAGG - Intergenic
1053609071 9:39692593-39692615 AGCAGGGCTTTGAGTAGAGATGG - Intergenic
1053866916 9:42448863-42448885 AGCAGGGCTTTGAGTAGAGATGG - Intergenic
1054089246 9:60778896-60778918 AGCAGGGCTTTGAGTAGAGATGG + Intergenic
1054244454 9:62649805-62649827 AGCAGGGCTTTGAGTAGAGATGG + Intergenic
1054558581 9:66684348-66684370 AGCAGGGCTTTGAGTAGAGATGG + Intergenic
1054760292 9:68998778-68998800 TTCTGGGCTCTGAGGGGGAATGG + Intronic
1055527546 9:77150290-77150312 TAAATGTCTTTGAGGGGAAAAGG - Intergenic
1055658204 9:78473380-78473402 TTGAGGACTTTGGGGGGAAATGG - Intergenic
1056298413 9:85217157-85217179 TGCAGGCTTTTGAGGGGAGGAGG - Intergenic
1058426603 9:104880773-104880795 TGCAGAGCTCTGAGGAGAGAAGG - Intronic
1060679198 9:125546379-125546401 TACAGCGCTTTGGGGGGAGATGG + Intronic
1061263089 9:129490681-129490703 TGCAGGGCCCTGAGCTGAAATGG - Intergenic
1062048605 9:134435771-134435793 TGCGGGGCTTGTAAGGGAAAGGG - Intronic
1062204349 9:135327552-135327574 GGGAGGGCTTTGAGGGGTCAGGG + Intergenic
1062344603 9:136109101-136109123 TGCAGGGCGGGGAGGGGAGAGGG - Intergenic
1062389998 9:136330075-136330097 AGCAGGGCTTTGGGGTGAAGAGG + Intronic
1062453689 9:136626152-136626174 TGCAGGGCCAGGAGGGGACATGG - Intergenic
1186622442 X:11255809-11255831 TGCAGGCCACTGAGGGTAAATGG + Intronic
1187154366 X:16710073-16710095 TGGCTGGCTTTGGGGGGAAAAGG - Intronic
1187239523 X:17499936-17499958 TGCAGGGCTCTGAAAGGAGATGG + Intronic
1187417238 X:19103900-19103922 TACAAGGTCTTGAGGGGAAAAGG + Intronic
1187966328 X:24615920-24615942 AGCAGGGGTTTGAGGCAAAATGG + Intronic
1188210972 X:27422853-27422875 TGAAGGGGGTTGAGGGGAGATGG + Intergenic
1188303364 X:28532313-28532335 TGGAAGGCTCTGAGGGGAAGAGG - Intergenic
1190752381 X:53373450-53373472 TGCATGGATTTCAGGGGGAATGG - Intergenic
1190958412 X:55220542-55220564 TCCGTGGCTTTGAGGGAAAAGGG + Exonic
1192313090 X:70032493-70032515 TGGATGGCTTAGAGGGGAAAAGG + Intronic
1194744576 X:97614406-97614428 TGCAGAGCTTTGCGAGGATACGG - Intergenic
1196818383 X:119683367-119683389 TTCAGGGCTGAGAGTGGAAATGG - Intronic
1197872067 X:131070152-131070174 TGGAGGGCTTTGAGGAGGAATGG - Intronic
1198863789 X:141098354-141098376 TGCAGATCTTTCTGGGGAAAAGG + Intergenic
1198898899 X:141489061-141489083 TGCAGATCTTTCTGGGGAAAAGG - Intergenic
1199543479 X:148983251-148983273 GGCAGGACTTTGAGGTGACATGG + Intronic
1200688686 Y:6282237-6282259 TGCAGATCTTTCTGGGGAAAAGG + Intergenic
1201046586 Y:9892484-9892506 TGCAGATCTTTCTGGGGAAAAGG - Intergenic
1201291027 Y:12421044-12421066 TGCAGGGCGTGGAGGGGATTCGG - Intergenic
1201438001 Y:13980095-13980117 TGAAGGGCTTTGGGGGCAAGGGG - Intergenic