ID: 1079292362

View in Genome Browser
Species Human (GRCh38)
Location 11:19199764-19199786
Sequence GTCTTAAAGGGCATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079292362_1079292368 11 Left 1079292362 11:19199764-19199786 CCATCCTCAATGCCCTTTAAGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1079292368 11:19199798-19199820 CCCTTCCTGCCATTCTTCACTGG 0: 1
1: 0
2: 3
3: 25
4: 267
1079292362_1079292370 12 Left 1079292362 11:19199764-19199786 CCATCCTCAATGCCCTTTAAGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1079292370 11:19199799-19199821 CCTTCCTGCCATTCTTCACTGGG 0: 1
1: 0
2: 4
3: 33
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079292362 Original CRISPR GTCTTAAAGGGCATTGAGGA TGG (reversed) Intronic
900881973 1:5388738-5388760 GGCTTCAAGGGAATGGAGGAAGG + Intergenic
901067900 1:6503114-6503136 GTTTTAAAGAGCTTTGAGGCTGG + Intronic
902201219 1:14835237-14835259 GCCTTAAAGGGCAGTGAGGAAGG + Intronic
903220807 1:21868804-21868826 GTCATAAAGGGCCTTGACAAAGG + Intronic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
911234026 1:95390793-95390815 GTCTTATATGGTATTGAGCAAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915540316 1:156561925-156561947 GTCTTGAAGGGCCTTGAGCAAGG + Exonic
916537013 1:165712764-165712786 ATCTTATAGGGCATTGTGTAGGG + Intergenic
920417974 1:205811438-205811460 TTCTTAATGGGCATTCAAGAAGG - Intronic
920939441 1:210467651-210467673 GACATAAAGGGCATGGTGGATGG + Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
924133293 1:240935192-240935214 GTCTAAAAGGGCACCGAGGCCGG - Intronic
1066003756 10:31128551-31128573 GTCTTAAAAGACAGTGTGGATGG - Intergenic
1069714451 10:70511729-70511751 ATTTTAAAAGGCATTGAGGGCGG + Intronic
1071974031 10:90937308-90937330 AGCTCAAAGGGCATTGAGTAAGG - Intergenic
1071991305 10:91103108-91103130 GATTGAAAGGGCATGGAGGAAGG + Intergenic
1072184908 10:93027989-93028011 GTCTTTAATGGCATTTAGAATGG - Intronic
1077900438 11:6483074-6483096 GTCTTCACGGGCAATCAGGAAGG + Exonic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1080813931 11:35735417-35735439 GTCTTTCAGGGCGATGAGGAAGG + Exonic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082774672 11:57236066-57236088 GTCGAAAAAGGCATAGAGGAAGG + Exonic
1087188416 11:95227778-95227800 GTGTCAAACTGCATTGAGGAAGG - Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG + Intergenic
1090932604 11:131311797-131311819 CTGTTAAAGGGCTTTGAGGGAGG - Intergenic
1091864237 12:3817295-3817317 GGGTTAAAGGGCATGGAGTATGG + Intronic
1092100843 12:5882667-5882689 GTCTGAAAGAGCAATTAGGAGGG + Intronic
1094193965 12:27726176-27726198 GGCTAAAAGGGGCTTGAGGATGG - Intronic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1095862138 12:46929280-46929302 GGAGTAAAGGGCATTGAGGTTGG + Intergenic
1099793410 12:87364260-87364282 GTCTTAAAGTTAAATGAGGATGG + Intergenic
1100162681 12:91878572-91878594 GTCTGAAAGGTCATTTATGATGG + Intergenic
1101325155 12:103709292-103709314 GACTTTAAGGGCAAAGAGGAGGG + Intronic
1102995588 12:117347582-117347604 GTTTTAAAGGGCAACAAGGAAGG + Intronic
1108667985 13:52652070-52652092 GGGTTAAAGGGCGCTGAGGAAGG + Intergenic
1109606712 13:64706237-64706259 GACATAAAGGGCATGGACGAGGG + Intergenic
1112119268 13:96392092-96392114 GTCAGAAAGGGCATGGAGAAGGG - Intronic
1112590081 13:100754911-100754933 GTTTTAAATGGGATTGATGAAGG - Intergenic
1119120140 14:72068034-72068056 GTCTTAAAGGGAAATGCTGATGG + Intronic
1121689721 14:95868659-95868681 CTCTTAATGGACAATGAGGAAGG - Intergenic
1122297980 14:100716176-100716198 GTGTTTATGGGCATTGAGGAAGG + Intergenic
1125566216 15:40680424-40680446 CACTAAAAAGGCATTGAGGAGGG - Intergenic
1130651198 15:85763070-85763092 GCCTTAAAGGGCCTGGAGTACGG + Intronic
1130654042 15:85779454-85779476 GTATTAAAATGCAATGAGGAGGG + Intronic
1131310085 15:91282853-91282875 GTCTAAAAGGAAATTCAGGAAGG - Intronic
1131464740 15:92646027-92646049 GTCCTGAAGGGCATAGAGAAGGG - Intronic
1131671051 15:94619829-94619851 ATCTGAAAGAGAATTGAGGATGG + Intergenic
1133131861 16:3681047-3681069 GTCTGACTGGGCTTTGAGGAAGG - Intronic
1137298682 16:47124255-47124277 ATCTTAAACGGCATGGCGGAGGG + Intronic
1140407641 16:74721676-74721698 GTGTTCAAGGGCAGTGGGGAGGG - Intronic
1140720374 16:77766085-77766107 GTCTTCCAGGGCATTGAGGAGGG + Intergenic
1141224173 16:82099671-82099693 GTTTGGAAGAGCATTGAGGATGG + Intergenic
1143611825 17:8022296-8022318 CTCTGAAAAGGCAATGAGGAGGG + Intergenic
1146680113 17:34801110-34801132 GTGGTAAAGGGCATGGGGGATGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148398869 17:47336042-47336064 GTCTTAAAGAGAATTTAAGAAGG + Intronic
1152401193 17:80067233-80067255 GTCTCTGAGGGCAATGAGGACGG - Intronic
1156523217 18:37739750-37739772 GTCAGAAGGGTCATTGAGGAAGG + Intergenic
1159228079 18:65566999-65567021 GTCTTCAAGGGCCTTGTGGTGGG - Intergenic
1161666588 19:5580728-5580750 TTCTTAAAGGGCAGAGGGGAGGG + Intergenic
1164752695 19:30668501-30668523 GTCCCAAAGGACACTGAGGAGGG + Intronic
1164961724 19:32437127-32437149 GTTTTAAATGGCACTGAGGAGGG + Intronic
1168192313 19:54748147-54748169 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168196638 19:54779424-54779446 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168202417 19:54825839-54825861 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168207220 19:54859891-54859913 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
925343999 2:3157116-3157138 GTCTTAAAGGGACCTGAGGAGGG + Intergenic
925486386 2:4336964-4336986 TTCTTAAAAAGCAGTGAGGATGG + Intergenic
929253167 2:39780860-39780882 GACTTCAAGGGCTTAGAGGATGG + Intergenic
935037703 2:99395334-99395356 GTCTCAAAGGGAAAGGAGGAGGG - Intronic
936641556 2:114317469-114317491 GTCAAAAGAGGCATTGAGGAGGG - Intergenic
937829563 2:126404561-126404583 ATCTTAGAGTGCACTGAGGATGG - Intergenic
938293296 2:130161631-130161653 GTCTTGAAGGGCAGTGAGTTGGG - Intronic
939541593 2:143501409-143501431 TTCTTAAAAGGCATTGAGTGAGG - Intronic
941134707 2:161699683-161699705 GGATTAAAGGGCTTTGAGAAAGG + Intronic
1170019918 20:11825930-11825952 GTGTTATAGGGCTTTGAAGAGGG - Intergenic
1170317355 20:15057031-15057053 GAATTAAATGGAATTGAGGATGG + Intronic
1171030130 20:21669526-21669548 GCCTTACAGGGGGTTGAGGATGG + Intergenic
1173820714 20:46018516-46018538 GTCATAAATGGCTTTGAAGAGGG - Intergenic
1175124609 20:56741953-56741975 GTCTTTATGGGGATTGAGGGTGG + Intergenic
1180559818 22:16607043-16607065 GTTATAAAGGACATTAAGGATGG + Intergenic
1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG + Intergenic
949458024 3:4260166-4260188 GTCATAAAGGGAATAGAAGAGGG + Intronic
950396286 3:12736651-12736673 GTCTGGAAGGGCAGTGAGGGAGG + Exonic
950545897 3:13637725-13637747 ATCATCAAGGGCAATGAGGAGGG + Exonic
951499741 3:23371819-23371841 GTCTTAAAAGTCATTGAGACTGG + Intronic
951722889 3:25720716-25720738 GTGCTAAAGGGCGTTGATGAAGG - Intronic
956378230 3:68638464-68638486 ATCTCAAAGGGCATTGCAGAGGG + Intergenic
960104351 3:113777924-113777946 GTCAGAGAGGTCATTGAGGATGG + Intronic
961789539 3:129365835-129365857 CTCTTAGAGGGCATGGAGGCAGG + Intergenic
962869824 3:139478074-139478096 GTTTTCATGGGCATTGAGGGGGG + Intronic
963918475 3:150882994-150883016 GTCTTCAATGGCTGTGAGGAAGG - Exonic
964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG + Intergenic
965925725 3:173977312-173977334 GTCTTAAATGGGAGTGGGGATGG + Intronic
970884436 4:20970850-20970872 CTCCCACAGGGCATTGAGGATGG + Intronic
972107524 4:35509051-35509073 AGCTTAAAGGGCATTGGGAAAGG - Intergenic
973326058 4:48863279-48863301 ATCCTAAAGGGCCTCGAGGAAGG - Intergenic
974573725 4:63689212-63689234 CTCTACAAGGGCAGTGAGGAGGG + Intergenic
976000759 4:80370942-80370964 CTCTTCTAGGGCAGTGAGGAAGG - Intronic
980704036 4:136469318-136469340 GCCTTGAAGGGTATTGAAGAGGG - Intergenic
981003459 4:139851339-139851361 GTCTTAAAAGGCCCTGAAGAAGG - Intronic
981867312 4:149438762-149438784 TTCTTAAAGATCATTGATGAAGG + Intergenic
982782804 4:159508682-159508704 GTCTTAAAGGGAATGATGGAAGG - Intergenic
984986440 4:185334916-185334938 GGCTGAAAGGGCTCTGAGGATGG + Intronic
988457063 5:31395735-31395757 GACATAAGGGGCATGGAGGAGGG + Intergenic
989494026 5:42090504-42090526 GTCTTATATGTCACTGAGGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990166126 5:52995246-52995268 GTCTTGAAGGGCCTTGAGCAGGG + Intronic
990625777 5:57609162-57609184 TTCATAAAGAGCATTGAAGAAGG + Intergenic
992415482 5:76548856-76548878 CTCTTAAATGGCATTTAGTAGGG - Intronic
993225941 5:85167335-85167357 CTCTTCTAGGGCAGTGAGGAAGG + Intergenic
993433309 5:87859587-87859609 GTCTTAATGGGGAGTGAGGAGGG - Intergenic
993465984 5:88248019-88248041 GTGTAAAAGGGCATTTTGGAAGG + Intronic
993838955 5:92852306-92852328 GTATTAAAGGGCAATAATGATGG + Intergenic
994216830 5:97146982-97147004 GTCTTTATGGGCATTTAAGAAGG - Intronic
995333592 5:110973990-110974012 GTCTCAAAGAGCATTGGGGATGG - Intergenic
997063492 5:130535256-130535278 GTCATCAAGGGCTTTGAGAAAGG + Intergenic
997422792 5:133782488-133782510 GTCGTGAAGGGCAGTGAGGTGGG - Intergenic
998318568 5:141207578-141207600 GTCTTAAAGTGCACTAAGAATGG - Intergenic
998598803 5:143562959-143562981 GTCTCAAGGGGCCTTGAAGAGGG + Intergenic
1000240040 5:159400817-159400839 CTATTAAAGGGAATTGAGGCTGG - Intergenic
1004758959 6:18644696-18644718 GTCATAAAAGGAACTGAGGAGGG + Intergenic
1006078876 6:31552629-31552651 GTATTAAAGAGCATTGAGAACGG + Intronic
1006935210 6:37712451-37712473 CTCTTAAAGGGCTGTGATGAGGG - Intergenic
1008417682 6:51262058-51262080 GTCTTAAATGGCAGTGACGATGG + Intergenic
1010110664 6:72225990-72226012 GTCTTCAAGGTCATTGATAATGG - Intronic
1014349482 6:120322230-120322252 GAAATAAAGGGCACTGAGGAAGG + Intergenic
1015733852 6:136376622-136376644 ATCATTCAGGGCATTGAGGATGG + Intronic
1015865452 6:137722272-137722294 GACATAAAGGGCATGGAAGAGGG + Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1021898671 7:25261855-25261877 TTCTTAAAGTGCATTGAGATTGG - Intergenic
1024867089 7:53915545-53915567 GTCTTCAAAGGCATTTATGAAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1031201032 7:118685656-118685678 GGGTTAAGGGGCATGGAGGAAGG + Intergenic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1033659508 7:143393842-143393864 GTTATGAAGAGCATTGAGGATGG - Exonic
1033718936 7:144036219-144036241 GTCTTACAGGGCAGAGAGCAAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034617428 7:152430828-152430850 GTTATAAAGGACATTAAGGATGG - Intronic
1035826885 8:2654205-2654227 GTGTCAAAGGGGATTGAGGGAGG - Intergenic
1037369319 8:18157555-18157577 GTATAAAAGGGCATGCAGGATGG - Intergenic
1037476783 8:19265473-19265495 CTCTTGAAGGGCGTGGAGGAAGG + Intergenic
1040535093 8:48302204-48302226 ATCTAAAAGGGTTTTGAGGAAGG + Intergenic
1042185857 8:66135594-66135616 GGGATAAAAGGCATTGAGGAGGG - Intronic
1045743498 8:105388668-105388690 GTCTTGAAAGGGAGTGAGGATGG + Intronic
1051888901 9:21923687-21923709 GTCCTTAAGCACATTGAGGAGGG - Intronic
1053190623 9:36063533-36063555 GACTTAAAGAGCATTTAGGGTGG + Intronic
1057776670 9:98016611-98016633 ATCTTAAAGGGATTTGAGAAAGG + Intergenic
1061745339 9:132735271-132735293 AGCTTCAAGGTCATTGAGGAAGG - Intronic
1187057976 X:15758907-15758929 GGCTTACAGAGCAGTGAGGAAGG + Intronic
1188013926 X:25086855-25086877 TTCTCAAAGGGCATAGAGTAGGG + Intergenic
1188554342 X:31395124-31395146 CTCTTTAGGGGAATTGAGGAAGG - Intronic
1190114636 X:47618776-47618798 GTTTAAAAGGGCTTTAAGGACGG + Intronic
1191877740 X:65813199-65813221 CTCTTTCAGGGCAGTGAGGAAGG + Intergenic
1193994333 X:88345849-88345871 CTCATGAAGGGCATTGAAGAGGG + Intergenic
1196012855 X:110906630-110906652 GTCTTAAAGGGCTGTGCAGAAGG + Intergenic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG + Intergenic
1198698228 X:139366866-139366888 GTATTAAAGGACATTTTGGAGGG + Intergenic
1199622293 X:149712286-149712308 GTCTCCTTGGGCATTGAGGAGGG - Intronic
1199628916 X:149762641-149762663 GTCTCCTTGGGCATTGAGGAGGG + Intergenic