ID: 1079296325

View in Genome Browser
Species Human (GRCh38)
Location 11:19237904-19237926
Sequence CCCTTTTCTGATCTCTGTTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079296321_1079296325 10 Left 1079296321 11:19237871-19237893 CCTCAGGTAATCCACTTCTGTTG 0: 1
1: 0
2: 0
3: 104
4: 1440
Right 1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG 0: 1
1: 0
2: 0
3: 23
4: 238
1079296322_1079296325 -1 Left 1079296322 11:19237882-19237904 CCACTTCTGTTGTCAAACAAACC 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG 0: 1
1: 0
2: 0
3: 23
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079296325 Original CRISPR CCCTTTTCTGATCTCTGTTG CGG Exonic
900750615 1:4394795-4394817 CCCTTTCATGATCTGTGTTTTGG + Intergenic
902202818 1:14846374-14846396 CCTTTTTTTGTTCTCTCTTGTGG - Intronic
905709694 1:40091005-40091027 ACCTTTTCTGTTCTCTGATTTGG - Intronic
906616874 1:47239524-47239546 CTCTTTTTTGGTCTCTGTTCAGG + Intergenic
910601301 1:89035240-89035262 CTCTCTTCTCATCTCAGTTGTGG + Intergenic
913210185 1:116575897-116575919 CCCTTTCTTGATCTCTCTTGTGG - Exonic
913944313 1:125143544-125143566 TCTTGTTCTGAACTCTGTTGTGG + Intergenic
914690418 1:150020930-150020952 CCCTGTTCTGGTCTCTGCTGGGG + Intergenic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
915433001 1:155881169-155881191 CCTTTTTCTTATCTCTTTGGGGG + Intronic
916239513 1:162624888-162624910 CCCTTTTCAGGTCTCTGTACAGG - Intergenic
917213437 1:172654345-172654367 CCTTTTTCTGATCTCTTGTGAGG - Intergenic
918934407 1:190901571-190901593 CCATTTTCTTATCTGTTTTGTGG - Intergenic
919833084 1:201555771-201555793 CCCTTTTCTGGCCTCTCTTTCGG - Intergenic
920891278 1:209988051-209988073 TTCTTTTCTCATCTCTTTTGTGG + Intronic
923544320 1:234913213-234913235 CCCTTTGCTGCCCTCTGTGGGGG - Intergenic
1064907603 10:20364271-20364293 CTCTTTTCTGATTTGTGTTGGGG + Intergenic
1065915137 10:30348964-30348986 CTCTCCTCTGATCTCTGTAGGGG - Intronic
1066285616 10:33963217-33963239 CACTTTTCTGTCCTCTGATGTGG + Intergenic
1068542744 10:58313486-58313508 ACCTTCTCTGCTCCCTGTTGTGG - Intergenic
1069734284 10:70642587-70642609 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
1071526443 10:86362444-86362466 CCATTGTCAGATGTCTGTTGAGG - Intronic
1071561598 10:86650177-86650199 CCCTGCTCTGCTCTCTGTTGCGG + Intergenic
1073117437 10:101099508-101099530 TTCTATTCTGATCTCTGTTCTGG + Intronic
1073448831 10:103597448-103597470 CCTTGTTTTGATTTCTGTTGTGG - Exonic
1073743509 10:106439425-106439447 ACCTTTCCTGATTTCTGTTCTGG - Intergenic
1074443523 10:113499136-113499158 TCCTTTTCTGTTTTCTGTTCTGG + Intergenic
1074623676 10:115153827-115153849 ATCTTTTCTGCTTTCTGTTGTGG + Intronic
1076023747 10:127095149-127095171 CCCTCTTCTGCTCTCTGCTCTGG - Intronic
1076708831 10:132319825-132319847 TCCTTTTGTCATCTCTATTGAGG + Intronic
1076724652 10:132407722-132407744 CCCTTTTCTGATCAGTTCTGGGG + Intronic
1077220763 11:1414870-1414892 CCCTGTTGTCATCCCTGTTGGGG + Intronic
1077597587 11:3547194-3547216 CCCATTTCTGACCTCTCTTTGGG + Intergenic
1077664541 11:4095548-4095570 CAGTTTACTGATCTCTTTTGTGG + Intronic
1078123237 11:8531948-8531970 CACTTTTCTTATCTCTTCTGTGG - Intronic
1078458225 11:11492418-11492440 CCCTGTGCTTTTCTCTGTTGTGG - Intronic
1079045977 11:17103879-17103901 CCCTTTTGTGATTCCTGGTGAGG - Intronic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1080006633 11:27414746-27414768 GCCTTTTCTGACCCCTGTTTTGG - Intronic
1082032234 11:47613308-47613330 TCCTTTTCAGAGCTCTGTTTAGG - Intergenic
1084036817 11:66516538-66516560 CTCTTTTTTAATCTCTTTTGGGG + Intronic
1084085251 11:66852104-66852126 CCCTTGTCTGATCTCTAAGGGGG + Intronic
1084493367 11:69490030-69490052 CCCCTTTCTGACCTATGCTGTGG - Intergenic
1086585704 11:88448893-88448915 CCATTTTCTGTTCTATTTTGGGG + Intergenic
1088067946 11:105743954-105743976 CCCTTTTATGATCTCTTTCTTGG + Intronic
1088707499 11:112477145-112477167 CCCTTCTCTGATTTCCTTTGGGG + Intergenic
1090275719 11:125417914-125417936 CCCTTCTATGAACTCTGCTGTGG + Intronic
1091321037 11:134651745-134651767 CCGTTTTCTCATCTCTTTTCAGG + Intergenic
1091369288 11:135045202-135045224 CACTTTTCTGATCACTGATGGGG - Intergenic
1092740022 12:11619300-11619322 CCCTTTTATGATCTCTTATTAGG - Intergenic
1092859535 12:12708613-12708635 GCCTTCTCTGCTCTCTTTTGTGG + Intergenic
1093928051 12:24928264-24928286 CCCTTCACTGATCTTTGTTATGG + Intronic
1097307901 12:58089282-58089304 CCCTTTTCTGAGCTAATTTGTGG + Intergenic
1098174014 12:67772392-67772414 CCATTCTGTGCTCTCTGTTGGGG + Intergenic
1099674978 12:85747478-85747500 CCCTTTTGTGAGCTCTAGTGGGG + Intergenic
1099839345 12:87946211-87946233 ATCTTTTCTGCTTTCTGTTGTGG - Intergenic
1102977000 12:117213952-117213974 CCCATTTTTGATCTGAGTTGAGG + Exonic
1103738046 12:123072922-123072944 TCCTTCCCTGATCCCTGTTGGGG - Intronic
1104376810 12:128270218-128270240 CTCTTTTCTGAAATCTGTGGGGG + Intronic
1104509407 12:129362855-129362877 CCCTTTTCTAATCCCTGAAGTGG - Intronic
1105201645 13:18185210-18185232 ATCTTTCCTGATCTCTCTTGTGG - Intergenic
1105673838 13:22648694-22648716 CCCTGCTCTGCTCTCTGTGGTGG + Intergenic
1105686826 13:22792364-22792386 CCCATTTCTGCTCTCTGCAGCGG - Intergenic
1109402323 13:61850345-61850367 CCCTTTCCTGATCTGGATTGTGG + Intergenic
1109482985 13:62980877-62980899 CTCTTTTCTTATCTGAGTTGTGG + Intergenic
1110860671 13:80341766-80341788 CCCTTTTCTGTTCCCCTTTGCGG + Intergenic
1110985070 13:81956741-81956763 CCCTCTTCTTATATCTTTTGGGG - Intergenic
1112954837 13:105044108-105044130 GCCTTTTTTGATCTGTGTTGTGG - Intergenic
1113121864 13:106932445-106932467 ATCTTTTCTGCTTTCTGTTGTGG + Intergenic
1113830775 13:113293984-113294006 CCCATTACTGATCTTTGCTGTGG + Intergenic
1113907871 13:113828699-113828721 CTCTCTTCAGATCTCTGTTGAGG - Exonic
1113941207 13:114019433-114019455 CCCTCTTCTGCTCTCATTTGTGG + Intronic
1114486998 14:23068754-23068776 CCTTTTTCTGGTGTGTGTTGCGG - Intronic
1115862416 14:37702054-37702076 CCCTTTTCTCCTTTCTTTTGAGG - Intronic
1116605573 14:46989288-46989310 TCCTTTTCTGATATGTGTGGGGG - Intronic
1117349524 14:54867881-54867903 TCCTTTTCTGTACTCTGTTAAGG - Intronic
1120309223 14:82808790-82808812 CCCTTTTCATATGTTTGTTGAGG + Intergenic
1120596077 14:86439135-86439157 CCCTCTTATGATGGCTGTTGTGG - Intergenic
1121156776 14:91692633-91692655 TGCTTGTCTCATCTCTGTTGTGG + Intronic
1121282677 14:92710673-92710695 GCCATTTCTGATCTTGGTTGAGG - Intronic
1123758565 15:23415735-23415757 CCCTGGCCTGATCTCTGCTGGGG - Intergenic
1124626004 15:31307950-31307972 CCCTGCTCTGATCTCTGGAGGGG - Intergenic
1126176504 15:45740754-45740776 CCCTTTTGGGATGTGTGTTGGGG + Intergenic
1126507814 15:49428227-49428249 CCCTTTACTTATCTCTCTGGTGG + Intronic
1127900183 15:63335326-63335348 CCCTTTTCTAAGCACAGTTGAGG + Intronic
1129019023 15:72498101-72498123 CCCTTTTGTGATCTATTTAGTGG - Intronic
1129108923 15:73326261-73326283 CCCGTTTCTGATTGCTGCTGGGG - Intronic
1130363308 15:83209689-83209711 CCCTTGTCTTATCTCTCCTGGGG - Intergenic
1130631597 15:85574936-85574958 CCCATTTGTGATCTCTTGTGAGG + Intronic
1133019511 16:2960988-2961010 CCTTTTTCTCATCTCTCTGGTGG - Intergenic
1134066325 16:11230759-11230781 CCCTATTCTGATCCTTCTTGGGG + Intergenic
1134457773 16:14407136-14407158 CCCTGGCCTGATCTCTGCTGGGG + Intergenic
1135478018 16:22794889-22794911 CGGTTTTCTTATCTCTGTTGGGG - Intergenic
1138564275 16:57821428-57821450 CCCTGTTCTGGTCTCTGTGGTGG - Intronic
1141802720 16:86322179-86322201 CCCTTTTCTTTTCTTTGATGGGG + Intergenic
1145911634 17:28546697-28546719 TCCTTTTCTGTTCTCTGGTGTGG - Exonic
1148382647 17:47210765-47210787 CCCTTTTCTGAGCTTGGTTATGG + Intronic
1148905022 17:50906576-50906598 CTCTTTTCTGATCTGGGGTGGGG + Intergenic
1150487203 17:65551991-65552013 CCCTGTTCTCATATCTGTAGAGG + Intronic
1151898223 17:76994741-76994763 CCCTGTTCTGATCTCTGTGAAGG + Intergenic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152686767 17:81697612-81697634 CCCTTTACAGATGTCTCTTGGGG + Intronic
1203167942 17_GL000205v2_random:115468-115490 ACCTTTTCTGCTTTCTCTTGTGG - Intergenic
1153510729 18:5848985-5849007 ACCATTTCTGATCCCTGTGGTGG - Intergenic
1153996103 18:10442803-10442825 CTCTTTTGTCATCTGTGTTGAGG + Intergenic
1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG + Intergenic
1158220643 18:55146928-55146950 GCCTTTACTGATCTCTGATTTGG + Intergenic
1158927964 18:62289822-62289844 CCTCTTTCTACTCTCTGTTGGGG - Intronic
1159902554 18:74061052-74061074 CCCAGTTCTGTTCTCTGTGGAGG - Intergenic
1160987589 19:1846401-1846423 TCCTTTTCCCATCTCTGGTGGGG - Intronic
1161835292 19:6641892-6641914 CGCTTCTCTGGTCTCTGTTGTGG - Intergenic
1164393368 19:27844302-27844324 CCCTTCCCAGGTCTCTGTTGTGG - Intergenic
1165262850 19:34635847-34635869 CCCTATCCTTATCTCTGCTGAGG + Intronic
1165849600 19:38841807-38841829 CACTTTTCTGATATCTTCTGAGG - Intronic
1166275140 19:41748288-41748310 CCCTTTTCTGATGCCTGTCACGG - Intronic
1166396603 19:42445794-42445816 CCCTTTTCTGATGTCTGTCACGG + Intergenic
925009354 2:470540-470562 TCCTTTCCTGATATCTGTTTGGG - Intergenic
929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG + Intergenic
929556609 2:42929499-42929521 CTTTTCTCTAATCTCTGTTGAGG - Intergenic
930506326 2:52286359-52286381 CCCTTTTCTGGTCAATTTTGTGG - Intergenic
930726466 2:54686640-54686662 CCCGTTTCTGATCCCCGTTTAGG + Intergenic
937789120 2:125939653-125939675 TCCTTTCCTGAACACTGTTGTGG + Intergenic
938705676 2:133923318-133923340 GGCTTTTCTGATCTTTGTTTTGG - Intergenic
939663656 2:144922364-144922386 CACTATTCTAATATCTGTTGTGG + Intergenic
942132510 2:172894255-172894277 CCCTATTCAGATCTCTGCTTAGG + Intronic
942138587 2:172954799-172954821 CCCTTTTCTTATTTCAGCTGAGG - Intronic
943081282 2:183261399-183261421 ACCCTTTCTTCTCTCTGTTGGGG + Intergenic
943455781 2:188104885-188104907 GTCTTTTCTGATCTTTGTTGAGG - Intergenic
945816539 2:214611666-214611688 CCATTTCCTGACCTCTGTTTTGG + Intergenic
947011669 2:225572788-225572810 CCTCTGTCAGATCTCTGTTGTGG - Intronic
947328413 2:229002594-229002616 CCCTTTTCTGTTATCTTTAGTGG + Intronic
1169299761 20:4431825-4431847 CCCTTCTCTGTTCTCTGGTCTGG + Intergenic
1169478958 20:5960164-5960186 AATTTTTCTGATTTCTGTTGTGG + Intronic
1171239312 20:23552114-23552136 TCCTTTCCTTATCTCTGCTGAGG + Intergenic
1172438698 20:34949713-34949735 CGGTTTCCTTATCTCTGTTGTGG + Intronic
1172798977 20:37563336-37563358 CACTTTTGTGAACCCTGTTGAGG + Intergenic
1174740761 20:53011953-53011975 CCCTTTTCTCATCTGTAATGTGG - Intronic
1174849780 20:53981743-53981765 CCCTTTTCTGCTTTCCTTTGGGG - Intronic
1175171585 20:57084986-57085008 TCCTGTTCTGAGCCCTGTTGGGG - Intergenic
1175355137 20:58359584-58359606 CCCTTTTCTCATCTTGGTTTAGG + Exonic
1175637640 20:60598925-60598947 CCATTTTCTAATTTCTCTTGAGG - Intergenic
1176403815 21:6343668-6343690 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
1176433342 21:6645436-6645458 ACCTTTTCTGCTTTCTCTTGTGG - Intergenic
1176716307 21:10352776-10352798 ATCTTTCCTGATCTCTCTTGTGG + Intergenic
1180165009 21:46020843-46020865 CCATTTGCTCATCTCTGATGTGG + Intergenic
1180602031 22:17027159-17027181 ATCTTTCCTGATCTCTCTTGTGG - Intergenic
1182188523 22:28433833-28433855 CCCTTTTCTGATTTTTGCTTTGG - Intronic
1182527991 22:30933463-30933485 CACCTTTCTGAGCTCTCTTGAGG + Exonic
1182690968 22:32162302-32162324 CCCTTTTATGGTCTCTTTTGTGG - Intergenic
1182828327 22:33284489-33284511 GCCTTTTCTCAGCTCTGTGGTGG + Intronic
1184291977 22:43502277-43502299 CCGTTTGCTGATCTCTGCGGTGG + Intronic
1185382424 22:50516111-50516133 CCCTTTTCTTCTCTGTGTCGGGG + Intronic
949157713 3:848749-848771 CCCTTCTCTGGTCTCTTTGGGGG - Intergenic
950299608 3:11865087-11865109 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950486609 3:13277767-13277789 CTCTTTTCTGATCTCTGATTTGG - Intergenic
951581644 3:24171070-24171092 CCTTTTTATCATCTCTTTTGGGG - Intronic
951631401 3:24725213-24725235 CCCTTCTATGATGTCTGTAGGGG + Intergenic
952499630 3:33948575-33948597 TCCTTTTCTGAACTGTTTTGAGG - Intergenic
954326831 3:49868594-49868616 CCCTTTTCTAATATTTGGTGTGG - Intronic
955554411 3:60120270-60120292 CACTGTGCTGATCTCTGTGGAGG - Intronic
956004155 3:64761137-64761159 TCCTTTTCTGTTCTCTGAAGGGG - Intergenic
956008740 3:64807992-64808014 CCCTTTTCACTTCTCTGCTGAGG - Intergenic
956492020 3:69782928-69782950 CTCTATTCTCATCTCTGTTAAGG - Intronic
957471274 3:80660145-80660167 CCCTTTTCTTGTCTTTTTTGGGG - Intergenic
959763732 3:109999508-109999530 CTCTTTTCTGCTTTCTCTTGTGG + Intergenic
960697529 3:120410794-120410816 AGCTTTTCTGAGCTGTGTTGAGG + Intronic
964450583 3:156809192-156809214 CCCTTTTCTAATCTCTGATATGG - Intergenic
965919890 3:173900066-173900088 CCCTTTTGTCCTCTCTGTTCTGG - Intronic
966160892 3:176967264-176967286 CCCTTTGCTTATATCTGTAGGGG - Intergenic
966520899 3:180872237-180872259 CCCACTTCTCAGCTCTGTTGGGG + Intronic
966582588 3:181584917-181584939 CCATTTTCTCATCTCTAATGTGG + Intergenic
966963302 3:184963338-184963360 GCCTTTTCTGCTCTTTGGTGAGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
968739698 4:2321173-2321195 CCCTTGTCTGTGCTCTGATGAGG - Intronic
976089674 4:81443447-81443469 CACTGTTCTGATTTCTGTGGTGG - Intronic
976174768 4:82340028-82340050 CCATTTACTGGTGTCTGTTGAGG - Intergenic
976289315 4:83400914-83400936 CTCTTTCCTGCTCTCTCTTGTGG - Intergenic
976450557 4:85185745-85185767 CCATTTTCAGTTCTCTGTTGAGG + Intergenic
976607014 4:86993434-86993456 CCCTTTCCTGATATGTGTTCAGG + Intronic
978998939 4:115193470-115193492 ACCTTTTCTGAACTGTGTTTTGG - Intergenic
979015624 4:115429727-115429749 CACTTTTCTTTTTTCTGTTGAGG - Intergenic
979279631 4:118850904-118850926 CTCTTGTCTCATCTCTTTTGTGG - Intronic
981460888 4:145012756-145012778 CCCTTTTCTATTCTCTGTGTTGG - Intronic
984253394 4:177361638-177361660 CCTTTTTCATATCTCTCTTGAGG + Intronic
984264047 4:177474942-177474964 CCCATTTATGACCACTGTTGGGG + Intergenic
984732417 4:183080134-183080156 CCCTTTTCTCATTTCTCTTCTGG - Intergenic
986389604 5:7272373-7272395 CCCTTTGCTGCCCTCTGTTACGG + Intergenic
986439888 5:7771292-7771314 CCTTTTCCTGTTCTCTGTCGTGG + Intronic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
989349655 5:40471842-40471864 ATCTTTTCTGCTCTCTCTTGTGG + Intergenic
993575462 5:89594123-89594145 CCCTTTCCTCATCTCAGTTTAGG - Intergenic
998031758 5:138876434-138876456 CACTTTTCAGACCTCAGTTGTGG + Intronic
998770805 5:145542861-145542883 CCCTTTTGTTATCTCTGTATTGG + Intronic
1001061300 5:168491365-168491387 TCCTTTTCTCTTCTTTGTTGGGG - Intronic
1001093054 5:168755817-168755839 TGCTGTTCTGATCTCTCTTGAGG - Intronic
1004423521 6:15492206-15492228 TCCTTCTCTCAGCTCTGTTGTGG - Intronic
1004896680 6:20155032-20155054 CACTTTCCTGAGTTCTGTTGTGG - Intronic
1005786842 6:29252456-29252478 CCCTTTGCTGACTTCTGTTTTGG - Intergenic
1006257883 6:32845523-32845545 CCCTTTTCTTCTCTCTGTGGTGG - Exonic
1006289912 6:33126771-33126793 CCCTTTTCTGCCTTCTGTGGAGG + Intergenic
1006315618 6:33289764-33289786 CCCTTTTCTGATCTGGCCTGCGG - Exonic
1006894658 6:37459663-37459685 CCATTTTCTGATGGCTGATGGGG + Exonic
1007098866 6:39231023-39231045 CCCTTCTCTGGCCTCTGTAGGGG + Intergenic
1007175813 6:39896713-39896735 CCCTTTTCTGAACTTTGCGGTGG + Intronic
1008235534 6:49043176-49043198 CCATTTGCTGATATTTGTTGAGG + Intergenic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1011133414 6:84074642-84074664 TCCATTGCTGATGTCTGTTGTGG - Intronic
1011356438 6:86476894-86476916 TCCTTTTCTGATTTTTCTTGTGG - Intergenic
1013040891 6:106432419-106432441 CCCTTCTCAGACATCTGTTGAGG + Intergenic
1014652292 6:124054663-124054685 TCCTTTGCTGATCTCTGATCAGG - Intronic
1015315285 6:131809804-131809826 ACCTTTGCTGATATCTGTTGTGG - Intronic
1016258719 6:142142004-142142026 CCCTTTTCTGATTTATCTTATGG - Intergenic
1019283184 7:210784-210806 CCCGTTTCTCATCTCTGAGGAGG + Intronic
1019792311 7:3024108-3024130 CCATTTTCTGAGCTCTTCTGGGG - Intronic
1020667001 7:11058134-11058156 TCCTTTTCTGATATATTTTGAGG - Intronic
1024531398 7:50396155-50396177 ATCTATTGTGATCTCTGTTGAGG + Intronic
1024945090 7:54800171-54800193 GCCTTTTCTGTACTCTGCTGTGG + Intergenic
1024987547 7:55208591-55208613 CCCTTCTCTGATCCCTCATGGGG - Exonic
1025474847 7:60906430-60906452 TCTTGTTCTGAACTCTGTTGTGG + Intergenic
1025512156 7:61583444-61583466 TCTTGTTCTGAACTCTGTTGTGG - Intergenic
1028266094 7:88727725-88727747 CTCTTTTCTGTTCTCTTTTCTGG + Intergenic
1030855863 7:114556389-114556411 TCCTTTTCTGATCCCTGCAGGGG - Intronic
1032757481 7:134904799-134904821 CCCTTTTCTGTTCTTCTTTGGGG - Intronic
1033238199 7:139655238-139655260 CCCTTTTCTGAACTATTTTCTGG - Intronic
1033551853 7:142454806-142454828 CCCTTTTGTGTTCTATGTTAGGG + Intergenic
1033828114 7:145217587-145217609 TCCTTTTCTCATCTCAGCTGTGG - Intergenic
1041420788 8:57665573-57665595 ATCTTTTCTGCTCTCTCTTGTGG + Intergenic
1042253180 8:66776272-66776294 CTCTTTTTTGATCCCTGTTTTGG - Intronic
1046856298 8:119035638-119035660 ACCTTCTCTGAACTCTGTGGTGG - Intronic
1047050239 8:121103233-121103255 ACCTTTTCTGATGTTTGCTGAGG - Intergenic
1047799880 8:128297740-128297762 CCAAGTTCTCATCTCTGTTGGGG + Intergenic
1048781815 8:138010058-138010080 CCCTTTTCTCATCATTATTGTGG + Intergenic
1049400117 8:142422309-142422331 CCCTTTCTTGAACTTTGTTGAGG - Intergenic
1050127732 9:2376728-2376750 CCTTTTTCTCATCTAGGTTGGGG + Intergenic
1050305899 9:4305736-4305758 GCCTTTTCTCCTCTGTGTTGTGG + Intronic
1050602086 9:7263147-7263169 CCCTTTCCTGATCTCTGGGTTGG - Intergenic
1050847598 9:10242367-10242389 CCCTATTCTAATCTCTCTTTTGG - Intronic
1053043077 9:34891206-34891228 TCCTTTCCTGATCTGTGTAGGGG + Intergenic
1053328914 9:37185601-37185623 CTCTTTTCTGGTGTCTGGTGTGG + Intronic
1055329206 9:75164316-75164338 ACCTTATCTGATATCTGTTGAGG - Intergenic
1055609268 9:78004723-78004745 GCCTTTTCTGATCCCTCTAGTGG - Intronic
1056975095 9:91245736-91245758 CCGTTTTCTCATCTGTGTGGAGG - Intronic
1057211488 9:93203191-93203213 CCCTTTGCTGAACTCAGCTGAGG + Intronic
1058487212 9:105453546-105453568 CCCTTTTTTCAACTCTTTTGAGG + Intronic
1061508013 9:131043016-131043038 CCCATTAGTGATGTCTGTTGTGG - Intronic
1203438194 Un_GL000195v1:163234-163256 ACCTTTTCTGCTTTCTCTTGTGG + Intergenic
1186021715 X:5263911-5263933 GCCTTTTCAGATCTCTTTTCAGG - Intergenic
1186110391 X:6248962-6248984 CACTTTTCTCATCTGTGTTATGG - Intergenic
1186509243 X:10117835-10117857 GCTCTTTCTGATCTGTGTTGGGG + Intronic
1187247187 X:17563372-17563394 CCCTGTTCTGGTCTCAGGTGAGG - Intronic
1187562988 X:20419811-20419833 CCATTTTGTGATATCTGTAGAGG + Intergenic
1189124608 X:38433170-38433192 CCCTTCTCTGGTCTCTGAAGAGG + Intronic
1191743998 X:64465676-64465698 CCCCTTCCTGATTTCTTTTGGGG + Intergenic
1192440653 X:71171226-71171248 CCCTGTTCGGAGGTCTGTTGGGG - Intergenic
1194138535 X:90178410-90178432 CTCTTTTCTGATGGCTGCTGTGG - Intergenic
1195150939 X:102069200-102069222 GCTTTTTCTGTACTCTGTTGTGG - Intergenic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1200484334 Y:3748645-3748667 CTCTTTTCTGATGGCTGCTGTGG - Intergenic
1201274517 Y:12285502-12285524 CCCTTCCCAGGTCTCTGTTGTGG - Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic
1202042953 Y:20704512-20704534 CCATTTTCTTATTTGTGTTGTGG - Intergenic