ID: 1079299393

View in Genome Browser
Species Human (GRCh38)
Location 11:19264085-19264107
Sequence CGGTTCTAGGGATAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079299393_1079299403 16 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299403 11:19264124-19264146 TTGAGAAGGGCTTGGTTTCTTGG No data
1079299393_1079299400 2 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299400 11:19264110-19264132 GGTTCAGCAGACACTTGAGAAGG No data
1079299393_1079299405 20 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299405 11:19264128-19264150 GAAGGGCTTGGTTTCTTGGTGGG No data
1079299393_1079299404 19 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299404 11:19264127-19264149 AGAAGGGCTTGGTTTCTTGGTGG No data
1079299393_1079299401 3 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299401 11:19264111-19264133 GTTCAGCAGACACTTGAGAAGGG No data
1079299393_1079299402 8 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299402 11:19264116-19264138 GCAGACACTTGAGAAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079299393 Original CRISPR CGGTTCTAGGGATAGCCAGG AGG (reversed) Intergenic