ID: 1079299400

View in Genome Browser
Species Human (GRCh38)
Location 11:19264110-19264132
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079299393_1079299400 2 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299400 11:19264110-19264132 GGTTCAGCAGACACTTGAGAAGG No data
1079299397_1079299400 -10 Left 1079299397 11:19264097-19264119 CCCTAGAACCGTGGGTTCAGCAG No data
Right 1079299400 11:19264110-19264132 GGTTCAGCAGACACTTGAGAAGG No data
1079299394_1079299400 -1 Left 1079299394 11:19264088-19264110 CCTGGCTATCCCTAGAACCGTGG No data
Right 1079299400 11:19264110-19264132 GGTTCAGCAGACACTTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079299400 Original CRISPR GGTTCAGCAGACACTTGAGA AGG Intergenic