ID: 1079299405

View in Genome Browser
Species Human (GRCh38)
Location 11:19264128-19264150
Sequence GAAGGGCTTGGTTTCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079299394_1079299405 17 Left 1079299394 11:19264088-19264110 CCTGGCTATCCCTAGAACCGTGG No data
Right 1079299405 11:19264128-19264150 GAAGGGCTTGGTTTCTTGGTGGG No data
1079299393_1079299405 20 Left 1079299393 11:19264085-19264107 CCTCCTGGCTATCCCTAGAACCG No data
Right 1079299405 11:19264128-19264150 GAAGGGCTTGGTTTCTTGGTGGG No data
1079299399_1079299405 0 Left 1079299399 11:19264105-19264127 CCGTGGGTTCAGCAGACACTTGA No data
Right 1079299405 11:19264128-19264150 GAAGGGCTTGGTTTCTTGGTGGG No data
1079299397_1079299405 8 Left 1079299397 11:19264097-19264119 CCCTAGAACCGTGGGTTCAGCAG No data
Right 1079299405 11:19264128-19264150 GAAGGGCTTGGTTTCTTGGTGGG No data
1079299398_1079299405 7 Left 1079299398 11:19264098-19264120 CCTAGAACCGTGGGTTCAGCAGA No data
Right 1079299405 11:19264128-19264150 GAAGGGCTTGGTTTCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079299405 Original CRISPR GAAGGGCTTGGTTTCTTGGT GGG Intergenic