ID: 1079309016

View in Genome Browser
Species Human (GRCh38)
Location 11:19348034-19348056
Sequence GACTCCTAGAAAAAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079309010_1079309016 18 Left 1079309010 11:19347993-19348015 CCAGCACAAGGACAGCAACAGCC No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data
1079309014_1079309016 -4 Left 1079309014 11:19348015-19348037 CCCAGAACTGGTGGAGACTGACT No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data
1079309007_1079309016 29 Left 1079309007 11:19347982-19348004 CCCCTCTGGCTCCAGCACAAGGA No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data
1079309008_1079309016 28 Left 1079309008 11:19347983-19348005 CCCTCTGGCTCCAGCACAAGGAC No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data
1079309009_1079309016 27 Left 1079309009 11:19347984-19348006 CCTCTGGCTCCAGCACAAGGACA No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data
1079309013_1079309016 -3 Left 1079309013 11:19348014-19348036 CCCCAGAACTGGTGGAGACTGAC No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data
1079309015_1079309016 -5 Left 1079309015 11:19348016-19348038 CCAGAACTGGTGGAGACTGACTC No data
Right 1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079309016 Original CRISPR GACTCCTAGAAAAAAACAAA AGG Intergenic
No off target data available for this crispr