ID: 1079312280

View in Genome Browser
Species Human (GRCh38)
Location 11:19377595-19377617
Sequence GACACATATGTGAATATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 400}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079312277_1079312280 11 Left 1079312277 11:19377561-19377583 CCATATTCCCAGTATGCAGCACT 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1079312280 11:19377595-19377617 GACACATATGTGAATATATGAGG 0: 1
1: 0
2: 2
3: 42
4: 400
1079312279_1079312280 3 Left 1079312279 11:19377569-19377591 CCAGTATGCAGCACTGTGCTGAG 0: 1
1: 0
2: 4
3: 24
4: 237
Right 1079312280 11:19377595-19377617 GACACATATGTGAATATATGAGG 0: 1
1: 0
2: 2
3: 42
4: 400
1079312278_1079312280 4 Left 1079312278 11:19377568-19377590 CCCAGTATGCAGCACTGTGCTGA 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1079312280 11:19377595-19377617 GACACATATGTGAATATATGAGG 0: 1
1: 0
2: 2
3: 42
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079312280 Original CRISPR GACACATATGTGAATATATG AGG Intronic
902107523 1:14050189-14050211 TACACATATGTGCACATGTGTGG + Intergenic
902269845 1:15295856-15295878 GATACATATGTGAATAACTGTGG + Intronic
902836710 1:19052074-19052096 TACACATATGTGAGTGTGTGTGG - Intergenic
903258941 1:22120963-22120985 GACACATATATGTATGTGTGTGG + Intronic
904060991 1:27710222-27710244 AACACATAAGTGAATAAGTGTGG - Intergenic
904605084 1:31693731-31693753 GACACATGTTTGCATATGTGTGG - Intronic
904741530 1:32680256-32680278 CAAAAATATATGAATATATGGGG - Exonic
906265025 1:44422084-44422106 CACACCTTTGTGACTATATGTGG - Intronic
906370691 1:45250881-45250903 GAGACATATGTGAATTTGAGGGG + Intronic
907109260 1:51911749-51911771 GGCAAATATTTGAAGATATGAGG - Exonic
907664875 1:56425906-56425928 GACAGATATGTTAATATCTATGG - Intergenic
907941568 1:59093358-59093380 GACTCAAATGAGAATATATCTGG + Intergenic
908495649 1:64691740-64691762 GTCACATTTGTGAAGATGTGAGG + Exonic
909172270 1:72312643-72312665 GACATATATATATATATATGAGG - Intergenic
909349080 1:74627662-74627684 CATACATATGTGTATATATACGG + Intronic
909742117 1:79042798-79042820 CACATATAAGTGAAAATATGTGG - Intergenic
909803944 1:79851228-79851250 GTCACATATATGGATATATATGG - Intergenic
910179919 1:84471358-84471380 TACACATAGGTGAATTTCTGTGG + Intergenic
910313751 1:85858472-85858494 GCCACCTATGTGATTATCTGAGG - Intronic
910565782 1:88641245-88641267 TACATATATATGAATATTTGGGG - Intergenic
910723163 1:90309982-90310004 CACACATATCTGTATATATACGG + Intergenic
910799069 1:91127853-91127875 GCCACATATGTGAATGGATCTGG + Intergenic
910824180 1:91388099-91388121 GATACATATGGCAAAATATGAGG - Intronic
912045655 1:105452289-105452311 CAGAGATATATGAATATATGAGG + Intergenic
914350599 1:146836374-146836396 GACACATAGGTTAATGTATGTGG - Intergenic
918435570 1:184508615-184508637 TACACATTTGTGAATATTGGAGG + Intronic
918571367 1:185997085-185997107 CACAGATATGTGAATATATGTGG + Intronic
919212516 1:194506601-194506623 GAGATATATATGAATATATTGGG - Intergenic
919352336 1:196473491-196473513 TACACATATATGCATACATGTGG - Intronic
919415887 1:197308947-197308969 TATACATATATGTATATATGTGG + Intronic
919553255 1:199019365-199019387 CACATATATGTGTATATATATGG + Intergenic
920328942 1:205190768-205190790 GACACTTATGTGAAAATCTGGGG - Intronic
921537013 1:216363600-216363622 CACAGATATATAAATATATGTGG + Intronic
922380822 1:225023004-225023026 CACTTATATGTGAAGATATGTGG - Intronic
923231648 1:231991846-231991868 GACATATATGTCCATACATGAGG - Intronic
924919849 1:248617276-248617298 CACTCATAAGTGAAAATATGTGG - Intergenic
1062993404 10:1842129-1842151 CACACTTGTGTGCATATATGTGG - Intergenic
1064043431 10:11988872-11988894 GAAAGCTGTGTGAATATATGGGG + Intronic
1064302435 10:14134474-14134496 GATAGATATGTGGATATATGGGG + Intronic
1064685900 10:17860853-17860875 GACAAATATGCAAATAAATGGGG - Intronic
1066365991 10:34777392-34777414 GACACATATGTGAGGACATGGGG - Intronic
1068469354 10:57441177-57441199 GTCAAATATGTGAATTTCTGAGG - Intergenic
1068742075 10:60484894-60484916 CACACATATGTGTGTGTATGTGG - Intronic
1070340827 10:75496874-75496896 TACACATATGTGTATACATGAGG + Intronic
1070372605 10:75797813-75797835 GACTTATATGTGAATATTTATGG - Intronic
1071121908 10:82288032-82288054 TACAGATATGTGATTATAAGGGG + Intronic
1071868880 10:89769680-89769702 TACACATGTGTGCACATATGCGG + Intronic
1072187179 10:93051020-93051042 TACATACATGTGAATTTATGTGG - Intronic
1074177691 10:111026655-111026677 AACAGATATGTGAAAAAATGAGG - Intergenic
1074607362 10:114986595-114986617 TACACATAAATGAATGTATGTGG + Intergenic
1074918416 10:117981930-117981952 GATATATATGTGTATATATATGG + Intergenic
1074918417 10:117981954-117981976 GATATATATGTGTATATATATGG + Intergenic
1074918420 10:117982051-117982073 TACATATATGTGTATATATATGG + Intergenic
1076054739 10:127363061-127363083 TGCACATATGTGTATATGTGGGG - Intronic
1077664784 11:4098150-4098172 TACAGACATGTGTATATATGTGG + Intronic
1079312280 11:19377595-19377617 GACACATATGTGAATATATGAGG + Intronic
1079534370 11:21493499-21493521 TACACATAAGTGAGAATATGTGG - Intronic
1079798417 11:24837143-24837165 GACATATATTAGAATATATATGG + Intronic
1080435615 11:32239426-32239448 AATACATATATGAATAGATGTGG + Intergenic
1082206373 11:49439871-49439893 GAAACATTTATGAATATATGGGG - Intergenic
1082209728 11:49484090-49484112 TAAACATGGGTGAATATATGAGG + Intergenic
1082625746 11:55482886-55482908 CACACATATGTGACATTATGTGG + Intergenic
1082705015 11:56483393-56483415 GAAACAAATATGAATAAATGAGG + Intergenic
1083999973 11:66290813-66290835 GACACAGATGTGAAGATCTGAGG + Intergenic
1084605458 11:70169392-70169414 GCCACAGATGTGGATAGATGGGG + Intronic
1085639208 11:78181213-78181235 GACTCATATGTGAATGTTTATGG + Intronic
1086000547 11:81979028-81979050 TATAGATATGTGAATATAAGTGG - Intergenic
1086111572 11:83204395-83204417 CACATATAAGTGAAAATATGTGG - Intronic
1086141777 11:83507483-83507505 GATATATATGTGTATATATATGG - Intronic
1086417850 11:86606881-86606903 GAAACAAATGTAAATATGTGAGG + Intronic
1086648901 11:89261902-89261924 GAAACATTTATGAATATATGGGG + Intronic
1087574536 11:99973911-99973933 AACACTCATTTGAATATATGAGG - Intronic
1088755235 11:112880214-112880236 GACAAATACATGGATATATGTGG - Intergenic
1091341349 11:134817285-134817307 TCCACAAATGTGGATATATGTGG - Intergenic
1091716414 12:2780114-2780136 TATAGATATGTGTATATATGTGG - Intergenic
1092066697 12:5596046-5596068 CACACCTATGTGAATCTATCTGG + Intronic
1092314660 12:7397796-7397818 GACAGAAATCAGAATATATGTGG + Intronic
1093837749 12:23857388-23857410 GACACATATGTGACAATAAAAGG + Intronic
1094218431 12:27969995-27970017 GACAGCTATGTATATATATGTGG - Intronic
1094522993 12:31212681-31212703 CACATATATGTGTATATATATGG + Intergenic
1096131841 12:49165532-49165554 CACACATATATGTATATGTGTGG - Intergenic
1096883686 12:54695374-54695396 TACATATATATGTATATATGTGG - Intergenic
1096883688 12:54695406-54695428 TACATATATATGTATATATGTGG - Intergenic
1097759949 12:63451880-63451902 GACACACATGTGAACAAGTGTGG + Intergenic
1098878726 12:75894042-75894064 TGCATATATATGAATATATGTGG - Intergenic
1099985240 12:89654874-89654896 GACACATATGAGGATGAATGGGG - Intronic
1100341151 12:93680399-93680421 CAGACATATGTCAAAATATGAGG - Intronic
1100796040 12:98182790-98182812 GACACTTGTGGGAATGTATGAGG + Intergenic
1100945892 12:99783643-99783665 CACACATATGTGAGAACATGTGG - Intronic
1101328441 12:103737466-103737488 GATAAATATATGAATACATGGGG + Intronic
1104680244 12:130745896-130745918 TACATATATGTGTATATATGTGG + Intergenic
1104707353 12:130957055-130957077 GACACATGTGTGGATGCATGTGG - Intronic
1107264088 13:38530710-38530732 GACACATAAGATAATAAATGTGG + Intergenic
1108366360 13:49718924-49718946 CATACATATGTGTATATGTGTGG - Intronic
1108541234 13:51448621-51448643 ATCATATATGTGCATATATGTGG + Intronic
1109241179 13:59890672-59890694 CATACATATATGTATATATGTGG - Intronic
1109351111 13:61182149-61182171 GACCCATATATATATATATGGGG - Intergenic
1109490828 13:63097952-63097974 GTCACACATGTGAATATCTGAGG - Intergenic
1109593413 13:64517320-64517342 GATATATATGTGGATATATATGG - Intergenic
1109761941 13:66842219-66842241 GACATAAAGGTGACTATATGAGG - Intronic
1111063871 13:83064157-83064179 GTGACCTATGTGAAAATATGGGG - Intergenic
1111161175 13:84397286-84397308 GGTAGATATGTGAATATGTGGGG - Intergenic
1111377908 13:87404690-87404712 GACACATAGGTGGTTATAGGAGG - Intergenic
1111751069 13:92333007-92333029 GACAGACAAGTGAATATATTGGG + Intronic
1111772189 13:92610881-92610903 GACACATGGGGGAAAATATGGGG + Intronic
1112683062 13:101789256-101789278 GACACAAAAGAGAATATAAGTGG - Intronic
1113165535 13:107436983-107437005 GACATATATCTGAAAATAAGTGG + Intronic
1113174223 13:107543807-107543829 GGTACATATGTGTATATATGTGG - Intronic
1113267635 13:108637017-108637039 GACACAGATATGGATATCTGAGG - Intronic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1116219630 14:42066555-42066577 CACACATAAGTGAGAATATGTGG + Intergenic
1116869671 14:50059468-50059490 CACACATACATGAATATATAGGG + Intergenic
1117168942 14:53070108-53070130 TACACATATGTGCATATATATGG - Intronic
1118216644 14:63815080-63815102 GATATATATGTGCATATATATGG - Intergenic
1118216646 14:63815114-63815136 GATATATATGTGGATATATATGG - Intergenic
1118216648 14:63815136-63815158 GATATATATGTGTATATATATGG - Intergenic
1118216649 14:63815158-63815180 GATATATATGTGGATATATATGG - Intergenic
1120224393 14:81774232-81774254 CACAAATATGTGCATTTATGTGG - Intergenic
1120268722 14:82283265-82283287 GACAAATACATTAATATATGAGG + Intergenic
1120383834 14:83818673-83818695 AAGACAGATGTGAATATTTGTGG + Intergenic
1120498602 14:85266092-85266114 GAGACATATGTCAAAATAAGAGG - Intergenic
1120549185 14:85848196-85848218 GACATATATGTCCATATATACGG - Intergenic
1120576291 14:86185634-86185656 GACATGTATGTTAATATTTGTGG + Intergenic
1120617849 14:86730105-86730127 GACACAGCTGTGTATATATATGG - Intergenic
1121590411 14:95102081-95102103 TGCATATATGTGTATATATGTGG + Intronic
1121938092 14:98039238-98039260 TACACATATATGTATATATACGG - Intergenic
1123900321 15:24870354-24870376 TACACATATGTGTATATGTGTGG - Intronic
1124950750 15:34318262-34318284 GACACAGAAGTCAATTTATGTGG - Intronic
1125376960 15:39040337-39040359 GACACATATGTAAATGCATGAGG + Intergenic
1125707977 15:41758077-41758099 GAAATTTATGAGAATATATGTGG + Intronic
1126846977 15:52769498-52769520 GAAACATATGGGGATATATATGG + Intronic
1127367815 15:58308169-58308191 GACAATTCTGGGAATATATGTGG + Intronic
1127734086 15:61825807-61825829 GAAAAATATGTGAGTCTATGTGG + Intergenic
1127952980 15:63828176-63828198 TACACAAATGAAAATATATGTGG - Intronic
1129691873 15:77718398-77718420 GACACGTGTGTGTATACATGTGG - Intronic
1130736494 15:86555828-86555850 AACATATATGTGAATATACTTGG + Intronic
1131885696 15:96910183-96910205 TATAAATATGTGTATATATGTGG + Intergenic
1133814398 16:9185235-9185257 CACATTTATGTGTATATATGTGG - Intergenic
1133906971 16:10031311-10031333 GACACCCATGTGAGTATCTGGGG - Intronic
1134598376 16:15513949-15513971 TATACATATATGAATATATGTGG - Intronic
1135011965 16:18889163-18889185 CATACATATATGCATATATGTGG - Intronic
1135318821 16:21476388-21476410 CATACATATATGCATATATGTGG - Intergenic
1135371716 16:21908181-21908203 CATACATATATGCATATATGTGG - Intergenic
1135440071 16:22462523-22462545 CATACATATATGCATATATGTGG + Intergenic
1136329125 16:29558456-29558478 CATACATATATGCATATATGTGG - Intergenic
1136443756 16:30298169-30298191 CATACATATATGCATATATGTGG - Intergenic
1136741631 16:32536112-32536134 GACATAAAAGTGAATATCTGAGG - Intergenic
1138894514 16:61187411-61187433 CACACATATATGTTTATATGAGG + Intergenic
1139983437 16:70879165-70879187 GACACATAGGTTAATGTATGTGG + Intronic
1140640903 16:76971455-76971477 GACAGATATATTAATAGATGGGG + Intergenic
1140990874 16:80210165-80210187 TACACATTTTTGAATAAATGAGG - Intergenic
1142268325 16:89075789-89075811 AGCACATCTGTGAATGTATGCGG + Intergenic
1203027971 16_KI270728v1_random:539122-539144 GACATAAAAGTGAATATCTGAGG + Intergenic
1203043750 16_KI270728v1_random:795309-795331 GACATAAAAGTGAATATCTGAGG - Intergenic
1144012324 17:11161567-11161589 TACACATGTGGGAATATGTGGGG - Intergenic
1147437223 17:40424357-40424379 CACATATATGTGTATATATATGG + Intergenic
1147676889 17:42213172-42213194 GACACATAGGCAAATATATATGG + Intronic
1149372956 17:56013506-56013528 GTCACATTTGTGGATATTTGGGG + Intergenic
1150975806 17:70085502-70085524 AACACAGATATGAATTTATGGGG - Intronic
1152342343 17:79732153-79732175 CACACATATATATATATATGAGG + Intronic
1153507204 18:5813439-5813461 AATACATATATGGATATATGGGG + Intergenic
1154300885 18:13191558-13191580 GACACATATATGAACGTGTGTGG + Intergenic
1155131154 18:22936005-22936027 TATAGATATGTGTATATATGTGG + Intronic
1155725271 18:29073449-29073471 GATATATATGTGTATATATATGG + Intergenic
1156966611 18:43102212-43102234 GAAACATATGTGGAAACATGTGG + Intronic
1157531202 18:48422362-48422384 AAAACACATATGAATATATGGGG + Intergenic
1158019527 18:52824964-52824986 GACATATATATATATATATGAGG - Intronic
1158117301 18:54010147-54010169 GGTACATAGGTGTATATATGGGG - Intergenic
1158150899 18:54369146-54369168 TGTACATATGTGAGTATATGTGG - Intronic
1158864517 18:61625215-61625237 TAAAAATATGTGAATATAAGTGG + Intergenic
1159497818 18:69228654-69228676 GAAATATCTGTGAATATATTAGG - Intergenic
1160801317 19:971137-971159 CACACACATGTGCATATATATGG - Intronic
1164268552 19:23646086-23646108 GATAAATATGTGAATAAATTAGG + Intronic
1166261340 19:41643789-41643811 AAAAAATATGAGAATATATGAGG - Intronic
1167764439 19:51471266-51471288 GACACATATCTGACTATACCCGG + Intergenic
925248299 2:2404857-2404879 GAAAAATACGTAAATATATGTGG - Intergenic
927392857 2:22614989-22615011 GTAACATAGGTAAATATATGCGG - Intergenic
929117198 2:38454372-38454394 GACACCTAAGTGTATCTATGAGG - Intergenic
930637065 2:53818106-53818128 AATACATATGTGTATATAAGAGG + Exonic
931198437 2:60074702-60074724 GACCCATATGTGATTATTTGGGG - Intergenic
931277704 2:60758149-60758171 AATACATATGTAAATATATACGG - Intronic
931641845 2:64387428-64387450 AACATAAATGTGTATATATGTGG + Intergenic
932629966 2:73332476-73332498 AATACATAAGTGAATATGTGTGG + Intergenic
933022268 2:77208609-77208631 CACATATATATGAATGTATGAGG + Intronic
933828695 2:86188420-86188442 AATACATATATGTATATATGTGG + Intronic
934609830 2:95726912-95726934 GGAAAATATGAGAATATATGTGG - Intergenic
935868536 2:107419179-107419201 GGCACATATTTGATTATATATGG - Intergenic
936543156 2:113368484-113368506 GGAAAATATGAGAATATATGTGG - Intergenic
936669839 2:114644404-114644426 GAAAGATATGTGGATATGTGGGG - Intronic
936995239 2:118407331-118407353 GACACTTGTGAGAATAAATGGGG - Intergenic
937582705 2:123507554-123507576 GACTCAAATGTTAATATATTTGG - Intergenic
938561682 2:132477650-132477672 GACACATAAGTGAATGGATGTGG - Intronic
938921386 2:135998536-135998558 TACACATATGTGCATTTTTGAGG + Intergenic
939159368 2:138568087-138568109 AACACAAATATGACTATATGAGG - Intronic
939542535 2:143511511-143511533 CACACAGATGGGAATATAGGTGG + Intronic
939775555 2:146383341-146383363 GACACATATGTGTGTATATATGG + Intergenic
940832761 2:158486196-158486218 GTTTCCTATGTGAATATATGTGG + Intronic
941572840 2:167193363-167193385 TACACATTGGTGTATATATGAGG - Intronic
943091979 2:183386356-183386378 GATATATATGTGGATATATATGG - Intergenic
943925301 2:193769604-193769626 GACATATATGTGCATATATAGGG - Intergenic
944442095 2:199753129-199753151 GACACATATATAAAGGTATGTGG + Intergenic
946705768 2:222457577-222457599 GACACAGATGTGAAGATAAGAGG - Intronic
947159266 2:227195651-227195673 CACACATATATATATATATGTGG - Intronic
948133274 2:235617176-235617198 CAAACATGTGTGAATAGATGAGG + Intronic
948497964 2:238366820-238366842 GACACATTAATGGATATATGAGG + Intronic
948661562 2:239510073-239510095 CACACATGTGTGCATATATATGG + Intergenic
1169841444 20:9942523-9942545 TGCACATAAATGAATATATGAGG - Intergenic
1170333598 20:15243530-15243552 CACACACAGGTCAATATATGTGG + Intronic
1171809936 20:29738875-29738897 GCCAAAAATGTGAATATTTGGGG + Intergenic
1171939827 20:31315911-31315933 GACACATTTGAGAATAAAGGGGG + Intergenic
1175103768 20:56599248-56599270 CACATATATGTGTATATATATGG + Intergenic
1175825130 20:61932775-61932797 GACACATCTGTGCACATGTGCGG - Intronic
1176675946 21:9777349-9777371 AACACATAATTGAATAGATGTGG + Intergenic
1177518662 21:22188528-22188550 GACAATTATGTGAATATTTGGGG + Intergenic
1177857597 21:26417109-26417131 AACAAATATGTGAATAGCTGTGG + Intergenic
1179375953 21:40849823-40849845 TACACATGTGTGCATATCTGAGG - Intergenic
1181385443 22:22541974-22541996 GATAGATATGTGAGTATGTGAGG + Intergenic
1182711175 22:32324209-32324231 CACATATATGTATATATATGAGG - Intergenic
1183037696 22:35152512-35152534 TACACACATGGGGATATATGGGG + Intergenic
1183233575 22:36598676-36598698 GACACCTATTTGACTATATCTGG + Intronic
1185100388 22:48837399-48837421 GACACGTGTGTGAATGTGTGAGG - Intronic
949155633 3:823884-823906 GACACAAATATGAATGTATCAGG - Intergenic
949285042 3:2392525-2392547 TACACATAATTGTATATATGGGG + Intronic
952214041 3:31258136-31258158 CACACACATGTAATTATATGAGG - Intergenic
953125526 3:40088527-40088549 GACACAGACCTGAATAGATGAGG + Intronic
953538334 3:43792982-43793004 GATACATCTGTGAGTTTATGAGG - Intergenic
953974601 3:47372616-47372638 GAGATATGTGTGTATATATGGGG - Intergenic
954841040 3:53511880-53511902 AAACCATATTTGAATATATGTGG + Intronic
955105511 3:55893823-55893845 TACACATATGTATGTATATGTGG + Intronic
955620705 3:60860638-60860660 GATACATATGTACATATATCAGG + Intronic
955620711 3:60860824-60860846 GATACATATGTACATATATCAGG + Intronic
955988787 3:64602669-64602691 GACACACATGGGAATTTAAGTGG - Intronic
957343808 3:78936646-78936668 GACATATTTGTAAGTATATGGGG + Intronic
957400078 3:79700062-79700084 TACACATAAGTGAAAACATGCGG + Intronic
957754915 3:84472190-84472212 TACACATATGTATATATATATGG - Intergenic
958081704 3:88753869-88753891 GACACGTATGGGAATGTATTAGG - Intergenic
958459723 3:94379584-94379606 AACACATAAATGAACATATGGGG + Intergenic
959216347 3:103455188-103455210 GACACAGATGTTAGTGTATGAGG - Intergenic
959238971 3:103763897-103763919 GATACATATGTATATATATATGG + Intergenic
959425517 3:106182820-106182842 GAAACAAATGTGAATATACATGG + Intergenic
959468773 3:106722612-106722634 GACACAAAAATGAATAAATGTGG + Intergenic
959951833 3:112188014-112188036 TAAACATATGTAAATAGATGTGG - Intronic
960212932 3:114992586-114992608 GACAAATATATGGATATATGTGG - Intronic
960236076 3:115283809-115283831 GACACATCAGTAAAGATATGTGG - Intergenic
960359217 3:116690467-116690489 GTAATATATGTGAATATATTTGG + Intronic
960381425 3:116967419-116967441 GACAGATATGAGAATATCAGAGG - Intronic
962108882 3:132421139-132421161 AACATATATGTGAATGTATGTGG + Intronic
963442653 3:145358720-145358742 GAAAAATATATGACTATATGTGG + Intergenic
963538109 3:146553850-146553872 CACACATATATGTATATATGAGG + Intergenic
963924911 3:150941198-150941220 AATACATATATGTATATATGGGG - Intronic
964134281 3:153326998-153327020 GACAGATATGTATATATACGAGG + Intergenic
965037750 3:163464610-163464632 AAGAGATATGTGAATATATTTGG + Intergenic
965379532 3:167970934-167970956 AACATGTATATGAATATATGTGG + Intergenic
965684876 3:171292110-171292132 TACACATAAGTGAAAATATAGGG - Intronic
965841836 3:172914716-172914738 GAAAAATATTTAAATATATGTGG - Intronic
965979150 3:174665655-174665677 AACACACGTGTGCATATATGAGG - Intronic
966302448 3:178494866-178494888 GACACACATGTGGAGACATGGGG - Intronic
967143507 3:186585163-186585185 GACACACATGTGCATGTGTGGGG + Intronic
967451119 3:189624322-189624344 CACACATATGTAAAGTTATGGGG - Intergenic
968263990 3:197348458-197348480 CACACATATGTGGGTATATATGG + Intergenic
968756919 4:2421283-2421305 GACACAAATGAGATTATATGAGG - Intronic
969959974 4:10934604-10934626 TACACATATTTGAATCTATCAGG - Intergenic
970280340 4:14448018-14448040 CACACATTTGTGTATATATAGGG - Intergenic
970330163 4:14974499-14974521 GACAGAGATGTTAATATTTGAGG - Intergenic
970728358 4:19073726-19073748 AATACATATATCAATATATGAGG + Intergenic
970958569 4:21845070-21845092 GACAAATAAGTAAGTATATGTGG - Intronic
971164695 4:24171028-24171050 GAAAGCTATGTGAGTATATGGGG - Intergenic
971637335 4:29078182-29078204 AACAGATATGTGTATGTATGTGG + Intergenic
971800092 4:31278101-31278123 CACATATATCTGTATATATGAGG + Intergenic
972102256 4:35435747-35435769 CACACATTTGTGCATATGTGTGG + Intergenic
972951615 4:44331684-44331706 TACATATATGGAAATATATGTGG + Intronic
973116961 4:46473475-46473497 CACACATATATGTATATATATGG - Intronic
973970596 4:56210356-56210378 TATGCATATGTGATTATATGTGG - Intronic
974444901 4:61967047-61967069 AACACATATATGAATATTTATGG - Intronic
974504545 4:62751846-62751868 CACACATATCTGGATATATCGGG - Intergenic
974555224 4:63437693-63437715 GACACATAGGCCAATATAAGAGG - Intergenic
974649699 4:64738689-64738711 GATACATATAAGTATATATGGGG - Intergenic
975447894 4:74488245-74488267 AATACATATGTGTGTATATGAGG - Intergenic
975914926 4:79313053-79313075 GACAAATATATGCATGTATGTGG - Intronic
975949662 4:79754408-79754430 TACACATATGTGCACATTTGGGG - Intergenic
976267197 4:83195499-83195521 TACACACATGGGGATATATGGGG - Intergenic
976625996 4:87182524-87182546 GAGACATGAGTGAATACATGAGG - Intronic
977590814 4:98824727-98824749 TACAAATATGTGAACATAAGAGG + Intergenic
977751971 4:100620576-100620598 TACACACATGGGAATACATGGGG + Intronic
977989332 4:103421705-103421727 GACACATATGAAAATCTCTGTGG + Intergenic
978177412 4:105749908-105749930 GTCAAATTTGTGAATATTTGTGG - Intronic
978283042 4:107039694-107039716 GACACAGAGGTGAATGAATGGGG + Intronic
982316466 4:154036991-154037013 GACACCTGTGAGAATATATTTGG - Intergenic
982753711 4:159193433-159193455 GACACAAATGTGAACTTATCAGG - Intronic
983356491 4:166665848-166665870 GATATATATATGAATATATATGG + Intergenic
983356492 4:166665870-166665892 GATATATATATGAATATATATGG + Intergenic
983374441 4:166907073-166907095 CACACACAAGTGTATATATGAGG + Intronic
984050077 4:174855243-174855265 TACACACATGGGGATATATGGGG - Intronic
984187873 4:176568316-176568338 TTTACATATGCGAATATATGTGG + Intergenic
984664547 4:182411538-182411560 TACCCATATGTGAATATCTGAGG - Intronic
985340827 4:188951748-188951770 TACAAATATGTAAATAAATGTGG + Intergenic
985379673 4:189379427-189379449 GATACATATATGAAAATAAGCGG - Intergenic
985822770 5:2171269-2171291 GTTACACATGTGAATATATTTGG + Intergenic
987124248 5:14796551-14796573 CAAAAATATATGAATATATGGGG + Intronic
987571479 5:19667083-19667105 AACACATATGTTAATATGTTTGG - Intronic
987608463 5:20170415-20170437 GAAAAATATGTAAATATATCTGG - Intronic
987619947 5:20327953-20327975 GACAACTATGTGAATATGTGGGG + Intronic
987865597 5:23532068-23532090 AACATATAAGTGAAAATATGTGG - Intergenic
988081607 5:26422453-26422475 CATACATATGTTAATATATCTGG - Intergenic
988318825 5:29666222-29666244 TACATATATGTATATATATGTGG - Intergenic
988321110 5:29697953-29697975 AATACATGTGTGAATACATGAGG + Intergenic
988967989 5:36439265-36439287 GACATTTAGGAGAATATATGGGG + Intergenic
989065549 5:37457576-37457598 GACACATATATCCACATATGTGG + Intronic
989534264 5:42545919-42545941 GACAAAGATGTGCATTTATGTGG + Intronic
989797024 5:45487608-45487630 AAGACATATGTGCACATATGAGG + Intronic
990907244 5:60817704-60817726 TATACATATGTGTATATATATGG - Intronic
991034064 5:62110010-62110032 TACACATATGTATATATATATGG + Intergenic
991250893 5:64559807-64559829 GACATATATGTGCATTTATTTGG + Intronic
991285619 5:64972501-64972523 GACATATATATTAATATATATGG + Intronic
991589525 5:68235524-68235546 GAAACATAGCTGAATATTTGTGG + Intronic
991726458 5:69540517-69540539 TATACATATGTGAATGTATCTGG + Intronic
991868499 5:71087357-71087379 TATACATATGTGAATGTATCTGG - Intergenic
992690940 5:79239336-79239358 AACACTTCTGAGAATATATGTGG - Intronic
993064326 5:83079251-83079273 AACACATATGCCAATAAATGAGG + Intronic
993299561 5:86190815-86190837 GGCAAATGTGTGCATATATGAGG + Intergenic
993694848 5:91049280-91049302 AACAAACATGTGAATTTATGGGG - Intronic
994230689 5:97307937-97307959 GACAAAAATGTGAATTTAAGGGG + Intergenic
994439590 5:99785315-99785337 GACACATAGGGCAAGATATGGGG + Intergenic
994664843 5:102694148-102694170 GACTCCTGTGTGAATATGTGAGG - Intergenic
994764203 5:103896159-103896181 TACACAAATGTGAGAATATGTGG - Intergenic
994909276 5:105882010-105882032 TACACATATATGTATATATAGGG + Intergenic
995618348 5:113993557-113993579 CACACATATGTATACATATGTGG - Intergenic
996018001 5:118562437-118562459 GACTCATATATATATATATGGGG + Intergenic
996266032 5:121541574-121541596 GTTACATATGTAAATATGTGAGG + Intergenic
997861078 5:137417051-137417073 TACACATATATCTATATATGTGG - Intronic
997878651 5:137570912-137570934 GAGACATTTGTGAAGATCTGGGG + Intronic
998762814 5:145451252-145451274 GACACATGTGTGAATGACTGTGG - Intergenic
999100243 5:149017924-149017946 AATACATAAGTGAATAAATGTGG - Intronic
1000032560 5:157417113-157417135 TATACATATATGTATATATGTGG + Intronic
1000276597 5:159742093-159742115 CACACATATGGGGATATGTGGGG + Intergenic
1000591148 5:163158859-163158881 GATTCAGATGTGAAAATATGTGG + Intergenic
1000826175 5:166047041-166047063 GACAATTATGTAAATATATATGG + Intergenic
1000955003 5:167532744-167532766 TACACATATGTGTGTATATATGG - Intronic
1001362022 5:171096147-171096169 GACAAATATCTGCATATAAGTGG + Intronic
1001367306 5:171155144-171155166 TACACATATATGTATATATATGG + Intronic
1002984724 6:2178050-2178072 CACTTATATGTGAAAATATGTGG - Intronic
1003585001 6:7380689-7380711 TACATATATATGTATATATGTGG - Intronic
1004397217 6:15255884-15255906 GACAGGCTTGTGAATATATGGGG + Intronic
1004896436 6:20152590-20152612 GACCAATATTAGAATATATGAGG + Intronic
1006695862 6:35930277-35930299 CACACAAATGTGCATTTATGTGG + Intergenic
1007917706 6:45576530-45576552 GACAGAAATGCGAATATCTGAGG + Intronic
1007937865 6:45749999-45750021 TACACAAATGTGAATAAATTGGG - Intergenic
1008056080 6:46947455-46947477 CACACATATGTGCACATCTGCGG + Intronic
1009195353 6:60678237-60678259 CACACATAAGTGAGAATATGTGG - Intergenic
1009580006 6:65520604-65520626 CACACATATATGTATATATCAGG - Intronic
1009868013 6:69421253-69421275 GATATATATGTGTTTATATGTGG - Intergenic
1010087238 6:71935406-71935428 AACACATATGTGAAAATATATGG - Intronic
1010729957 6:79380721-79380743 AACACATATGTAAACATACGAGG - Intergenic
1011395973 6:86908404-86908426 CACATATATGTATATATATGTGG + Intergenic
1011491293 6:87896207-87896229 CACACATATATATATATATGGGG + Intergenic
1011569459 6:88718470-88718492 GAAAGATATGTTAATAGATGGGG + Intronic
1011912516 6:92459344-92459366 TATACATATGTGTATATATATGG - Intergenic
1011955681 6:93022366-93022388 TGCACATATGTGAGTATATAGGG + Intergenic
1012131694 6:95501134-95501156 TGCACATCTGTGAATATCTGTGG + Intergenic
1012349122 6:98229782-98229804 GACATATATGTGAAAATTAGTGG + Intergenic
1012382833 6:98640742-98640764 GACACACATGTTAATAAGTGAGG + Intergenic
1013004299 6:106057396-106057418 TACAGATATGTGAATATATCTGG - Intergenic
1013894822 6:115074115-115074137 AACATATATGTGTATGTATGTGG + Intergenic
1014070135 6:117171988-117172010 TATAGATATGTGTATATATGAGG + Intergenic
1014138424 6:117914146-117914168 TACACGTGTGTGTATATATGTGG - Intronic
1014435146 6:121412446-121412468 GACACTTATAAGTATATATGTGG - Intergenic
1015233290 6:130940904-130940926 GACTCATATGTTTATGTATGTGG + Intronic
1016312588 6:142750188-142750210 GACATATATGTAAGTAAATGTGG - Intergenic
1017294881 6:152782007-152782029 TAAACATATGTGAATATCTTTGG + Intergenic
1017325665 6:153138952-153138974 TACACATATGCATATATATGTGG + Intergenic
1018361951 6:163079538-163079560 GAAACATATTAGAATACATGAGG + Intronic
1018765967 6:166932831-166932853 GACTCATGTGCGAATAGATGAGG - Intronic
1018887809 6:167956231-167956253 GGCAAATATGTGACTATATAGGG + Intronic
1020807114 7:12803797-12803819 GACACATATGTGAACACAGACGG + Intergenic
1020928619 7:14364943-14364965 GTCACATAAGTGAATATATTTGG + Intronic
1021630148 7:22637030-22637052 CACATATATGTGAGAATATGAGG + Intergenic
1021802159 7:24317869-24317891 GACACACACCTGAATTTATGGGG - Intergenic
1022019150 7:26381862-26381884 AACACAATGGTGAATATATGTGG + Intergenic
1023782434 7:43669455-43669477 TACACATATGGGGATATGTGGGG - Intronic
1026519114 7:71100934-71100956 GACACATATGTGAATGTTTGAGG + Intergenic
1027563596 7:79763038-79763060 TACATATATGTGAGTATATAAGG + Intergenic
1027735641 7:81929805-81929827 GAGACACATCTAAATATATGAGG + Intergenic
1027974169 7:85127993-85128015 GGCACATATCAGAATATTTGAGG - Intronic
1028155687 7:87426782-87426804 GACACATTTGTGAATTTTTAAGG + Exonic
1028506045 7:91571262-91571284 AATAAATATGTGAATAAATGGGG + Intergenic
1028705063 7:93832559-93832581 GAAAATTATGTGAATATCTGTGG - Intronic
1030198200 7:106874447-106874469 CAGAAATATGTGAATATATGTGG - Intronic
1031928904 7:127664517-127664539 GATACATAAGGTAATATATGGGG - Intronic
1032163471 7:129527774-129527796 GACACATAAGTAAATATTTATGG + Intergenic
1032509173 7:132458319-132458341 AACAGAAATGTGAATATATATGG + Intronic
1034596134 7:152193953-152193975 CACACACATGTGTATATATGTGG - Intronic
1036170847 8:6482893-6482915 GACACATAAGTGAATGAATGAGG + Intronic
1038103982 8:24412963-24412985 CACACATGTGTGTACATATGTGG - Intergenic
1039133292 8:34292349-34292371 GACAGCTATGTGAAGATATGGGG + Intergenic
1039157093 8:34573064-34573086 GATATATATGTGTATATATATGG + Intergenic
1039162892 8:34642129-34642151 GAAAGATATGTAACTATATGTGG + Intergenic
1040675506 8:49744482-49744504 GACACAGATATGAATAGATAAGG - Intergenic
1042745488 8:72101980-72102002 GACACATCTGTGAATATAGTTGG - Intronic
1042908842 8:73803706-73803728 GACAGAAATGTGAAAATTTGGGG - Intronic
1043325694 8:79048156-79048178 TACACAGATGTAAATAAATGAGG + Intergenic
1043447409 8:80332508-80332530 GCAGCATATGTGAATATAGGTGG + Intergenic
1044543545 8:93434283-93434305 GATACATCATTGAATATATGAGG - Intergenic
1045849982 8:106684052-106684074 GACACATTTGATAATATATACGG - Intronic
1046186357 8:110726063-110726085 AATAATTATGTGAATATATGAGG - Intergenic
1047539780 8:125753532-125753554 AGAACATATGTGAATATCTGGGG + Intergenic
1048453613 8:134556343-134556365 TACATATGTGTTAATATATGTGG + Intronic
1051392364 9:16579722-16579744 CACACATATGTGCATATATATGG + Intronic
1051681035 9:19608474-19608496 GACAGATGTGTGAACATGTGTGG + Intronic
1051960259 9:22752055-22752077 AACACATATATTAATCTATGTGG + Intergenic
1052622228 9:30928027-30928049 AACACATATGTGAATATGAATGG - Intergenic
1053403441 9:37849405-37849427 GATACATAAATGAATAGATGTGG + Intronic
1055392201 9:75834917-75834939 AACACATAAATGAATAAATGTGG - Intergenic
1055594478 9:77851051-77851073 GACACACCTGTGAAGATCTGGGG - Intronic
1055918199 9:81429413-81429435 TACACATATGTAAGTATATTAGG - Intergenic
1056068900 9:82965537-82965559 GACACAGATGTAAATTTATTAGG + Intergenic
1056779156 9:89536600-89536622 TACACATATGTATATATGTGTGG - Intergenic
1056952832 9:91058594-91058616 GAAACATTTGTGGATATATGTGG - Intergenic
1058188097 9:101879538-101879560 TACACATATGTATATATATATGG + Intergenic
1058590016 9:106555315-106555337 GATACATATGTGCAAGTATGTGG + Intergenic
1059166455 9:112080803-112080825 GACACTTATTTGTATAAATGAGG - Intronic
1060380960 9:123171567-123171589 TGCACACATGTGTATATATGTGG + Intronic
1060492643 9:124096227-124096249 GACACATGTGTGCATTTCTGTGG + Intergenic
1061174262 9:128983423-128983445 GGCACATACCTGAAGATATGTGG + Intronic
1062021494 9:134321583-134321605 TACACATATGTGTACATACGAGG - Intronic
1185941861 X:4330846-4330868 TACACATATGTGCATGTGTGTGG - Intergenic
1186059383 X:5687410-5687432 CACACATATGTATGTATATGTGG + Intergenic
1186088518 X:6018215-6018237 CGCATATATGTGTATATATGTGG - Intronic
1186243577 X:7596250-7596272 CACACATATATGAATATATATGG + Intergenic
1188549431 X:31346393-31346415 GTCATATATGAGTATATATGAGG - Intronic
1188625536 X:32279936-32279958 CATATATATGTGTATATATGTGG - Intronic
1189057638 X:37715042-37715064 TACACATATATGTATATATTTGG - Intronic
1189057640 X:37715120-37715142 CACACATATTTGTATATATTTGG - Intronic
1190118568 X:47641707-47641729 GAAACAAATGTGAATCTGTGGGG + Intronic
1191666706 X:63709772-63709794 GACATAGATGAGAATATTTGTGG - Intronic
1192629838 X:72768796-72768818 CACAAATATATGAATATATTTGG + Intergenic
1192651872 X:72952008-72952030 CACAAATATATGAATATATTTGG - Intergenic
1192765159 X:74132483-74132505 TACACATGTGTGGATATGTGGGG - Intergenic
1194934935 X:99937558-99937580 GCCACATATGTGTATATGTAGGG - Intergenic
1197404608 X:126034704-126034726 CAGACATATGGGCATATATGAGG - Intergenic
1198560574 X:137845732-137845754 AATACACATATGAATATATGAGG + Intergenic
1198761454 X:140037169-140037191 AAAACATATGAGAATATATTTGG + Intergenic
1199150511 X:144479783-144479805 GATATATATGTGAATATAGGTGG + Intergenic
1199732211 X:150646277-150646299 TACACATATGTGAGTATATACGG - Intronic
1200273485 X:154710285-154710307 CACACATATATAAATATATTGGG - Intronic
1201450936 Y:14114290-14114312 GACACATGTATGTATTTATGGGG - Intergenic