ID: 1079312360

View in Genome Browser
Species Human (GRCh38)
Location 11:19378163-19378185
Sequence CTGTGACAGCAGAAGCGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079312360_1079312371 12 Left 1079312360 11:19378163-19378185 CCCATCCGCTTCTGCTGTCACAG 0: 1
1: 0
2: 1
3: 15
4: 140
Right 1079312371 11:19378198-19378220 TACACATGTCATTTGTCTTCTGG 0: 1
1: 0
2: 0
3: 18
4: 210
1079312360_1079312372 29 Left 1079312360 11:19378163-19378185 CCCATCCGCTTCTGCTGTCACAG 0: 1
1: 0
2: 1
3: 15
4: 140
Right 1079312372 11:19378215-19378237 TTCTGGCTTCCAAGTTGCAATGG 0: 1
1: 0
2: 2
3: 29
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079312360 Original CRISPR CTGTGACAGCAGAAGCGGAT GGG (reversed) Intronic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
903699139 1:25233214-25233236 GTGGGACAGAAGAAGCGGTTGGG - Intergenic
904623063 1:31787131-31787153 CTGTGCAAGCAGAAGCCGAGAGG - Intergenic
906577487 1:46903970-46903992 CTGAGACAGAAGAAGAGGCTGGG - Intergenic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
912441945 1:109705878-109705900 CTGAGACAGAAGAAGCGACTGGG - Intronic
913161756 1:116151857-116151879 CTGTGACAGCAGGAGAGGATGGG - Intergenic
913236199 1:116785365-116785387 CTGTGACTGCTGTAGGGGATGGG - Intergenic
914887010 1:151593826-151593848 CTGGGGAAGCAGAAGCGGTTTGG + Intergenic
917381599 1:174416101-174416123 CTGTCACAGCAGAAGTGAGTTGG - Intronic
921540306 1:216406028-216406050 CTGTGGCAGCAGTAGGGGAAGGG + Intronic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
1063072697 10:2682106-2682128 CTCTGACAGCAGCAGTGGAATGG - Intergenic
1064225118 10:13476226-13476248 GTGTGACAGCAAAAGCGGCCAGG + Intronic
1068494843 10:57774622-57774644 CTGTGACAGCCAAAAGGGATGGG + Intergenic
1068749234 10:60572667-60572689 CTCTGACAGCAGCAGGGGCTGGG - Intronic
1069049925 10:63781571-63781593 CAGTGAAAGCAAAAGCGTATGGG - Intergenic
1070749474 10:78955441-78955463 CTGTGACATCAGAAGCATTTAGG + Intergenic
1072396627 10:95049756-95049778 CTGAGACAGCAGCTGGGGATGGG + Intronic
1073354329 10:102841783-102841805 CTGAGACAGAAGAAGAGGCTGGG + Intergenic
1073879366 10:107962048-107962070 CTGTGACAGCAAAAGAGCACAGG + Intergenic
1075120108 10:119658658-119658680 CTGTGACAGGAGTAGCAGAAAGG + Intronic
1075453658 10:122570650-122570672 CTGTGGCAGCAGAAGAGGTTGGG + Intronic
1075453858 10:122572074-122572096 CTGTGGCAGCAGAAGAGGTTGGG + Intronic
1076116454 10:127905173-127905195 CTGTCAGAGCAGAGGAGGATGGG - Intergenic
1078038023 11:7828282-7828304 CTGTGACTGCAGAAGGGCACAGG + Intergenic
1078125581 11:8558608-8558630 GTGTGACACCAGATGCGGGTGGG + Intronic
1078271410 11:9798404-9798426 CTGGGACAGAAGAAGGGGACAGG + Intronic
1079312360 11:19378163-19378185 CTGTGACAGCAGAAGCGGATGGG - Intronic
1084467548 11:69334963-69334985 CTGTTACAACAGAAGCCGATGGG - Intronic
1085154786 11:74283474-74283496 CTGTAACAGCAGACATGGATTGG - Intronic
1089455691 11:118624475-118624497 CTCTGAGAGCAGATGAGGATGGG + Intronic
1092864938 12:12751884-12751906 ATGTGACGGCAGAAGCAGATTGG + Intronic
1093627966 12:21372763-21372785 CACAGGCAGCAGAAGCGGATGGG - Intronic
1094865298 12:34524363-34524385 CTGAGACAGAAGGAGAGGATGGG - Intergenic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1102454076 12:113060802-113060824 CTGTGAGAGCAGAAGTGGGTAGG + Intronic
1102910788 12:116712390-116712412 CTGTGACAGCAGACGAGGTAAGG + Exonic
1107187460 13:37540895-37540917 CTGTGAGATCAGAAGAGGATGGG + Intergenic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1120993585 14:90398221-90398243 CTGGGGGAGCAGAAGCGGGTGGG + Intronic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1126308025 15:47283351-47283373 CTGTGACACCACAAGCTGTTTGG + Intronic
1128268102 15:66284768-66284790 TTGTGATAGCAAAAGCGGCTGGG + Intergenic
1129749206 15:78048810-78048832 CTGAGACAGCAGGAGAGGAGAGG - Intronic
1129968594 15:79758085-79758107 CTCTGAGAGCAGCAGCGGAAGGG + Intergenic
1132864397 16:2086393-2086415 CTGGGGCAGCAGGAGCGGGTAGG - Intronic
1134362628 16:13545796-13545818 GTGTGATAGTAGAAGCGGATCGG - Intergenic
1136511693 16:30741807-30741829 CGGAGCCAGCAGCAGCGGATGGG - Intronic
1136996030 16:35188531-35188553 CTGTGACATCAGCAGTGGATTGG + Intergenic
1138240867 16:55426104-55426126 CTGTGACAGCCTAAGCTGTTAGG + Intronic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG + Intergenic
1142200182 16:88757414-88757436 CTGTGAGAGCAGGGGCGGGTGGG + Intronic
1142487977 17:259113-259135 CAGTGACAGCAGGAGAGAATCGG - Intronic
1142792234 17:2276357-2276379 TTGTAACAGCAGATGTGGATAGG - Intronic
1142905688 17:3040202-3040224 CAGTAACAGCAGAGGTGGATGGG + Intergenic
1144480149 17:15622274-15622296 GTGTGACATCAGAGCCGGATGGG - Intronic
1144918156 17:18741464-18741486 GTGTGACATCAGAGCCGGATGGG + Intergenic
1145229368 17:21161215-21161237 ATGTGACAGCATAGGCGCATGGG + Intronic
1146530875 17:33606882-33606904 CTGTGACCACAGAATGGGATTGG - Intronic
1147932701 17:43992812-43992834 ATGTGACCACAGAAGCAGATTGG + Intronic
1151507556 17:74539547-74539569 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151509094 17:74547392-74547414 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151675871 17:75597041-75597063 CTGGGACAGCAGCAGCGAAGGGG + Intergenic
1151678746 17:75613330-75613352 CTGTGCCAGCACAAGCTGCTGGG + Intergenic
1151732015 17:75917331-75917353 CTGTGAGAGCTGAAGAGGCTAGG + Intronic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1154025936 18:10707007-10707029 CTGTGACTGAAGAACCAGATTGG + Intronic
1155726260 18:29088015-29088037 CTGTGACGACAGAAGTGGCTAGG + Intergenic
1157119495 18:44895535-44895557 CTTTGACAGCAGAAGTGAAATGG + Intronic
1158575529 18:58634429-58634451 CTGTGACAGCAGAACAGGGTGGG - Intergenic
1163326962 19:16610814-16610836 GTGTGACAGCAGGAGGGCATGGG + Intronic
1163942306 19:20506498-20506520 CTGAGATAGAAGAAGAGGATGGG + Intergenic
1165153682 19:33774980-33775002 CTGAGACAGCAGATGCTGAGGGG + Intergenic
925314801 2:2913133-2913155 CTGTGACAGCAGACGTGTAGAGG - Intergenic
929895195 2:45953649-45953671 CAGTGACAGCAAGAGTGGATGGG - Intronic
932446837 2:71786708-71786730 CTGGCACAGCAGAGGCGGAATGG - Intergenic
938051983 2:128182201-128182223 CTGTGACAGCCGAAGAGAAATGG + Exonic
939604530 2:144237638-144237660 CTTTGACAGCACAAGTTGATCGG - Intronic
943202508 2:184846905-184846927 CTGTGACAGCTGAGGCTTATGGG + Intronic
947170584 2:227306888-227306910 CAGTGGCAGCAGAAATGGATGGG + Intronic
947801836 2:232933595-232933617 CTGTCACAGCACAAGGGGCTGGG - Intronic
1170180373 20:13523389-13523411 ATGTGACAGCAGGAGCCAATGGG - Intronic
1172106891 20:32522383-32522405 CTCTGACTGGAGCAGCGGATGGG + Intronic
1172243192 20:33427204-33427226 GTGTGACAGTATAAGGGGATAGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175850034 20:62085353-62085375 CGGGGTCAGCAGATGCGGATGGG + Intergenic
1177634914 21:23774692-23774714 CTGAGACAGCAGTAGCGGTGGGG - Intergenic
1178712403 21:34929768-34929790 CAGTGACAGCAGAAGTGACTTGG - Intronic
1180200157 21:46219370-46219392 CTGTGACAGCAGAGAGGGGTGGG - Intronic
1180935211 22:19620868-19620890 CTCTCCCAGCAGAAGCGCATGGG + Intergenic
1180991239 22:19938000-19938022 CTGAGACAGAAGAAGAGGCTGGG - Intronic
1182112710 22:27734643-27734665 CTGTGTGTGCAGAAGTGGATGGG - Intergenic
1183345842 22:37307269-37307291 CAGTGACCGCAGAAGCTGCTGGG + Intronic
954076189 3:48183017-48183039 CTTTGATAGCAGAAGCTGTTGGG - Exonic
954436666 3:50499944-50499966 CGGTGACAGCAGCAGCGGCTGGG + Intronic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
959162126 3:102736259-102736281 CTTCGCCAGCAGAATCGGATGGG + Intergenic
960299941 3:115990557-115990579 CTGAGAAAACAGAAGCTGATTGG - Intronic
960882664 3:122361461-122361483 GTGGGCCAGCAGAAGTGGATAGG - Intronic
961705816 3:128784388-128784410 GTGTGAAAGCAGAAGAGAATGGG - Intronic
964709519 3:159656898-159656920 CTATTACAACAGAAGAGGATGGG - Intronic
967672947 3:192260871-192260893 CTTTGATAGCAGAAACAGATAGG + Intronic
968733068 4:2280778-2280800 CTGTGAAAGGAGAAGCCCATGGG + Intronic
970035211 4:11726083-11726105 CTGTGACAGCAAAACCAGACAGG + Intergenic
973122968 4:46545619-46545641 CTGTGACAGTAGAAGAGGCCAGG - Intergenic
974998680 4:69194589-69194611 CTGTGACAGAAGAAGAGGCTGGG - Intronic
976342926 4:83964829-83964851 CTTTGCCAGCAGAATTGGATGGG - Intergenic
983190473 4:164749068-164749090 CTGAGACAGAAGAAGAGGCTGGG - Intergenic
984061752 4:174997282-174997304 CTGTCAAAGCAAAAGCAGATTGG - Intergenic
989559045 5:42830019-42830041 CTTTAACAGCAGAAGGGGCTGGG - Intronic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990471976 5:56123901-56123923 CTGTGACAGCTGAGGCAGATTGG - Intronic
990810069 5:59713798-59713820 CTTTGACAGCAGAGTTGGATGGG + Intronic
995165438 5:109034503-109034525 TTGTGAAAGCAGAAGCCAATAGG - Intronic
995344672 5:111098267-111098289 CTGTCAAAGCAGAAGGGTATGGG + Intronic
997295017 5:132763678-132763700 CTGTGACAGCAGGTGGGGACAGG + Intronic
999191305 5:149749456-149749478 CTCAGACAGCAGTAGCGGAGGGG - Intronic
1006516058 6:34546363-34546385 CTGGGACAGCAGGAGGGGAAGGG + Intronic
1007656640 6:43454975-43454997 CCGGGACAGAAGAAGGGGATGGG + Intronic
1007973397 6:46075966-46075988 CTGTGACAGCAGTGGAGCATTGG - Intronic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1012150439 6:95743747-95743769 CTGTGACAGCAGAATAGCAATGG + Intergenic
1014179291 6:118367228-118367250 ATGTAACAGCTGAAGTGGATTGG + Intergenic
1015582525 6:134741390-134741412 GTGTGACAGCAAAAGCAGATGGG + Intergenic
1016801582 6:148174341-148174363 CTGTGACATGAGAGGGGGATGGG - Intergenic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1023881215 7:44322752-44322774 CAGAGACAGCAGAAAAGGATGGG + Intronic
1031571919 7:123369733-123369755 CTGTCATGGTAGAAGCGGATGGG - Intergenic
1032416769 7:131741550-131741572 CCGTGACAGGAGTAGGGGATTGG - Intergenic
1034348356 7:150400683-150400705 ATGTGACAGTAGAAGCAGCTTGG - Intronic
1034908101 7:154968806-154968828 CTGTGAAAACTGATGCGGATGGG + Exonic
1035017919 7:155782540-155782562 CTGTGAAAGCCAAAGCAGATTGG + Intergenic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038852614 8:31294942-31294964 CTGTGACAGCAGCAGCACCTAGG + Intergenic
1043182082 8:77097490-77097512 GTGTGACAGCAGAACTGGTTGGG + Intergenic
1043237911 8:77892116-77892138 CTATGACAGCAGTACCAGATGGG - Intergenic
1044182795 8:89216785-89216807 ATTTGACAGCAGAAGAGGGTGGG + Intergenic
1051372322 9:16369176-16369198 ATCTGACAGCAGAGGCGCATAGG - Intergenic
1053307449 9:36994545-36994567 CTGTGGCAGCTGAAGCTAATGGG - Intronic
1055163696 9:73164224-73164246 CTGGTATAGCAGAAGTGGATGGG - Intronic
1058750727 9:108036025-108036047 CTGTGACAGCAAAAGCTTGTGGG + Intergenic
1059198959 9:112396819-112396841 CTGAGACAGAAGAAGAGGCTGGG + Intronic
1059565046 9:115375827-115375849 ATGTGACAGCAGAACTTGATGGG - Intronic
1062318431 9:135979127-135979149 CTCTGACAGCAGAGGTGCATGGG + Intergenic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1192317944 X:70066700-70066722 CTCTGACAGCGGAAGGGGCTGGG + Intergenic
1197952255 X:131910207-131910229 ATGTGACAGAAGAAGCAGATTGG - Intergenic
1199671123 X:150149071-150149093 CAGGGACAGCAGCAGAGGATGGG - Intergenic
1201641837 Y:16187880-16187902 CTGATACAGCAGAAGTGGAAGGG + Intergenic
1201660978 Y:16397441-16397463 CTGATACAGCAGAAGTGGAAGGG - Intergenic