ID: 1079314028

View in Genome Browser
Species Human (GRCh38)
Location 11:19392348-19392370
Sequence AGGAATATACAATTTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079314024_1079314028 21 Left 1079314024 11:19392304-19392326 CCACTCCAACACAATGACTTAAC 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG 0: 1
1: 0
2: 2
3: 19
4: 316
1079314025_1079314028 16 Left 1079314025 11:19392309-19392331 CCAACACAATGACTTAACTCAGT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG 0: 1
1: 0
2: 2
3: 19
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079314028 Original CRISPR AGGAATATACAATTTGAGCA GGG Intronic
902318125 1:15639355-15639377 GGGAAAATATTATTTGAGCAAGG - Intronic
903292288 1:22321984-22322006 ATGAATTTGCAATTTGGGCAGGG + Intergenic
904100552 1:28023022-28023044 AGTAATATACAAGATGAGCCTGG + Intronic
904337040 1:29804661-29804683 AGGAAAACACAATTTCAGAATGG - Intergenic
906255867 1:44349521-44349543 AGGAATTTACAACTAAAGCAAGG - Intronic
906455136 1:45988893-45988915 AGAAATATACAACATGAGCCTGG - Intronic
908917929 1:69153926-69153948 AGGTAAATACCATTTGATCATGG + Intergenic
908998583 1:70190046-70190068 AAGACTGTACAAATTGAGCAGGG + Intronic
909634686 1:77804419-77804441 AAGAATATACAATGAGAGCTGGG + Intronic
909755682 1:79222044-79222066 GAGAATATACAATTTAAGCCTGG + Intergenic
909906066 1:81196628-81196650 GGGAATATACAAGATGAGCCTGG - Intergenic
910749878 1:90617430-90617452 GGGAATATACAAGGTGAGCTTGG + Intergenic
911074840 1:93863098-93863120 AAGAATATGCATTTTGAGGATGG - Intergenic
911168758 1:94748045-94748067 AGGAATTTACAATATGATAAAGG - Intergenic
911442143 1:97940076-97940098 AGGAATATACAAGATAAGCTTGG - Intergenic
912241633 1:107916560-107916582 AGTAATTTACAATTTGTACAGGG + Intronic
912389293 1:109291016-109291038 ACGATTTTACAATTTGGGCAGGG + Intergenic
915072781 1:153285868-153285890 AGAAATATACAATATAAGCTTGG - Intergenic
917642533 1:176996877-176996899 TGGAAAATGCAATTTGAGGAAGG + Intronic
917716322 1:177741399-177741421 AGGAATATAAATTTGGATCATGG - Intergenic
917952356 1:180052420-180052442 GGGAAAATACAGTTTGAGCCTGG + Intronic
918385372 1:184002021-184002043 AGGAAGATAAAATAGGAGCAAGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919986259 1:202677647-202677669 AGAAATCTACAGTTTGAGCAGGG - Intronic
920545671 1:206814981-206815003 ACAAATATACAATCTGGGCAGGG + Intronic
922403640 1:225287762-225287784 GGAAATATACAATATGAGCCTGG + Intronic
922973745 1:229766080-229766102 AACAATGAACAATTTGAGCAGGG - Intergenic
923204835 1:231749053-231749075 AGGCAGATTCAATCTGAGCAGGG + Intronic
923210849 1:231803078-231803100 ATGGAAATACAATTTGGGCAGGG + Intronic
923709122 1:236371284-236371306 ACGAATAAACAATTACAGCAAGG - Intronic
924387710 1:243514663-243514685 AAGAATATACAACTTGGGCTGGG + Intronic
1063431855 10:5998071-5998093 ATGAATATATAATTTGGGCCAGG + Intergenic
1065792033 10:29269221-29269243 TTGAAAATACAATTTGAGCAAGG - Intergenic
1066201416 10:33145505-33145527 ATGAATTTGCAATTTGGGCAGGG + Intergenic
1066534703 10:36379033-36379055 ATGAATATACAGTTTCAGGAAGG - Intergenic
1066542799 10:36467402-36467424 AGGAATATAACATTTTTGCAAGG + Intergenic
1067730620 10:48808596-48808618 ATGCATATACAGGTTGAGCAAGG - Intronic
1068813606 10:61284734-61284756 AGGATTATACAACTTGATGAAGG - Intergenic
1069541885 10:69300903-69300925 ACTAATAAACAATTTCAGCAAGG + Intronic
1069647527 10:70013784-70013806 AGAAATAGACAATTTGAATAGGG + Intergenic
1069668327 10:70180208-70180230 GGGAATATACAAGATGAGCCTGG + Intergenic
1071021575 10:81063541-81063563 AGGAAAAGACAATGTGACCATGG + Intergenic
1071040819 10:81307575-81307597 AGGAATTTGCACTTTGTGCAAGG + Intergenic
1072749502 10:97967368-97967390 AGAAATATACAAAGTGAGCCTGG - Intronic
1073859531 10:107721760-107721782 ACGAATATAAAATTTAAGGATGG + Intergenic
1074007034 10:109437179-109437201 TGGAATAAACAATTTCAGGAAGG + Intergenic
1074653918 10:115560016-115560038 ACTAATACACAATTTTAGCAAGG + Intronic
1075229143 10:120657760-120657782 AGGAATTTTCATTTTGACCAAGG - Intergenic
1076487193 10:130831097-130831119 AGAAGTATACAATGTGAGCCTGG + Intergenic
1078402626 11:11041485-11041507 AGGAATGTACAAGATGAGCCTGG - Intergenic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1079874366 11:25838279-25838301 GGGAATATACAAGCTGTGCATGG - Intergenic
1083019801 11:59495440-59495462 GGGAATATACAATATAAGCCTGG + Intergenic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1085262914 11:75218558-75218580 AGGAAGATACAAGATGAGCCTGG - Intergenic
1085344743 11:75761323-75761345 AGGAAAATGCAGTATGAGCAAGG - Intronic
1085361771 11:75894691-75894713 AGGATTATACAGTCTGGGCAGGG - Intronic
1085373622 11:76037405-76037427 AGGAACATACATTCTCAGCAGGG + Intronic
1085467053 11:76731230-76731252 ATGAATCTACAATTTGGGCAGGG + Intergenic
1085592356 11:77775632-77775654 AGGTATTTAAAACTTGAGCAGGG + Intronic
1087625740 11:100594182-100594204 AGGATTACACAATTTAAACAAGG + Intergenic
1088356803 11:108952582-108952604 AGAAATATACAAGATGAGCCTGG + Intergenic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1090813919 11:130273691-130273713 ACTAATAAACAAGTTGAGCAAGG - Intronic
1091025968 11:132141652-132141674 AGGCCTATACTGTTTGAGCAGGG - Intronic
1091436528 12:477795-477817 AGAAATATACAAGTTGATGAGGG + Intronic
1093403394 12:18775883-18775905 ATGAAAATGCAATTGGAGCAAGG + Intergenic
1094071321 12:26417295-26417317 AGGAAAATACAATTAGAAAATGG + Intronic
1098918399 12:76280358-76280380 AGGAAAATACAGTTTAACCAAGG + Intergenic
1099541526 12:83914757-83914779 AGGTATATACAATTTTAACAAGG + Intergenic
1100017804 12:90032979-90033001 ACTAATAAACAATTAGAGCATGG - Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1101693880 12:107106475-107106497 ATAAATATGCAATTTGGGCAGGG - Intergenic
1101753233 12:107600638-107600660 AGGAATCTTCCATATGAGCAAGG + Intronic
1107537249 13:41347705-41347727 ACGAATAAACAAGTTCAGCAAGG - Intronic
1108030861 13:46228188-46228210 AGGTAAATACAATCTGAACACGG + Exonic
1108191461 13:47944675-47944697 AAAAATAAAGAATTTGAGCAAGG - Intronic
1109471216 13:62806828-62806850 AGGCTGAAACAATTTGAGCAAGG + Intergenic
1109589196 13:64454939-64454961 AGAAATTTACTTTTTGAGCAGGG + Intergenic
1109844163 13:67962413-67962435 AGGAATATGGTATTTGAACAGGG + Intergenic
1111402080 13:87751567-87751589 GGGAATATACAAGTTGATCTTGG - Intergenic
1111758447 13:92429860-92429882 AGGAATATAAACTTTGAGACAGG + Intronic
1113238522 13:108310658-108310680 AGGAAAATACAAGTTGAACTTGG - Intergenic
1113349957 13:109519453-109519475 GGGAAGAAACAATTGGAGCAGGG + Intergenic
1113971151 13:114190429-114190451 AGGAATAAACAATTATAGCAAGG + Intergenic
1114134327 14:19829813-19829835 AGGAATATAAATTTTGTACATGG + Intergenic
1117288079 14:54306841-54306863 AGCAAAATACAATTGGAGCTTGG + Intergenic
1117984254 14:61372136-61372158 AAGAATATACAAAGTGAGCCAGG - Intronic
1118121947 14:62855488-62855510 ATGAATCTACAATTTGCACAGGG - Intronic
1118883589 14:69849153-69849175 AGGGTTATACAATTTGCCCAAGG + Intergenic
1119051554 14:71374131-71374153 AAGAATATACAATATGCCCATGG - Intronic
1120399253 14:84007200-84007222 AGGAAGATTCACTTTCAGCAGGG - Intergenic
1121132578 14:91461831-91461853 AGGAATATACTATTTCAGGAAGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121910345 14:97784860-97784882 AGAAATATACAAGATGAGCCTGG - Intergenic
1123430270 15:20209104-20209126 AGAAAAAGACAATTTCAGCAGGG + Intergenic
1123577386 15:21685405-21685427 AGGAATATAAATTTTGTACATGG + Intergenic
1123614008 15:22127875-22127897 AGGAATATAAATTTTGTACATGG + Intergenic
1123810834 15:23924496-23924518 AGGATTATACACTATGACCAAGG - Intergenic
1124080068 15:26485497-26485519 GGGAATATACAATATAAGCCTGG + Intergenic
1124281282 15:28364482-28364504 AGGAATAAAAAAAGTGAGCATGG + Intergenic
1124301420 15:28547139-28547161 AGGAATAAAAAAAGTGAGCATGG - Intergenic
1125060451 15:35415195-35415217 ATGAATATACAAGGTCAGCATGG + Intronic
1125124883 15:36208540-36208562 AGGAAAATAATATTTGACCACGG + Intergenic
1127063677 15:55214544-55214566 AGGATGATAGAATATGAGCATGG - Intronic
1127266290 15:57365068-57365090 AGGAAAATACTATTAGAGCCAGG + Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1128190980 15:65696717-65696739 GGAAATATAAAATTTGTGCATGG - Intronic
1128442113 15:67720131-67720153 TGGAATATACAATTTTAACTAGG - Intronic
1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG + Intronic
1130341930 15:83006808-83006830 AAGAAGATAAAATTTGAGAAGGG + Intronic
1132356661 15:101176068-101176090 AGGAATATAAAAATTAAGGAGGG + Exonic
1202986255 15_KI270727v1_random:419650-419672 AGGAATATAAATTTTGTACATGG + Intergenic
1134390319 16:13813992-13814014 ATGAATCTACAAATTGGGCAGGG + Intergenic
1134902009 16:17946856-17946878 ACGTATATACAAATTGGGCATGG - Intergenic
1135848455 16:25940479-25940501 AGGGATTTACAACATGAGCAGGG + Intronic
1136854366 16:33642102-33642124 AGAAAAAGACAATTTCAGCAGGG - Intergenic
1137400424 16:48148718-48148740 AGGAATAAACAGTTTGTCCAGGG - Intronic
1140034859 16:71364312-71364334 GGGAATATACAAGCTGAGCAGGG - Intronic
1140773780 16:78230724-78230746 AGGCAAATTCACTTTGAGCAGGG + Intronic
1141047221 16:80726708-80726730 TGGAATATACAAAATGAGCCTGG + Intronic
1141074849 16:80995358-80995380 AGGAATATACAATGTAGGCCAGG + Intronic
1141232406 16:82181461-82181483 AGTAATATACATTTTCAGCCAGG - Intergenic
1143530406 17:7499761-7499783 AGAAAAATAAAATTTGAACAAGG - Intronic
1144401293 17:14905051-14905073 AGGCTTATAAAATTTGAGCCAGG + Intergenic
1145090053 17:19978508-19978530 AGGAAAATGGCATTTGAGCAAGG - Intergenic
1145754830 17:27382741-27382763 GGGAATATAAAAGTTGGGCAGGG + Intergenic
1146455856 17:33009224-33009246 AGGAATTTCTAATCTGAGCAAGG - Intergenic
1146754640 17:35418218-35418240 AGGGACAGACAATTTGATCAAGG + Intronic
1146821701 17:35988091-35988113 ATGAATAAACAAATTGAGCCAGG + Intronic
1147948561 17:44094028-44094050 AGGAAAATACAGGCTGAGCACGG + Intronic
1149270552 17:54972619-54972641 AGGAAAATACAAGATAAGCATGG - Intronic
1149589128 17:57815316-57815338 AGGAATAGGCAATTAGACCAGGG - Intergenic
1149972615 17:61234277-61234299 AGGAATGTAGGATTTGAGGAAGG - Intronic
1150113624 17:62524619-62524641 AGGAACATACAAATTTGGCAAGG - Intronic
1151258738 17:72900289-72900311 AGAGAGATACCATTTGAGCAAGG + Intronic
1203159140 17_GL000205v2_random:33123-33145 AGGAAAATACATTGAGAGCACGG + Intergenic
1153557259 18:6328434-6328456 AGGAACATTCAATTTTGGCAAGG - Intronic
1153754881 18:8271630-8271652 AGTAATCTAAAATTTTAGCATGG - Intronic
1154267554 18:12892248-12892270 AGGTTTATTCAATTTGACCAAGG - Intronic
1154320039 18:13342086-13342108 AGGATTATACAATACGATCAAGG - Intronic
1156769705 18:40704546-40704568 AGGAATTGAGAAATTGAGCAAGG - Intergenic
1157648716 18:49304809-49304831 AGAAATTTACAAAATGAGCACGG - Intronic
1157913521 18:51641630-51641652 TGGAATATATAATTTCAACAGGG + Intergenic
1162430123 19:10623444-10623466 AGGAATATACATTTAGTGCTGGG - Intronic
1163240001 19:16055925-16055947 ACTAATAAACAATTTTAGCAAGG - Intergenic
1164661820 19:29980118-29980140 AGGAATATTAAGTTTGGGCATGG - Intronic
926884454 2:17584565-17584587 AGGGATATACCATTTGGCCAAGG + Intronic
928298836 2:30108193-30108215 ATGAATCTATAATTTGGGCAGGG + Intergenic
929367102 2:41172704-41172726 AGGAATAAACTATTTCAGAAAGG + Intergenic
929413479 2:41723502-41723524 TGGAATGTACAATTTCAGAAAGG - Intergenic
929441684 2:41970230-41970252 ACAAATCTGCAATTTGAGCAGGG + Intergenic
930501135 2:52219589-52219611 AGGAATAGACAAATAGATCAAGG + Intergenic
931222857 2:60303957-60303979 AGGAGTATATAATTTGCACAGGG + Intergenic
932030632 2:68180460-68180482 AAGACTGTACAATTTGAGCCGGG - Exonic
936763424 2:115814610-115814632 AGGAAAATACAATTTTACGAAGG + Intronic
937598701 2:123703036-123703058 AGGAATAAACAAGATGAGCCTGG + Intergenic
939534477 2:143410192-143410214 AGGAATATACCATTTTATAATGG - Intronic
939954582 2:148516637-148516659 AGCAATAAACAACTCGAGCATGG + Intronic
940062617 2:149589062-149589084 GGGAATATACAAGATGAGCCTGG - Intergenic
940266063 2:151839812-151839834 AGGAATATTCAGTTAGATCAAGG - Intronic
940539966 2:155001347-155001369 GGGAATATGCATTTTGATCAGGG + Intergenic
941867415 2:170349345-170349367 AGGAATTTACAGTTTGAGTGGGG - Intronic
942074518 2:172344317-172344339 ATGAATCTACAATGTGGGCAGGG + Intergenic
942376849 2:175346303-175346325 GGAAATATACAATATGAGCCTGG - Intergenic
942758748 2:179373275-179373297 AGGAAACTAGAATTTGGGCAAGG - Intergenic
943431556 2:187809224-187809246 AGGCTAAGACAATTTGAGCAGGG + Intergenic
943607236 2:189990480-189990502 AGGACTATACACTCTGACCAAGG - Intronic
943859475 2:192842517-192842539 AGGACTAAACAATTAGGGCATGG - Intergenic
944997975 2:205315972-205315994 AGGAATTTACAATTTCATTAAGG - Intronic
945201629 2:207287557-207287579 ATTCATATACAATTTGAGTATGG - Intergenic
945298854 2:208197270-208197292 AGAAATAGAAAATTTGAGCCAGG - Intergenic
945701282 2:213173964-213173986 AAGAATATACATTTTGAAAAGGG - Intergenic
946037710 2:216756951-216756973 AGGAATATGCAAGATGAGAAGGG - Intergenic
946584798 2:221172998-221173020 ATTAATTTACAGTTTGAGCAGGG - Intergenic
946704476 2:222444912-222444934 AGGAAAATAAATTGTGAGCATGG + Intronic
947466652 2:230355715-230355737 AGCAATTTACAATATGAACATGG - Intronic
1169893686 20:10479640-10479662 AGAAATATGCAATTCGAGCCGGG - Intronic
1170217967 20:13911852-13911874 AAGGATATAAAATTTAAGCAAGG - Intronic
1171071612 20:22074129-22074151 AGAAATATGCATTTTTAGCAAGG + Intergenic
1173068153 20:39734674-39734696 GGGAATATACAAGATGAGCCTGG + Intergenic
1173691350 20:44963565-44963587 AGAAATCTACAATTTGAGCATGG - Intergenic
1174937821 20:54891507-54891529 ATGAATATACCATTCGTGCATGG + Intergenic
1177184497 21:17778782-17778804 AAGAAAATACAATTTGGGCTGGG - Intergenic
1177193405 21:17876664-17876686 GGAAATATATAATTTAAGCAGGG + Intergenic
1177559857 21:22736424-22736446 AAGAATATACAATTTAATGAAGG - Intergenic
1177732457 21:25045578-25045600 ATGAAAATACAATATGAGTAAGG + Intergenic
1178026660 21:28475958-28475980 TGGAATAAACATTTTTAGCAAGG - Intergenic
1178192810 21:30305393-30305415 AGAAGTATACAATGTGTGCAGGG - Intergenic
1181298348 22:21860377-21860399 AGGTATATAAATTGTGAGCAAGG + Intronic
949693987 3:6672832-6672854 AGAAATAAACAATTTGAGATGGG - Intergenic
949759149 3:7449358-7449380 AGGAAGATTCAACTTCAGCAAGG + Intronic
949789544 3:7778088-7778110 AGGAATCTGCAATTTAACCAGGG + Intergenic
950987410 3:17389700-17389722 TTGAATCTACAACTTGAGCAGGG - Intronic
951265238 3:20557627-20557649 AGGTCTATTCAATTTTAGCATGG - Intergenic
952765517 3:36950510-36950532 AGAAATGTACAAGTTGAGCTTGG + Intergenic
953621063 3:44533330-44533352 AAGACTTTACAATTTGAGAAGGG - Intergenic
957746821 3:84354801-84354823 GAGAATAAACAATTTGACCAAGG - Intergenic
959365328 3:105451106-105451128 AGGAAAAAAAAATCTGAGCATGG + Intronic
959794528 3:110408913-110408935 ATGAATAAACAAATTCAGCAAGG - Intergenic
962183276 3:133231355-133231377 ATGAATCTGTAATTTGAGCAGGG + Intronic
962428113 3:135292561-135292583 AGAAATATACAAGATGAGCTTGG + Intergenic
962486750 3:135851061-135851083 AAGAATAAGCAATTTGACCAAGG + Intergenic
963553234 3:146751785-146751807 AGAAATATTCTCTTTGAGCACGG - Intergenic
965294678 3:166928586-166928608 AAGAAAAGAAAATTTGAGCAGGG + Intergenic
966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG + Intergenic
967119372 3:186369196-186369218 AGAAATCTACATTTTGAACAAGG + Intergenic
967750746 3:193113592-193113614 AGGAATATCGTATTTGAGAATGG + Intergenic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
970096576 4:12469956-12469978 AGAAAGATCAAATTTGAGCAAGG + Intergenic
970226338 4:13861212-13861234 AAGAATATAGAATTACAGCAGGG + Intergenic
971020016 4:22525337-22525359 AAGAATATACCATTTCAGAAAGG - Intergenic
973707741 4:53596946-53596968 AAGAATGTAAAATTTGAGGAAGG - Intronic
973880539 4:55267399-55267421 TGGAATCTAAAATATGAGCATGG + Intergenic
975077719 4:70233477-70233499 AGGAAAATAAAATTTGAAGAGGG + Intronic
975181031 4:71345316-71345338 ATGAATAAAGAATTTGGGCAGGG - Intronic
976904981 4:90226229-90226251 ATGATTTTACAATCTGAGCAAGG - Intronic
977003284 4:91530980-91531002 AGAAATATACAATTTTTGCCGGG - Intronic
977162259 4:93649966-93649988 AGGCATATACAAGGTGAGCTGGG - Intronic
977782913 4:100999314-100999336 AGGAATACAAAATTACAGCAAGG - Intergenic
977957017 4:103039940-103039962 AAGAATATACCATTTGAGGCTGG - Intronic
978050383 4:104191612-104191634 AGGAATCTACCATTTAGGCAGGG - Intergenic
978410909 4:108424398-108424420 GAGAATATACAAGTTGAGCCTGG + Intergenic
979614041 4:122721524-122721546 ATGAATCTACAATTTAGGCAGGG + Intergenic
979629712 4:122886773-122886795 GGGAATATACAAAATGAGCCTGG - Intronic
979857046 4:125646701-125646723 TGGAATAGAGAATTTAAGCAAGG - Intergenic
980094765 4:128477915-128477937 AGAAATCTGCAATTTAAGCAAGG - Intergenic
980759668 4:137214130-137214152 TGGAATATACAAGATGAGCCTGG + Intergenic
981158345 4:141467099-141467121 AGGAATATACAAGGTGAGTCTGG + Intergenic
981210687 4:142100511-142100533 AAGAATTTACAAATTAAGCAGGG - Intronic
981551518 4:145946422-145946444 AGGAACATACTATATCAGCAAGG + Intergenic
982483162 4:155935569-155935591 GGGAGTGTACAATTTGAGAAAGG - Intronic
982795214 4:159636288-159636310 AGGAATCTACATTTTAAACAAGG + Intergenic
982980755 4:162131952-162131974 AAGAATCTACAATTTAAACAGGG + Intronic
986062402 5:4203657-4203679 AAGAATTTACAATGGGAGCAAGG - Intergenic
986122442 5:4853945-4853967 TGGCATATACAATTTGAGATTGG + Intergenic
987485759 5:18523616-18523638 AGGCATCTACACTTTGAGAAGGG - Intergenic
989792922 5:45429288-45429310 AGGAATGTGAAATTTGGGCAGGG + Intronic
991035741 5:62125633-62125655 AGGAATGTACTTTCTGAGCAAGG + Intergenic
991047507 5:62238079-62238101 AGAAAAAGACAATTTCAGCAGGG + Intergenic
991606189 5:68403490-68403512 ACGAATATGCAATTTGGGCAGGG - Intergenic
991940617 5:71848839-71848861 ATACATCTACAATTTGAGCAAGG + Intergenic
992426719 5:76665103-76665125 AGGAATAAAAAGTTTGAGTAAGG + Exonic
992563920 5:77979146-77979168 AGAAATATCCATTTTGAGTATGG - Intergenic
993148450 5:84127677-84127699 AGGAATACAGAATTAGAGCAAGG - Intronic
993808935 5:92450696-92450718 AGCAATATACAATTTAGGTATGG - Intergenic
995651595 5:114375768-114375790 AGGCTTCTACAATTTAAGCATGG + Intronic
995689629 5:114809951-114809973 TGGAATAAACAATATGAGCAAGG + Intergenic
995982733 5:118125071-118125093 ACTAATAAACAATTTCAGCAAGG + Intergenic
998946638 5:147347055-147347077 AAGGATATACATTTTCAGCAAGG + Intronic
999742245 5:154565218-154565240 AGGAAAAGAAAATTAGAGCAGGG + Intergenic
1000839158 5:166195180-166195202 AGGAAAAAAAAATTTGAGCCGGG + Intergenic
1000847295 5:166297665-166297687 AGGACTATACAAGTTGAGCCAGG + Intergenic
1000883251 5:166721158-166721180 AGCAATATACTTTTGGAGCATGG - Intergenic
1000966504 5:167663907-167663929 AAGAATTTTCAAATTGAGCAAGG - Intronic
1004171820 6:13301082-13301104 AGGAAAATGCACTTTGAGCTTGG + Intronic
1004539387 6:16535327-16535349 GGGAATATCCAAGATGAGCATGG + Intronic
1005018589 6:21396477-21396499 AGGAATTTACAATGTCACCAAGG - Intergenic
1005504172 6:26455726-26455748 AGGAATCTAGAATTTGAACAGGG + Intergenic
1006884541 6:37369991-37370013 AGGAAATGACATTTTGAGCAGGG - Intronic
1007141486 6:39579374-39579396 GGGAATAAATAATTTGAGCAAGG - Intronic
1008187951 6:48418083-48418105 GGGAATTTACAATTTAATCAAGG - Intergenic
1011774844 6:90718232-90718254 AGGAATGTACACGTTGAGCCTGG + Intergenic
1013413523 6:109903833-109903855 AAGAATATACCATATCAGCATGG - Intergenic
1013648281 6:112167760-112167782 AGGAAGATACAATTTGTGCAAGG + Intronic
1013795126 6:113879291-113879313 AGGAATTTGGAATCTGAGCAGGG - Intergenic
1013868831 6:114731233-114731255 AGGTAAATACAATTTCAGAATGG + Intergenic
1014329742 6:120047757-120047779 AGGAATACACAAGATGAGCCTGG - Intergenic
1015742577 6:136472893-136472915 TGGAAGATATGATTTGAGCAGGG - Intronic
1016470303 6:144368474-144368496 AGGAATATACATGATAAGCATGG + Intronic
1017507899 6:155085262-155085284 AAGAAGATACAATTTGAAGAAGG + Intronic
1018149289 6:160923635-160923657 AGCAATATACAACTTCAACAGGG - Intergenic
1018227948 6:161647565-161647587 AGGAATATACTCTCTGAGTATGG - Intronic
1018302851 6:162421940-162421962 AGTAATATCTAATTTCAGCAAGG + Intronic
1020064624 7:5177823-5177845 AGGAAGAAAAAATCTGAGCAGGG + Intergenic
1021615799 7:22501259-22501281 AGAAAAAGACAACTTGAGCAGGG + Intronic
1021628724 7:22622673-22622695 AGGAAAGTACAAGTTGAGAAAGG - Intronic
1026109675 7:67449186-67449208 AGGAATTTGCATTTTGAGCTGGG + Intergenic
1026453521 7:70550943-70550965 AGGAATATACAAGATGAACCTGG + Intronic
1028376701 7:90153377-90153399 AGAAAAAGACAACTTGAGCAGGG - Intergenic
1030910983 7:115248570-115248592 AGGAAAATACAAAATGAGCTTGG - Intergenic
1031473711 7:122197768-122197790 AAGATTATACAATTTGGGCTGGG - Intergenic
1032043323 7:128580382-128580404 AGGAACATACAAATTTGGCAAGG - Intergenic
1035418097 7:158705966-158705988 AGCAATATAAAATTATAGCAGGG + Intergenic
1036403865 8:8436309-8436331 AGCAATATTCAATTTGAAAATGG - Intergenic
1036846115 8:12171920-12171942 AGGAATATACTAGGAGAGCAGGG - Intergenic
1036867480 8:12414239-12414261 AGGAATATACTAGGAGAGCAGGG - Intergenic
1038029057 8:23621138-23621160 ACTAATATAAAAGTTGAGCAGGG - Intergenic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1039404514 8:37301111-37301133 ATGAATAGGCAATTTGGGCATGG - Intergenic
1042652274 8:71056369-71056391 AGGAATAAAAAACTTCAGCATGG + Intergenic
1042782227 8:72504478-72504500 AGAAATATACAAGATGAGCCTGG + Intergenic
1042825933 8:72979213-72979235 ATGAATCTGCAATTTGAACAGGG - Intergenic
1044147645 8:88737546-88737568 AGAAATATACAATTTTAAAAAGG - Intergenic
1044337145 8:90999821-90999843 AGCTATATACAATTTGAGGAAGG - Intronic
1045572533 8:103383651-103383673 GGAAATGTACAATATGAGCATGG + Intergenic
1047878116 8:129162944-129162966 ATGAATCTGCAATTTGGGCAAGG + Intergenic
1047891323 8:129314383-129314405 GGGATTATTCAATTTGACCATGG - Intergenic
1048828449 8:138452782-138452804 AGGAATGAACATTCTGAGCATGG - Intronic
1048982050 8:139707711-139707733 AGGAATATCTACTTTGGGCAGGG - Intergenic
1050164452 9:2749156-2749178 AAGAAAATATAATTTGATCATGG - Intronic
1050654480 9:7811427-7811449 AGAAACATCCAATTTGGGCAAGG - Intronic
1051074294 9:13211900-13211922 AAGAATATAAAATTTGAACATGG - Intronic
1051328474 9:15998502-15998524 AGGAATAGACAATCTGCGTATGG - Intronic
1052532032 9:29698249-29698271 AGGAATATCTAATTTGAGTAGGG + Intergenic
1052652068 9:31318042-31318064 AGTAATACACATTTGGAGCATGG - Intergenic
1053194104 9:36101870-36101892 AGAAGTGTACAATTTGAGTAAGG + Intronic
1054075399 9:60524169-60524191 AGGAATAAACACTCAGAGCATGG + Intergenic
1054838124 9:69701923-69701945 AGAACTAAACAATTTCAGCAAGG - Intergenic
1054857147 9:69913343-69913365 AGGAATATACACAATGAGCCTGG + Intergenic
1054988460 9:71291354-71291376 AGGAAAGTACAATATGAGAAAGG - Intronic
1055218875 9:73903554-73903576 ATGAATATAAAATAGGAGCATGG - Intergenic
1056236469 9:84599642-84599664 AGGAATTCACCATTTGAACACGG - Intergenic
1057323867 9:94041763-94041785 GGGAATATACAAGATGAGCCTGG - Intronic
1057891322 9:98872137-98872159 AGGAATAAACAACTACAGCAGGG - Intergenic
1059430913 9:114249861-114249883 AGGAAAATACAAACTGAGCCGGG - Intronic
1059912128 9:119056237-119056259 GGGAAGAAAGAATTTGAGCAGGG + Intergenic
1060327955 9:122635967-122635989 AGGGATATAGAATTTGAGTTTGG - Intergenic
1062307372 9:135916075-135916097 AGGATTATACACTATGACCAAGG + Intergenic
1187340458 X:18416661-18416683 GTGAATTTGCAATTTGAGCAAGG + Intergenic
1187482869 X:19673958-19673980 AGGAATGTGGTATTTGAGCAAGG - Intronic
1189849205 X:45162266-45162288 ATGAATATGCAACTTGAGCAGGG - Intronic
1189928433 X:45982301-45982323 ATGAATATGAAATTTGGGCAGGG - Intergenic
1190149432 X:47931600-47931622 AGGAAAATACAAGATGAGCCTGG - Intronic
1190159365 X:48019583-48019605 AGGAATATACAATCTGAAAGGGG - Intronic
1190175077 X:48141816-48141838 AGGAATATACAATCTGAAAGGGG - Intergenic
1192267423 X:69548412-69548434 AGGAATATATAAACTAAGCAAGG + Intergenic
1194265252 X:91745172-91745194 AGGAAAAGGCAATTTGACCAAGG + Intergenic
1194283425 X:91981363-91981385 TGGAATATACAATTTCGGCAAGG - Intronic
1194481535 X:94432065-94432087 AGAAAAATACAATGTGATCATGG - Intergenic
1194987409 X:100505853-100505875 ATGAATATACAAGATGAGCCTGG + Intergenic
1195603249 X:106772328-106772350 AGCAATATAAAATTTGCTCAAGG - Intronic
1195897327 X:109759845-109759867 AAGAAGAAACAATATGAGCAAGG + Intergenic
1196226203 X:113170027-113170049 AGTAAGATACAATTTGTGTATGG + Intergenic
1200582405 Y:4965620-4965642 AGGAAAAGGCAATTTGACCAAGG + Intergenic
1200601000 Y:5205927-5205949 TTGAATATACAATTTCGGCAAGG - Intronic