ID: 1079314461

View in Genome Browser
Species Human (GRCh38)
Location 11:19395975-19395997
Sequence AGTTGGCCTCAGGCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079314457_1079314461 7 Left 1079314457 11:19395945-19395967 CCTTATGGAGTATAATCTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 27
4: 273
1079314452_1079314461 22 Left 1079314452 11:19395930-19395952 CCCAGCCTTGCACTTCCTTATGG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 27
4: 273
1079314454_1079314461 21 Left 1079314454 11:19395931-19395953 CCAGCCTTGCACTTCCTTATGGA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 27
4: 273
1079314455_1079314461 17 Left 1079314455 11:19395935-19395957 CCTTGCACTTCCTTATGGAGTAT 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 27
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079314461 Original CRISPR AGTTGGCCTCAGGCAGGACT TGG Intronic
900013326 1:133758-133780 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
900043390 1:489745-489767 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
900064828 1:724742-724764 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
900385550 1:2408991-2409013 TGTTGGCCTCAGCCAGCACGGGG - Intronic
900679237 1:3907227-3907249 ACGTGGACCCAGGCAGGACTGGG + Intergenic
901008382 1:6183049-6183071 AAATGGCCTCAGGCAGGCCTTGG - Intronic
901134578 1:6984661-6984683 AGTAGGCTTCAGGCAGGACCTGG + Intronic
901806342 1:11741039-11741061 AGTTGGGGGCAGGCAGGGCTGGG - Intronic
902699407 1:18161388-18161410 TGTTGGAATCAGGCAGGCCTGGG - Intronic
902826781 1:18980039-18980061 AATTGGTCTCAGGCAAGAGTGGG - Intergenic
902975609 1:20086021-20086043 AGTGGGCCTAAAGCAGGGCTGGG + Intronic
904044507 1:27601956-27601978 AGTTGGTGTCAGGCGGGACTTGG - Intronic
904162997 1:28535135-28535157 AGGTGGCCTCAGGTGGGTCTGGG + Exonic
904330480 1:29755155-29755177 AGCTGGCATCAGGCAGGCCTGGG + Intergenic
904351888 1:29913787-29913809 AGTTGACCTCAGGCAGCCGTTGG - Intergenic
904416199 1:30362439-30362461 AGCTGGCATCAGGCAGGCCTGGG - Intergenic
904593386 1:31627757-31627779 AGATGGACTCAGCCAGGCCTCGG + Intronic
904610422 1:31723026-31723048 AGGTGGCCTGAGGGAGGACCTGG - Intergenic
904961925 1:34340177-34340199 AGTGTGCCTGAGCCAGGACTAGG + Intergenic
905957147 1:42007266-42007288 AGTGAGCCTCATGAAGGACTGGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
909733569 1:78928041-78928063 TGAGGGCCTGAGGCAGGACTTGG + Intronic
910198077 1:84666855-84666877 GGGTGGCCTCATGCAGAACTCGG - Intronic
911413498 1:97540756-97540778 AGAAGGACTGAGGCAGGACTAGG - Intronic
913223623 1:116679524-116679546 AGCTGTCCTCAGGCAAGATTAGG - Intergenic
914883019 1:151562234-151562256 AGTCGGCTCCAGGCAGTACTTGG - Intronic
917791638 1:178502935-178502957 AGTTGGCCTGAGGCGGGTCCTGG - Intergenic
918205124 1:182301399-182301421 AGTGGGCAGCAGGCAGGATTTGG - Intergenic
920387824 1:205580714-205580736 AGTTGGCCTCAGACAGGAAAGGG - Exonic
922099733 1:222470761-222470783 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
922261768 1:223950253-223950275 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
922735312 1:227975489-227975511 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
923423903 1:233848675-233848697 AGTTGGCCTCAGTTAGCACACGG - Intergenic
924342933 1:243052428-243052450 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1064225803 10:13483795-13483817 AGACAGCATCAGGCAGGACTTGG + Intronic
1064893245 10:20204142-20204164 AGTTGGCCTCAGGCATGAAATGG - Intronic
1065920348 10:30387449-30387471 AGTTAGCCACAGGCAGGGCAGGG + Intergenic
1066733550 10:38453124-38453146 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1068905296 10:62315464-62315486 TGTTGTCCGCAGGGAGGACTTGG - Intergenic
1069896822 10:71685196-71685218 AGTGGGTCTGAGGCAGGGCTGGG + Intronic
1070652569 10:78248422-78248444 ACTTGGACTCAGGCAGACCTCGG - Intergenic
1073580813 10:104664040-104664062 ATCTGGGCTCAGGCATGACTTGG + Intronic
1075895732 10:125992992-125993014 AGTGGGCCTCATGGAAGACTTGG + Intronic
1075975031 10:126687319-126687341 AGGTGGCCTCAGCCAGGCCCAGG - Intergenic
1076469803 10:130710454-130710476 AGTTTGCCACAGGCAGGGATGGG + Intergenic
1076969663 11:125962-125984 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1077433815 11:2528658-2528680 AGCAGGACTCTGGCAGGACTGGG + Intronic
1077439745 11:2562315-2562337 AGCTGGCCACAGGCAGGCCCTGG + Intronic
1078127831 11:8585617-8585639 AATGGACCTCAGGCAGGGCTTGG + Intronic
1078341377 11:10499931-10499953 ATATGGCCTCAGGCAGGCCAAGG + Intronic
1079123501 11:17701838-17701860 AGTTGGACTCATGCAGCACGTGG + Intergenic
1079128230 11:17733678-17733700 AGGTGGGCCTAGGCAGGACTGGG - Intergenic
1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG + Intronic
1079532089 11:21466334-21466356 AGTGGGCATCAGTCAGGACAAGG + Intronic
1080233819 11:30046476-30046498 AGAAGGCCTTTGGCAGGACTGGG + Intergenic
1080660926 11:34295324-34295346 GGTTGGCCACAGGCAGGAGGAGG + Intronic
1081731363 11:45373996-45374018 AGTTGGCAAGAGGCAGGAATGGG - Intergenic
1081803082 11:45872955-45872977 ACTGGTCCTCAGGCAGGGCTGGG - Intronic
1083269286 11:61563277-61563299 AGTTGGCCAGGGGCAGGGCTGGG - Intronic
1083658151 11:64240048-64240070 AGTGGGCCTAAGGCAGGAGTGGG + Intergenic
1083878608 11:65537490-65537512 GGTTGGGCTGAGGGAGGACTGGG + Intronic
1086405450 11:86495478-86495500 AGCTGGCCTTAGGCAAGAATTGG - Intronic
1087162809 11:94966311-94966333 AGTTGGCCTGAGGCTGGGATGGG + Exonic
1087170339 11:95043362-95043384 TGCTGGGCTCAGGCAGTACTTGG + Intergenic
1088545811 11:110957616-110957638 TGCTGGCCACAGGCAGGTCTGGG - Intergenic
1089456801 11:118630433-118630455 AGTTACCCTCAGGCAGCCCTTGG - Intronic
1096094600 12:48925869-48925891 CGTTGGACTCAGGCAGTCCTGGG - Intronic
1097631547 12:62070025-62070047 AGCTGGTCTCAGGCAGCTCTGGG - Intronic
1098610372 12:72450045-72450067 AGGTGGAAACAGGCAGGACTTGG - Intronic
1101578546 12:106020439-106020461 AGTTGGACTAATGCAGGGCTGGG - Intergenic
1102930790 12:116860547-116860569 AGCTGACCTCATGCATGACTTGG - Exonic
1104058995 12:125252203-125252225 AGTGGGCCTCAGGAAGGGCCCGG + Intronic
1104927684 12:132322067-132322089 AGATGCCCTCAGCCAGGACTGGG - Intronic
1105025175 12:132843606-132843628 ATTTGGCCTCAGTCAGGAGCCGG - Intronic
1106109410 13:26763261-26763283 AAGTGGCCTCAGGCAGCCCTGGG + Intergenic
1106825876 13:33519827-33519849 AGTTGGCTCTATGCAGGACTTGG - Intergenic
1106843502 13:33711809-33711831 ATTTGTCCTCAAGCATGACTAGG - Intergenic
1108161025 13:47639487-47639509 ATTTGGCCTAAGGCAGCACAAGG + Intergenic
1108444584 13:50494575-50494597 AGTTGGGTTCAGGCAACACTGGG + Intronic
1115696536 14:35905219-35905241 AGTTATTCTCAGGCAGGAATGGG + Intronic
1115701895 14:35961773-35961795 TGTTGGTCTGAGGTAGGACTTGG - Intergenic
1116886842 14:50230898-50230920 TGTTGTCCTCAGGCTGGAATCGG - Intronic
1117151508 14:52892830-52892852 AATTGGACTCAGGCAGAAATTGG - Intronic
1117606995 14:57440300-57440322 TGTTGGCCTGGGGTAGGACTCGG - Intergenic
1117775037 14:59174934-59174956 AATTGGCCGCAGGCAGGAAAGGG - Intergenic
1118067450 14:62207296-62207318 AGTTGGGCTCAAGCAGGCCTGGG - Intergenic
1118774681 14:68966441-68966463 AAGTGGCCACAGGCAGCACTAGG + Intronic
1120703072 14:87719686-87719708 ATTTGGCATCACGCAGGTCTGGG - Intergenic
1121737542 14:96228859-96228881 ACTTGGCCTCAGGCAGACCCAGG + Intronic
1122444894 14:101761423-101761445 AGCCGGCCTCAGGCAGGCCGCGG - Intergenic
1122981890 14:105195815-105195837 AGTTGGCCTGAGTCAGGGCCAGG + Intergenic
1202906478 14_GL000194v1_random:76496-76518 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1124239929 15:28020395-28020417 AGTGGGACTCAGGCAGGAGGGGG - Intronic
1124376283 15:29131130-29131152 GGTTGGCCTCACCCAGGAGTGGG - Intronic
1124377190 15:29135808-29135830 TCTTGGCCTCAGACAGGACCAGG + Intronic
1125738169 15:41943017-41943039 AGAGGGCCTCAGCCAGCACTTGG + Intronic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1126902394 15:53327551-53327573 TGTCTGCCTCAGGCAGGACAAGG + Intergenic
1127715527 15:61645574-61645596 AGCTGGGCTCAGCCAGGGCTAGG - Intergenic
1127861553 15:62998050-62998072 ATTTGGTCTCAGGCAGAACTGGG - Intergenic
1127888639 15:63227347-63227369 AGATGTCCTCAGGCAAGCCTGGG - Intronic
1128130727 15:65225460-65225482 AGGAGGCCTCAGGCAGGCCTGGG - Intergenic
1128906697 15:71473887-71473909 AATTGGCCTAAGGTAGGACCTGG - Intronic
1129077012 15:73005566-73005588 TGTGGGCCACAGGAAGGACTTGG + Intergenic
1129151884 15:73694297-73694319 AGCTGGGCTCAGGCATCACTCGG + Intronic
1129247467 15:74288223-74288245 AGTTGGCCTCTGGGAGGAAAAGG - Intronic
1132930732 16:2457979-2458001 AGTTGGGATCAGCCAGGACACGG - Exonic
1133211391 16:4265014-4265036 AGGTGGCCCAAGGCTGGACTTGG - Intronic
1133444350 16:5847263-5847285 AGTTGGGAACATGCAGGACTTGG + Intergenic
1133839019 16:9392125-9392147 AGGTGACCTCAGGCATAACTGGG - Intergenic
1135854569 16:25995434-25995456 AGATGGCCTCTGGCAGCCCTAGG + Intronic
1138599966 16:58048272-58048294 GTTAGGCCTCAGGCAGGCCTGGG - Intergenic
1139352890 16:66348328-66348350 CGTGGGCCTGAGGCAGGGCTGGG + Intergenic
1139631497 16:68234493-68234515 TCTGGGCCTCAGGCAGGCCTGGG - Intronic
1140583749 16:76262335-76262357 TTTTGGCCTCAGGCAGGTCCAGG - Intergenic
1141713808 16:85715680-85715702 AGCAGGCATCAGGCAGGATTGGG + Intronic
1141772728 16:86101000-86101022 AGTTAGCCACAGGCAGGCCCGGG + Intergenic
1141884473 16:86882371-86882393 ACTTGCCCTCAGGCACAACTGGG + Intergenic
1142150421 16:88510210-88510232 AGCTGGGCAGAGGCAGGACTTGG + Intronic
1142451014 16:90173160-90173182 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1142456549 17:60535-60557 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1142563059 17:822536-822558 AGCAGGACTCAAGCAGGACTGGG + Intronic
1143021978 17:3921604-3921626 AGCTGGACTCAGGCCGGCCTGGG + Intergenic
1144137748 17:12314566-12314588 AGTGGGTCTCAGGCAGGGGTAGG + Intergenic
1144667376 17:17111384-17111406 AGGTGTCCTGAGGCAGGACCAGG + Intronic
1146646655 17:34581006-34581028 ACTTGGCCCCAGGCTGGGCTTGG - Exonic
1149304251 17:55333139-55333161 AATTGGCCTCAGCCAGCACAAGG - Intergenic
1151102039 17:71566977-71566999 AGGTGGCCGCCGGCAGGACTTGG - Intergenic
1151566642 17:74902266-74902288 AGTGGGCATCAGCCAGGCCTGGG - Intergenic
1152342544 17:79733366-79733388 AGTGGGCCTGGGGCAGGGCTGGG - Intronic
1152359007 17:79821652-79821674 AGCTGGCCTTGGGCAGGTCTGGG + Intergenic
1156252215 18:35361557-35361579 GGTTGTTCTCAGGCAGGAGTGGG + Intergenic
1157038029 18:44000346-44000368 TCTAGGCCTCAGACAGGACTTGG + Intergenic
1157891313 18:51420723-51420745 AGTAGGCCTCAGGCAGGAATTGG - Intergenic
1158657174 18:59348393-59348415 GGTAAGCCCCAGGCAGGACTCGG - Intronic
1160185791 18:76675235-76675257 AGATGGCCTCAGACAGGAGCCGG + Intergenic
1160563868 18:79775003-79775025 AGTCGAACTCAGGCAGGAGTGGG + Intergenic
1160646467 19:195888-195910 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1160988444 19:1850941-1850963 TATGGGCCTCAGGGAGGACTTGG + Intergenic
1161240866 19:3223021-3223043 TGTGGGCCTCAAGAAGGACTTGG + Intergenic
1161257320 19:3316561-3316583 TGATGGCCTCTGGGAGGACTTGG + Intergenic
1161277492 19:3426756-3426778 AGCGGCCCTGAGGCAGGACTGGG - Intronic
1161300033 19:3538061-3538083 TGTGGGCCTCAGGGAGGACTTGG + Intronic
1161619191 19:5289516-5289538 GGTGGGCCTCAGGAAGGACTTGG - Intronic
1161650388 19:5480625-5480647 GGTAGGCCTCGGGGAGGACTTGG + Intergenic
1162573633 19:11486401-11486423 AGGTGGCCAGTGGCAGGACTGGG + Intronic
1165121575 19:33562466-33562488 GGTTAGCCTCAGGCAAGAATGGG + Intergenic
1165358328 19:35317905-35317927 TGTAGGCCACAGGCAGGACTGGG + Intergenic
1165358342 19:35318011-35318033 TGTAGGCCACAGGCAGGACTGGG + Intergenic
1167126429 19:47552363-47552385 AAATGGCCACAGGCAGGATTGGG - Intronic
925038209 2:708655-708677 AGCAGCTCTCAGGCAGGACTCGG - Intergenic
926490139 2:13515530-13515552 AGTTGGCATTAGTCAGGACAGGG - Intergenic
928485432 2:31726464-31726486 AATTGGCCTGAGACAGGGCTCGG + Intergenic
928550505 2:32366070-32366092 AGATGGGGTCAGGCTGGACTTGG + Intronic
929533952 2:42768877-42768899 AGTTGGCCAGAGGCGGGGCTTGG - Intronic
931247016 2:60500082-60500104 AGGCAGCCTCAGGCAGGCCTGGG - Intronic
933759649 2:85664880-85664902 AGTTGGACTCAGGCAAGGATGGG + Intronic
934654474 2:96110073-96110095 GGCTGTCCTTAGGCAGGACTCGG - Intergenic
935024193 2:99260756-99260778 AATTGGCCTGAGGCAGGAATGGG + Intronic
935063814 2:99631073-99631095 AGTGGGGCTCAGGCAGGGCCTGG + Intronic
937669349 2:124521906-124521928 AGTTGTCCTCAGACAAGACCAGG - Intronic
939579551 2:143931639-143931661 AGTTGGCCACAAGCTGGATTTGG - Intergenic
939998205 2:148940169-148940191 AGTTGGCTGCAGGAAGGACTGGG + Intronic
940988844 2:160077301-160077323 AGTTGGTCTGGGGTAGGACTAGG + Intergenic
941953299 2:171178299-171178321 ACTTGGCCTCAAGCAGACCTGGG - Intronic
942278306 2:174338088-174338110 AGTAGATATCAGGCAGGACTTGG - Exonic
946161881 2:217840520-217840542 AGGTGGTCTCAGGCAGGGCCAGG + Intronic
946317428 2:218926338-218926360 ACTGGGCCTGAGGGAGGACTAGG + Intergenic
948433295 2:237934447-237934469 AGTGGGCCACAGGGAGGGCTGGG - Intergenic
1168846094 20:945584-945606 AGTTGCTCTCAGTCAGGCCTTGG + Intergenic
1169187945 20:3634678-3634700 CTCTGGCCTCAGTCAGGACTTGG - Intronic
1170236142 20:14106607-14106629 AGTGGGCCTTGGGCAGGACCTGG + Intronic
1170462250 20:16588228-16588250 AGTGGGCCTCAGGACGGACATGG + Intergenic
1170562820 20:17570941-17570963 AGTTGGACTCTGCCAGAACTTGG + Intronic
1170605091 20:17869832-17869854 GTGTGGCCACAGGCAGGACTGGG - Intergenic
1170892797 20:20390492-20390514 CGCTGGCCTCAGGCAGGGCCAGG - Intronic
1172632028 20:36385085-36385107 AGTAGGACTCAGGCTGGATTTGG + Intronic
1172695225 20:36817744-36817766 AGTTGGCCTCGGCGAAGACTTGG + Intronic
1174657424 20:52183225-52183247 AGTTGGCATCAGCCAGGCCAAGG + Intronic
1174909244 20:54588597-54588619 GGTTTGTCTCAGGCAGGGCTGGG + Exonic
1175138171 20:56840490-56840512 AGTTGGAATAAGGCAGGCCTGGG + Intergenic
1176112521 20:63417095-63417117 TGTTGGCCTCAGGCAGTGCAGGG - Intronic
1176271471 20:64237235-64237257 TTTGGGCCTCAGGCAGGCCTGGG - Intronic
1176279040 20:64290328-64290350 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1176625823 21:9091295-9091317 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1177258560 21:18698004-18698026 AGGTGGCCTAAGCCAGGAGTTGG + Intergenic
1177377878 21:20297570-20297592 AGTTGGCCTGAGGGAGGAAGAGG - Intergenic
1177547495 21:22578319-22578341 AATTGGTCACAGGCAGCACTTGG + Intergenic
1181672890 22:24433977-24433999 AGTTGGCCTCAGGCAGCCTAGGG - Intronic
1182121157 22:27787786-27787808 AATTGGCCACAGGCACGTCTGGG + Intronic
1182723668 22:32425535-32425557 AGATAGCCTCAGCCAGGACAAGG - Intronic
1182930855 22:34173143-34173165 AATTGGCCTTAGACAGGATTTGG - Intergenic
1183602516 22:38848184-38848206 AGTTGGCCTCAGGCTGCAAGAGG + Intergenic
1184083910 22:42246627-42246649 TCTTGCCCTCAGGGAGGACTGGG + Intronic
1184549717 22:45198018-45198040 GTTTGGCCTCAGCCTGGACTGGG - Intronic
1184818172 22:46888156-46888178 AGGTGGCCCAAGGCAGGAATAGG - Intronic
1185054001 22:48568649-48568671 AGTGGGCGTCAGTGAGGACTCGG + Intronic
949950173 3:9222383-9222405 AGTTGGCCCCAGGCTGGCCTGGG - Intronic
950423036 3:12909852-12909874 AGGTGGCACCAGGCAGGTCTGGG - Intronic
950726236 3:14918806-14918828 AGACAGCATCAGGCAGGACTCGG - Exonic
952314606 3:32221743-32221765 AGCTGGACTTAAGCAGGACTTGG + Intergenic
954107026 3:48414960-48414982 AGGGGTCCTCAGGCAGGCCTGGG + Exonic
954438987 3:50511321-50511343 AGTTGGGCCCAGGCAGGGCTGGG + Intergenic
956105646 3:65815247-65815269 TGTTGGCCCCAGGCTGGATTAGG - Intronic
956170959 3:66432922-66432944 TGTGGGCCCCTGGCAGGACTGGG - Intronic
961763315 3:129188064-129188086 AGTAGGCCTCAGTAAGTACTGGG - Intergenic
962973356 3:140425200-140425222 AGCTGGCCACAGTAAGGACTGGG - Intronic
967214497 3:187198995-187199017 AGCTGGCCCCAGTCAGGCCTGGG + Intronic
968355892 3:198106417-198106439 TTCGGGCCTCAGGCAGGACTGGG + Intergenic
968371214 3:198223638-198223660 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
969315465 4:6379008-6379030 CCTTGGCGTCAGGCAGGCCTCGG - Intronic
971554910 4:28001884-28001906 GGTTGGCCTCAGCCAGGAGGTGG + Intergenic
971641732 4:29142765-29142787 AGTTGGCCTCAGGCACATCCAGG + Intergenic
974082756 4:57229828-57229850 GGATGGCCTCAGACAGGACCTGG + Intergenic
975083969 4:70314831-70314853 AGATGGTCACAGTCAGGACTAGG - Intergenic
975718609 4:77228993-77229015 AGATGGGCCCAGGCAGGACATGG - Intronic
975762917 4:77635686-77635708 AGAAGGCCTTTGGCAGGACTGGG - Intergenic
976034525 4:80798277-80798299 TTTTGGCCTCAGGCAGTACAGGG + Intronic
977583344 4:98748100-98748122 AGTGGGCCTCAGCCAGCACTTGG + Intergenic
979259899 4:118636111-118636133 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
979328485 4:119404514-119404536 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
979782018 4:124663845-124663867 AGGTGGACTCAGGTAGTACTTGG + Intergenic
987118537 5:14745413-14745435 GGTTGGCCACAGGCAAGACCTGG - Intronic
989153165 5:38319828-38319850 AGTGGGGCTCAGGCAGGAGCAGG + Intronic
989542589 5:42634827-42634849 GGTGGGCCGCAGGCAGGAGTAGG - Intronic
990497664 5:56364887-56364909 AGTTGCCTTAAGGCAGGAATGGG - Intergenic
993202312 5:84831326-84831348 TTTGGGCCTCAGGCAGGACTGGG - Intergenic
994123681 5:96146439-96146461 AGCAGGCCTCAGGCAGGGCCTGG + Intergenic
1001379659 5:171295829-171295851 AGCTGTCTTCAGGCGGGACTTGG + Intronic
1002428914 5:179191843-179191865 AATGGGCCTCAGGCAGCACATGG + Intronic
1002575271 5:180170701-180170723 TGGTGGCCCCATGCAGGACTGGG - Intronic
1002730453 5:181329184-181329206 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1002754080 6:144920-144942 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1002931574 6:1638551-1638573 AGACTTCCTCAGGCAGGACTGGG + Intronic
1004014469 6:11719473-11719495 AATTGGTCTAAGGCAGGCCTGGG + Intronic
1004850425 6:19693017-19693039 ACTTGGCCTCAGGCAGACCTGGG + Intergenic
1005428099 6:25725250-25725272 TGTTAGACTCAGGCAGGAATGGG - Intergenic
1006187835 6:32190672-32190694 AGCTGGCCTCTGGCCAGACTGGG + Intergenic
1006378077 6:33682894-33682916 AGATGGGCTCAGGCAGGAGCAGG + Intronic
1007168953 6:39848767-39848789 TGTGAGCCTCAGGCAGGGCTGGG - Intronic
1007284959 6:40741030-40741052 ATGTGGCCTCAAGCAGTACTTGG + Intergenic
1007909824 6:45502561-45502583 AGATGGCCTCAGGCTGGATCAGG - Intronic
1009042502 6:58196115-58196137 AGCGGGCCTCCGGCTGGACTTGG + Intergenic
1014273501 6:119361089-119361111 AGTTAGCCTCAGCCAGGAGAAGG - Intergenic
1014305454 6:119735723-119735745 AGTTCGCCTTAGGCAGCTCTTGG - Intergenic
1018961905 6:168455209-168455231 AGTTGGCCCCAGAGAGGACCAGG + Intronic
1019023310 6:168937332-168937354 AGCTGGCCTCCGGCAGGGCCAGG + Intergenic
1019210541 6:170401260-170401282 AGCTGCCATCAGGCAGGACGAGG - Intronic
1019518448 7:1449920-1449942 AGTCTGCCTCAGGCAGAACAAGG - Intronic
1019530690 7:1501783-1501805 AGTTGGCATCAGGGAGCCCTGGG - Intronic
1019827326 7:3295104-3295126 AGTTGGCCTCTGATAGGATTGGG + Intergenic
1023401618 7:39795735-39795757 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1023736552 7:43240824-43240846 AAGTGGCCTCAGGCAGGGCTGGG + Intronic
1023834682 7:44061173-44061195 GCTTGGCCACAGGCAGGGCTTGG - Exonic
1024018937 7:45347880-45347902 CCTTGGCCTGAGACAGGACTGGG - Intergenic
1024134478 7:46392530-46392552 AGTTGGCCATAGGAAGGAATTGG - Intergenic
1024613660 7:51088824-51088846 AGTTTCCCTCAGGCAGGAGCTGG - Intronic
1024648000 7:51384940-51384962 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic
1025095405 7:56092170-56092192 AGTTGGCCCCAGTCAGAGCTGGG - Intronic
1026100204 7:67378248-67378270 AGCTGGCCTCAGGGAGGAGAAGG + Intergenic
1026502228 7:70952546-70952568 TGCTGGCCTCAGGCAGGAAAGGG + Intergenic
1026929640 7:74216719-74216741 AGCAGGACTCAGACAGGACTTGG - Intronic
1026980401 7:74523427-74523449 ACTCGACCTCAGGCCGGACTTGG + Intronic
1027452630 7:78350565-78350587 ATGTGGCCTCAGGGAGGATTAGG + Intronic
1030348131 7:108455937-108455959 AGTTGGCCACAGGCTGGAGGGGG + Intronic
1030732129 7:113002782-113002804 AGCTGGCTTCTGGTAGGACTAGG - Intergenic
1032052123 7:128656104-128656126 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1032116488 7:129122031-129122053 GGTGGGCCTAAGGCAGGCCTTGG + Intergenic
1032461351 7:132113876-132113898 ACTTGGTTTCAGGCATGACTTGG + Intergenic
1033015910 7:137671344-137671366 AGTTGTCCGCAGTCATGACTTGG + Intronic
1036433849 8:8714795-8714817 ACCTGGCCTGTGGCAGGACTGGG + Intergenic
1037806310 8:22059573-22059595 CTTTGGCCTCAGGCAGGCCGGGG + Intronic
1041200643 8:55450155-55450177 AGATGGCGTCAGGCTGGGCTCGG + Intronic
1042562084 8:70079852-70079874 AGATGGCCTTGGGCGGGACTGGG + Intergenic
1043136250 8:76529705-76529727 AGTTGCACCCAGGCAGGACTAGG - Intergenic
1043527850 8:81115613-81115635 TGTTGGGCTAAGGCAGGAATGGG + Intergenic
1043640665 8:82446304-82446326 AGTAGGCCTCAAGTAGGCCTTGG + Intergenic
1048431883 8:134378207-134378229 AGTTGGTCTCAGCCAGCACCAGG + Intergenic
1048931271 8:139317194-139317216 AGTTGGCTTCGGGCAGCATTTGG - Intergenic
1049407620 8:142458661-142458683 AGGTGGCCTCAGGGAGGGCGGGG - Intronic
1057445620 9:95112462-95112484 ACTTGTTCTCAGGGAGGACTGGG - Intronic
1057870502 9:98713419-98713441 ATTTGGGGTCAGGCAGGACTGGG - Intergenic
1058841993 9:108918829-108918851 AGTGAGCCTGTGGCAGGACTGGG - Exonic
1059204911 9:112455483-112455505 AGTTTGATTCAGCCAGGACTAGG - Intronic
1061445329 9:130634200-130634222 AGCTGGCCTGAGGCTGGACAGGG + Intronic
1061902272 9:133679004-133679026 AAGTGACCTCAGGCAGAACTGGG - Intronic
1062349136 9:136130660-136130682 GGGTGGCCTCAGCCATGACTGGG - Intergenic
1062398087 9:136360579-136360601 AGGGGGCCTCAGGCAGGAGCTGG + Intronic
1062754863 9:138281694-138281716 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1203748996 Un_GL000218v1:61716-61738 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1203578771 Un_KI270745v1:25863-25885 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1186313576 X:8345607-8345629 AGTTGGCTCCGGCCAGGACTGGG - Intergenic
1187715156 X:22095417-22095439 AGCTGGGCTGAGGCAAGACTGGG + Intronic
1189240830 X:39523119-39523141 AGGTGGCAGCAGGCAGGGCTGGG - Intergenic
1192152530 X:68721058-68721080 AGATGGGCTCAGGCAGGTCCCGG - Exonic
1197632599 X:128878791-128878813 ACTTGGCCTTTGGCAGGAATTGG - Intergenic
1198226662 X:134651807-134651829 TGAGGGTCTCAGGCAGGACTTGG - Intronic
1198302219 X:135343954-135343976 TGTTGGACCCACGCAGGACTAGG + Exonic
1198311083 X:135426166-135426188 AGGTGGCCTCAGGCAGGGAGAGG - Intergenic
1199851419 X:151726975-151726997 TGTTGGCCTCAGGCAGGGTGGGG + Intergenic
1202381391 Y:24278481-24278503 AGGTGGGGTCAGGCAGGGCTGGG + Intergenic
1202489394 Y:25391645-25391667 AGGTGGGGTCAGGCAGGGCTGGG - Intergenic