ID: 1079315036

View in Genome Browser
Species Human (GRCh38)
Location 11:19400315-19400337
Sequence CAGGTAGAACCTCTGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079315028_1079315036 -4 Left 1079315028 11:19400296-19400318 CCATCTCCCTGCTATGTTCCAGG 0: 1
1: 1
2: 4
3: 34
4: 324
Right 1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 138
1079315030_1079315036 -10 Left 1079315030 11:19400302-19400324 CCCTGCTATGTTCCAGGTAGAAC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079315036 Original CRISPR CAGGTAGAACCTCTGGTGGT GGG Intronic
902562757 1:17288078-17288100 CAGACAGAATCTCTGATGGTGGG - Intergenic
903035052 1:20487381-20487403 CTGGTATAACATCTGGTGGAGGG + Intergenic
904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG + Intronic
907777594 1:57533751-57533773 CCTATAGATCCTCTGGTGGTTGG + Intronic
912474880 1:109928943-109928965 CAGGCAGGAGCTCTGGTGGAGGG - Exonic
916648417 1:166812269-166812291 AAGGGAGAACATGTGGTGGTTGG - Intergenic
917154547 1:171982870-171982892 TAGGTAGAACTGATGGTGGTGGG - Intronic
917792749 1:178509822-178509844 CAGGGAGAGCCTCTGCTGGCTGG + Intergenic
918177968 1:182061708-182061730 CAGAGAGAGCCTCTGGAGGTGGG + Exonic
919540731 1:198842288-198842310 CAGGTTGGAATTCTGGTGGTAGG - Intergenic
922254063 1:223876288-223876310 CAGGTAGAATCTCTGGGTGTAGG + Intergenic
923973043 1:239226769-239226791 CAGCCACAACCTCTGCTGGTAGG + Intergenic
924730055 1:246702844-246702866 CAGGGAAATCCTCTGGTGCTGGG + Intergenic
1064219857 10:13431343-13431365 CCGGGTGAACCTCTGGAGGTGGG - Intergenic
1067703557 10:48590483-48590505 CAGGTAGGGCCTCAGCTGGTGGG - Intronic
1070889053 10:79928533-79928555 CAGGTAGGGACTCGGGTGGTGGG - Intergenic
1072291042 10:93964987-93965009 GAGTTAGAAACTCTGGAGGTTGG - Intergenic
1073583627 10:104688723-104688745 CAGGAAGTACCTCTGTGGGTGGG + Intronic
1074478084 10:113791025-113791047 CAAGTGGAACCCCTGGTTGTTGG - Intergenic
1074884312 10:117682933-117682955 CTGAAAGAACCTCTGGGGGTGGG - Intergenic
1075220919 10:120583872-120583894 CAGGAAACACCACTGGTGGTAGG + Intronic
1075840812 10:125501314-125501336 CATGGAGAATCTCTTGTGGTTGG - Intergenic
1079081015 11:17413797-17413819 CAGGGAAAACCACTGCTGGTTGG + Intronic
1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG + Intronic
1080156376 11:29116418-29116440 GAGTTAGAAACTCTGGGGGTTGG + Intergenic
1082751858 11:57028119-57028141 CAGGTATAACCTTTCGGGGTTGG - Intergenic
1083635183 11:64117076-64117098 CAGGTAGAGCTTCTGCAGGTGGG - Exonic
1087932163 11:103990537-103990559 CAGGCAGAACCTCTGCTGTCAGG - Intronic
1092085702 12:5757585-5757607 GAAGCAGAACCTGTGGTGGTGGG - Intronic
1092894373 12:12998927-12998949 CAGTTAGATCCTCTGGAGTTGGG - Intronic
1094661789 12:32476463-32476485 CAACTAAAACCTCAGGTGGTAGG - Intronic
1096012621 12:48233665-48233687 CAGGTAGGACATCTGATGTTGGG + Intergenic
1097316746 12:58179974-58179996 CAGGTAGTACTTCAGGAGGTGGG + Intergenic
1097524278 12:60710879-60710901 CAGGTAGAAGCTGTAGAGGTTGG + Intergenic
1101648011 12:106649279-106649301 TAGGCAGAACCTCTGGTTTTGGG + Intronic
1102678755 12:114675940-114675962 CAGTTGGAGCCTCTGTTGGTTGG + Intronic
1104294248 12:127497225-127497247 CAGGAAGAGCCTCAGGTGCTGGG + Intergenic
1104869309 12:131983250-131983272 CAGGGAGCACGTCTGGTGGGTGG - Intronic
1106434721 13:29713252-29713274 CAGGGTTAACCTATGGTGGTGGG - Intergenic
1108179579 13:47827514-47827536 CAGGTGGGACCTCTGGTTGAAGG - Intergenic
1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG + Intergenic
1111167934 13:84487016-84487038 CAGGAAGAACCACTGTTAGTGGG + Intergenic
1112523808 13:100123374-100123396 CAGAAAAAATCTCTGGTGGTTGG + Intronic
1112759774 13:102681047-102681069 CAGGTAGAAATTCTGCTGATTGG - Intergenic
1114783959 14:25572422-25572444 CATTTAGAATCTCTGTTGGTGGG + Intergenic
1115029036 14:28773347-28773369 CAGGCAGAGCCTTAGGTGGTGGG - Exonic
1117408630 14:55429351-55429373 CATGCAGAAACTCTGGGGGTGGG + Intronic
1122561963 14:102622127-102622149 CAGGTAGAAACTCCAGAGGTAGG + Intronic
1122571267 14:102704036-102704058 CAGATAGCACCTCTGGTGCAGGG + Intronic
1124372682 15:29112286-29112308 CAGGGAGAACCGCTGCAGGTCGG - Intronic
1125313292 15:38403522-38403544 GAACTAGAAACTCTGGTGGTGGG + Intergenic
1128635603 15:69300147-69300169 CAGGCAGAACCTAGGGGGGTGGG - Intronic
1128736440 15:70056443-70056465 CAGGTAGGACCCCGGGTGGGTGG - Intronic
1133631806 16:7629134-7629156 CAGGTAGAACCTCTGGCCCTGGG + Intronic
1135742778 16:24990742-24990764 GAATTAGAACCTCTGGAGGTGGG + Intronic
1147334942 17:39721732-39721754 CAGTCAGAATCTCTGGGGGTGGG + Intronic
1151195711 17:72430020-72430042 CAATCAGAACCTCTGGGGGTGGG - Intergenic
1152050002 17:77966248-77966270 CAGGTGGAACCTCTAGTTGTTGG + Intergenic
1153452612 18:5246347-5246369 CGGGCAGAACCTGTGGTGTTAGG + Intergenic
1153707812 18:7764617-7764639 GAGTCAGAACCTCTGGGGGTTGG - Intronic
1158145068 18:54303136-54303158 AAGGTAGAAGCTCTCATGGTAGG + Intronic
1158426210 18:57341766-57341788 CAGTTAGGACCTCTGTTAGTTGG + Intergenic
1159436377 18:68423336-68423358 GAGGGAGAACATCTGGTGTTTGG - Intergenic
1159512382 18:69412456-69412478 AAGGTAGAATCTCTGGGAGTCGG - Intronic
1165728743 19:38130685-38130707 CAGGTCGATCATCTGGTCGTGGG - Exonic
1166500613 19:43338278-43338300 CAGGAAGAACCTGTGATGGATGG - Intergenic
1166873854 19:45885733-45885755 CAGGTAGCACCACTGGCGGCGGG + Exonic
1166891741 19:45998300-45998322 CAAGCAGAAACTCTGGGGGTGGG - Intronic
1168723938 19:58570541-58570563 CTGGTAGGACTTCTGATGGTGGG - Intronic
925609915 2:5693794-5693816 CAGGTCGAACATCAGGTCGTCGG - Exonic
926734604 2:16063341-16063363 CATGTAGAACGTCTGCTAGTAGG - Intergenic
927890374 2:26744313-26744335 GAGGTACAACCTCATGTGGTGGG + Intergenic
930719268 2:54623538-54623560 CATGTAGACCTTCTGGTTGTTGG - Exonic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
939932682 2:148254606-148254628 CAGGTACAACGTCTGCTGGTAGG + Intronic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
941478580 2:165977729-165977751 CAGTGAGAACATGTGGTGGTTGG - Intergenic
941494478 2:166182748-166182770 CAGATAGGACCTCTGGTTGCAGG - Intergenic
942916653 2:181316904-181316926 AATTTAGAACCTCTGGTAGTGGG - Intergenic
944004172 2:194882122-194882144 AAGGTAGAACCCCTGGTGTGGGG - Intergenic
945426304 2:209708467-209708489 GAGATAGAACCTATGGTGATGGG + Intronic
945675706 2:212853069-212853091 CAGCTAGAATCTCTGGAGGTGGG - Intergenic
947019139 2:225655058-225655080 CATATACCACCTCTGGTGGTGGG - Intergenic
947038698 2:225889819-225889841 CAGGTGTAACCCCTGGTGTTGGG + Intergenic
949048783 2:241885819-241885841 CAGGTGGGAGCTCGGGTGGTGGG + Intergenic
1168849697 20:968050-968072 CAGGAAGAGCCTCTGCTGGCAGG + Exonic
1168984808 20:2038979-2039001 GAATTAGAATCTCTGGTGGTGGG + Intergenic
1175350751 20:58316203-58316225 CAGGTAGAAACACTGGAGGGAGG + Intronic
1175650186 20:60715187-60715209 CAGTTAAAACCATTGGTGGTCGG - Intergenic
1176385322 21:6136126-6136148 CAGGCAGCATCTCTGGTGGTAGG - Intergenic
1179718833 21:43304061-43304083 CAGGTAGAAACCATGGAGGTAGG - Intergenic
1179738151 21:43402126-43402148 CAGGCAGCATCTCTGGTGGTAGG + Intergenic
1179945258 21:44669782-44669804 GGGGTAGGACCTCTGGGGGTGGG - Intronic
1182012783 22:27014525-27014547 CAGATACAACAGCTGGTGGTTGG - Intergenic
1182125380 22:27811851-27811873 CAGGAAGAACCCCTGCTGGTTGG - Intergenic
1182891290 22:33820860-33820882 CAGGAGGAGCCTCTGGAGGTTGG - Intronic
952154365 3:30626844-30626866 GAGGTAGAAATTTTGGTGGTAGG + Intronic
953536147 3:43778299-43778321 CAGCTAGAGCCTGTGGTGCTTGG + Intergenic
954660493 3:52224417-52224439 CAGGAAGAACTTCTGCAGGTAGG - Intronic
960938950 3:122921232-122921254 CTGGGAGAGCCTCGGGTGGTAGG + Intronic
961669725 3:128520223-128520245 CAGGAAGATCCTCTGGGGATAGG - Intergenic
966937794 3:184725226-184725248 AAATCAGAACCTCTGGTGGTGGG + Intergenic
968858308 4:3146176-3146198 CAGTCAGCACCTCAGGTGGTTGG + Intronic
972820192 4:42692776-42692798 GAGTTAGAAACTCTGGAGGTGGG + Intergenic
978233162 4:106424801-106424823 CTGGTTGAACCTCTGATGGCTGG - Intergenic
978476370 4:109136044-109136066 CAGGCAGAAGCCCTGGTGGTAGG + Intronic
984832991 4:183993062-183993084 CAGGAATCACCTCTGGCGGTGGG + Intronic
987456037 5:18147902-18147924 CAGGTAGGACCTATGGCGGCTGG + Intergenic
988992485 5:36684838-36684860 GAGGTAGAAACTAGGGTGGTTGG - Intronic
989773389 5:45171911-45171933 AAGATAGAACCTCTGGAGTTGGG - Intergenic
990044845 5:51416164-51416186 AAGTTAGAATCTCTGGAGGTGGG + Intergenic
990460767 5:56028981-56029003 CAGGTAGATGCTCTGGAAGTTGG + Intergenic
994521415 5:100841833-100841855 CATGTAATACCTCTGGTGGATGG - Intronic
995999255 5:118339231-118339253 GAGTAAGAACCTCTGGTAGTAGG + Intergenic
999629033 5:153550823-153550845 GAATTAGAACCTCTGGGGGTGGG - Intronic
1001708310 5:173758112-173758134 CAGGTGGAAGATCTGGGGGTAGG + Intergenic
1003672946 6:8176705-8176727 CAGATAGAATCCCTGGAGGTGGG - Intergenic
1005176630 6:23053978-23054000 CAGGGAGGGCCTCTGGGGGTGGG - Intergenic
1005367571 6:25094648-25094670 CAGGTAGAACCACTGGAGTAAGG - Intergenic
1007997320 6:46322010-46322032 CAGGTAAAAGTTCTGGGGGTGGG + Intronic
1016019520 6:139221025-139221047 CAGGTAGAATGTCTGTTGGAAGG + Intergenic
1017144754 6:151224585-151224607 CAGGTAGCATCTCTGCAGGTAGG - Intergenic
1021631483 7:22651769-22651791 AAGTCAGAACCTCTGGGGGTGGG + Intergenic
1023830287 7:44035158-44035180 CAGGGAGGACCTCTGATGGGTGG - Intergenic
1029740605 7:102489445-102489467 CAGGGAGGACCTCTGATGGGTGG - Intronic
1029758602 7:102588617-102588639 CAGGGAGGACCTCTGATGGGTGG - Intronic
1029776540 7:102687696-102687718 CAGGGAGGACCTCTGATGGGTGG - Intergenic
1030165262 7:106548229-106548251 CAGTCAGCACCTCGGGTGGTTGG + Intergenic
1031151271 7:118056864-118056886 AAGTTAGAATCTCTGGGGGTAGG + Intergenic
1032268269 7:130383256-130383278 CAGGTAGAGGCTCTGCTTGTGGG - Intronic
1034757935 7:153640512-153640534 CAGGTGGAAGCTCTGGCTGTGGG + Intergenic
1035049566 7:155990656-155990678 CAGGTGGAAGCTCTGGAGCTGGG + Intergenic
1035371813 7:158384404-158384426 CGGGAAAAACCTCTGGAGGTTGG - Intronic
1036510155 8:9392535-9392557 CAGGCAGAAGCTCTGGGGGTGGG + Intergenic
1037665070 8:20962088-20962110 CAGTGAGAACATGTGGTGGTTGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041566748 8:59287026-59287048 CAGAAAGAATCTCTAGTGGTAGG - Intergenic
1044289119 8:90446971-90446993 AAGGCAGAACCTCTGGGGATTGG - Intergenic
1045477799 8:102568192-102568214 GAGGTAGAACCCCATGTGGTTGG + Intergenic
1052649780 9:31287548-31287570 GAGGGAGAACCTGTGGTGTTTGG - Intergenic
1056763278 9:89429208-89429230 CTGGTACAACTCCTGGTGGTGGG - Intronic
1058842626 9:108924845-108924867 CAGCCAGAACCTCAGGTGTTGGG - Intronic
1060067540 9:120516274-120516296 CAGTGAGAACATCTGGTGTTTGG - Intronic
1186683348 X:11898742-11898764 TAGGTGGAAGCTCTGGAGGTAGG + Intergenic
1187313979 X:18174712-18174734 CAGCCAGAATCTCTGGTGATGGG + Intronic
1193008151 X:76644060-76644082 CATGGAGAACCTCTGCTGGCAGG + Intergenic
1196889578 X:120279038-120279060 CTGGTAGAATCTCTGGTGATGGG + Intronic
1196969427 X:121092532-121092554 GAGTTGGAATCTCTGGTGGTAGG + Intergenic
1199530597 X:148843393-148843415 TTTGTAGAAGCTCTGGTGGTTGG - Exonic
1200059920 X:153479639-153479661 CAGGAAGAATCTCAGGTGGCTGG + Intronic
1200236635 X:154470853-154470875 CAGGTAGAGATGCTGGTGGTCGG + Intronic