ID: 1079315965

View in Genome Browser
Species Human (GRCh38)
Location 11:19408073-19408095
Sequence GCTTCATTACAGTGGCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079315965_1079315969 -4 Left 1079315965 11:19408073-19408095 CCCCAATGCCACTGTAATGAAGC 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1079315969 11:19408092-19408114 AAGCGAGCTTTAACTAACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 36
1079315965_1079315970 10 Left 1079315965 11:19408073-19408095 CCCCAATGCCACTGTAATGAAGC 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1079315970 11:19408106-19408128 TAACCCTGGTACCCACTGAGCGG 0: 1
1: 0
2: 0
3: 13
4: 84
1079315965_1079315975 25 Left 1079315965 11:19408073-19408095 CCCCAATGCCACTGTAATGAAGC 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1079315975 11:19408121-19408143 CTGAGCGGCCTCATCACAAATGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079315965 Original CRISPR GCTTCATTACAGTGGCATTG GGG (reversed) Intronic
906060102 1:42942877-42942899 GCTGCATTTCCGTGGCATTCTGG - Intronic
910855301 1:91688962-91688984 CCTTCTTTACAGTCACATTGGGG - Intronic
915087740 1:153399515-153399537 GCTTCATGACAGTGGAGTTTGGG - Intergenic
915175617 1:154012283-154012305 GCTTGAATACAGTTGAATTGAGG + Exonic
916427323 1:164693125-164693147 GCTGTGTTACAGTGGCAGTGGGG - Intronic
917556186 1:176091296-176091318 GCTTGAGTACAGTGGCACAGTGG - Intronic
919018901 1:192077733-192077755 GCTTCATTACATTGGCATGATGG + Intergenic
919658371 1:200219240-200219262 GCTGCAGTACAGTGGAATGGGGG - Intergenic
921250908 1:213297164-213297186 GGTTCATTACTGTGGCATTCTGG - Intergenic
921888115 1:220326685-220326707 GATTCATTAGAATGACATTGCGG + Intergenic
922082024 1:222306591-222306613 GCTGCATTGGAGTGGCATTCAGG + Intergenic
922344356 1:224684047-224684069 GCTTCATTACTGAGGCAATTTGG - Intronic
922449014 1:225721670-225721692 GCTGCACTACAGTGCCATTCAGG + Intergenic
1064350636 10:14573228-14573250 GCCTCATCACTGTTGCATTGAGG - Intronic
1064841302 10:19595421-19595443 TCTTCATTAAAGTGGCAGTCGGG - Exonic
1070469372 10:76763624-76763646 GCTTTATTCCAGTGGCTTTTTGG + Intergenic
1070891194 10:79943136-79943158 CCATCAATACAGTGGCCTTGGGG - Intronic
1071446116 10:85749176-85749198 GCTTCATTCCAGTGAGTTTGGGG + Intronic
1071870804 10:89792281-89792303 GCATCATTACTGTGGCACTTTGG + Intergenic
1072450811 10:95538167-95538189 GCTTCATGAAAGAGGCCTTGGGG + Intronic
1074403301 10:113160173-113160195 GCTGTTTTACAGTGGCATTTTGG - Intronic
1074572453 10:114636318-114636340 CATTCTTTAGAGTGGCATTGAGG - Intronic
1075551483 10:123395828-123395850 GCACCATTAGAGTGGCATTCAGG + Intergenic
1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG + Intronic
1079315965 11:19408073-19408095 GCTTCATTACAGTGGCATTGGGG - Intronic
1079732853 11:23957511-23957533 GCTTCATAACAGTTACTTTGAGG - Intergenic
1092537182 12:9401060-9401082 GCTGCAGTACAGTGGCACAGTGG - Intergenic
1092557493 12:9572252-9572274 GCTGCAGTACAGTGGCACAGTGG + Intergenic
1094513787 12:31115661-31115683 GCTGCAGTACAGTGGCACAGTGG - Intergenic
1096523739 12:52198596-52198618 GGTTCATGCCAGTGGCATTTTGG + Intergenic
1098809758 12:75071615-75071637 TCTTCATGATAGTGGCCTTGTGG - Intronic
1100037568 12:90271730-90271752 GCATCATTTCAGTGTAATTGAGG + Intergenic
1101599418 12:106196038-106196060 ACTTCATTTCAGGGACATTGGGG + Intergenic
1107146071 13:37061605-37061627 TCTCCAATACAGTGACATTGGGG + Intergenic
1107277565 13:38693555-38693577 CTTTCATTACAGTGGGATTTGGG + Intronic
1109151258 13:58850343-58850365 TCTTTATTACAGTGACCTTGAGG + Intergenic
1113354280 13:109563419-109563441 GCTTCACTACAGTAGCAGAGAGG - Intergenic
1115563424 14:34603236-34603258 GCTGGAGTACAGTGGCATAGTGG - Intronic
1115971216 14:38946819-38946841 TCTTCATCACTCTGGCATTGAGG - Intergenic
1119858318 14:77917728-77917750 GCTACAGTACAGTGCCATTTAGG - Intronic
1120749041 14:88180697-88180719 ACATCAGTGCAGTGGCATTGAGG - Intronic
1121296687 14:92832040-92832062 GCTGACTTACAGTGTCATTGAGG + Intronic
1124613661 15:31225900-31225922 GGTTCCTTCCAGTGGGATTGTGG + Intergenic
1124655942 15:31507457-31507479 GGTTCCTTCCAGTGGCTTTGTGG + Intronic
1126137746 15:45408837-45408859 GCTGGAGTGCAGTGGCATTGAGG - Intronic
1127855176 15:62948219-62948241 ACTATATTACAGTGGCAGTGAGG - Intergenic
1131859203 15:96634282-96634304 GCTCCACGACAGTGGCAGTGAGG - Intergenic
1134399148 16:13892909-13892931 GCTTCATTACAAAGCCTTTGAGG + Intergenic
1134412558 16:14015173-14015195 GTTTCATTTCACTTGCATTGTGG - Intergenic
1135207166 16:20493155-20493177 TCTTCATTATTGTGGCATTTAGG - Intergenic
1135209389 16:20511334-20511356 GCTTGAGTTCAGTGGCACTGTGG + Intergenic
1135211719 16:20530477-20530499 TCTTCATTATTGTGGCATTTAGG + Intergenic
1135493884 16:22934514-22934536 GTATCATTGCAGTGGCATTTGGG - Intergenic
1135568202 16:23528335-23528357 GCTTCCCTGCAGTGCCATTGGGG - Intronic
1135693376 16:24564367-24564389 GCTGCATGACAGTGGTCTTGTGG + Intronic
1140050034 16:71472437-71472459 GCTTCCTGACAGTGGCACTGGGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1144732007 17:17533088-17533110 TCTTGATTACTGTTGCATTGTGG - Intronic
1158635473 18:59152524-59152546 GCTTCTTTCCAGTGGCAGTATGG + Exonic
1160655783 19:268410-268432 TCTTCATTACTGTGGCTTTAGGG - Intergenic
1164439256 19:28259647-28259669 GCATCATTACATTGCGATTGCGG - Intergenic
1164761191 19:30729634-30729656 GCTTCATCACAGCAGCACTGCGG - Intergenic
1166632396 19:44418576-44418598 GCTTCATTACATAGGCATGATGG + Intronic
925481828 2:4283953-4283975 GCTTCCTCACTCTGGCATTGTGG + Intergenic
929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG + Intronic
931052792 2:58432603-58432625 GCTTAATTAAGGTGGCTTTGTGG + Intergenic
933498538 2:83082746-83082768 GCTTCATTTCAGTTGGATGGTGG - Intergenic
936475431 2:112835607-112835629 TTTTTATTACAGTGGCAATGAGG - Exonic
937212235 2:120282060-120282082 GTTTCTCAACAGTGGCATTGTGG - Intronic
943630859 2:190250562-190250584 CCTTGATTACAGTGGAATTTAGG - Intronic
944706987 2:202300099-202300121 GTTTCATTTTAGTGGCTTTGGGG - Intronic
945414897 2:209558949-209558971 TCTTCATTACAGAGGCAGAGAGG - Intronic
1169512912 20:6284312-6284334 GCTCCATTACATAGGCATGGTGG + Intergenic
1170487759 20:16837039-16837061 GCTTCCTTACGGCTGCATTGAGG + Intergenic
1170803470 20:19610066-19610088 GCTTTATTTCACTGGAATTGGGG - Intronic
1171004648 20:21452596-21452618 GCTGCATTACAGTGTCTTTGAGG + Intergenic
1171033424 20:21696933-21696955 CCTTCATTACAGAGGGAGTGGGG - Intergenic
1174708978 20:52685218-52685240 GCTTCATTTCAGTCACAGTGAGG + Intergenic
1178478579 21:32958993-32959015 GCTCCTTTCCTGTGGCATTGTGG + Intergenic
1178858063 21:36266650-36266672 GCTTCATTACATAGGCATGATGG + Intronic
1179002781 21:37479189-37479211 ACTACATTACAGTGGCAGTGTGG + Intronic
1179712372 21:43270728-43270750 GCTGCCTTAGGGTGGCATTGGGG + Intergenic
1180876339 22:19176906-19176928 GCTTCAGGACAGTGGCTGTGAGG + Exonic
1181375298 22:22453352-22453374 GCTTCATTGCAGTGGCCTCAGGG + Intergenic
1184094001 22:42306663-42306685 GCTCCATCCCAGTGGCATGGGGG - Intronic
1184256808 22:43291609-43291631 GCTGCGCTACAGTGGCATGGTGG + Intronic
949285490 3:2398509-2398531 GATTCATTATATTGCCATTGAGG + Intronic
951032670 3:17900111-17900133 GCTTCAAAACAGTTGCATTTTGG + Intronic
956108503 3:65846813-65846835 GCTTCCTCACAGAGGCAATGTGG - Intronic
959405237 3:105953462-105953484 GCTTCTTTACAGTTCCATTGTGG + Intergenic
959405497 3:105957965-105957987 GCATCATTACAATGGCCTAGAGG + Intergenic
962469592 3:135694181-135694203 CCTTCATTACTGTGTCATTTGGG - Intergenic
966443234 3:179970695-179970717 GCATCATAACAGTTGCATTCAGG - Intronic
967774115 3:193368539-193368561 TCTTAATTACTGTGGCTTTGTGG - Intronic
968022855 3:195410028-195410050 GTTTGATTACTGTGGCTTTGTGG - Intronic
972630396 4:40836984-40837006 GCATCATGACACTGGGATTGGGG - Intronic
974409070 4:61515492-61515514 GATTCATTAAAGTAGCTTTGTGG + Intronic
975446519 4:74471827-74471849 GATTCATTACATCTGCATTGGGG - Intergenic
975507904 4:75159783-75159805 GGTTCATTACAGTGTCATGTAGG - Intergenic
978160228 4:105538083-105538105 GTTGCATTACAGTGGAATAGAGG + Intergenic
980384186 4:132064288-132064310 GATTCATTTCAGTGGCCTAGGGG + Intergenic
985150880 4:186945935-186945957 GATTCATTTCAGAGACATTGAGG + Intergenic
986175334 5:5347717-5347739 GCTTCATTAGAGAGGCACTAAGG + Intergenic
987286087 5:16458468-16458490 GCTTAATGCCAGTGGGATTGAGG - Intronic
987978367 5:25045435-25045457 GCTTTATTGCAGTGGTATGGAGG + Intergenic
989790097 5:45388547-45388569 GCTTCATTAAATTTGCAGTGGGG - Intronic
990448580 5:55915409-55915431 GCTTTATTTAACTGGCATTGGGG + Intronic
990707380 5:58544408-58544430 GTTTCATTACAGAGGAAGTGAGG + Intronic
995588839 5:113677111-113677133 GCTTCATTTCATAGGCAATGGGG + Intergenic
995931617 5:117453200-117453222 GATTCATTGCAGTATCATTGTGG + Intergenic
995945438 5:117639406-117639428 GCTTCTTGACAGTGCCATTTTGG - Intergenic
996481469 5:123980336-123980358 GCTTCCTGACAGTAGCATTTGGG - Intergenic
999714433 5:154348544-154348566 TCATCAATTCAGTGGCATTGTGG + Intronic
1000038992 5:157471125-157471147 GGTTTATTTCAGTGGCAATGTGG + Intronic
1002819327 6:710322-710344 GCTTCATCACTGTAGCACTGGGG - Intergenic
1002850614 6:993250-993272 GCTTCACCTCAGTGGCACTGGGG + Intergenic
1008555137 6:52666436-52666458 TCTTCATGACAGTGGCTTTTTGG - Intergenic
1010300814 6:74256497-74256519 ACTTCATCACAGTGGCTTTCAGG - Intergenic
1010685095 6:78845147-78845169 GCTTCATGGTGGTGGCATTGTGG - Intergenic
1011920428 6:92568801-92568823 TTTTCATTATAGTGGCAGTGTGG - Intergenic
1017568099 6:155710161-155710183 GCTTCAATACAGGAGCATTGGGG + Intergenic
1019306373 7:337225-337247 GCTTCATGTCTGTGGCATTTAGG - Intergenic
1019498570 7:1352809-1352831 GCTTCCTGGCAGAGGCATTGGGG - Intergenic
1020101331 7:5395690-5395712 GCCTCATTATATTGTCATTGTGG - Intronic
1022087117 7:27079175-27079197 GCTGGAGTACAGTGGCATTTGGG - Intergenic
1026118708 7:67518140-67518162 GCTTCATTACATTGACAACGTGG - Intergenic
1028190233 7:87840496-87840518 GATTAATGACTGTGGCATTGAGG - Intronic
1028400607 7:90421398-90421420 GCTTAAGTCCATTGGCATTGTGG - Intronic
1028628369 7:92904295-92904317 GCTTCTTTTCAATGGCATTTAGG - Intergenic
1033530583 7:142258898-142258920 TCTTCAATACAGTTGCATTGAGG + Intergenic
1033590184 7:142802319-142802341 GCTTCATTATGGTTTCATTGAGG - Intergenic
1034785387 7:153921581-153921603 CCCTCTTTACAGTGGCACTGTGG - Intronic
1040510372 8:48088030-48088052 GCTTCATTACATAGGCATGATGG - Intergenic
1045092866 8:98764942-98764964 GCTTGATTACATTTGCATTTTGG + Intronic
1046100799 8:109611838-109611860 ACTTCATTGCAGTTACATTGAGG + Intronic
1049976793 9:867699-867721 GCTCCATTACTCTGTCATTGTGG + Intronic
1050275298 9:3991304-3991326 TCTTCATTAAAGAGGCTTTGAGG - Intronic
1051143667 9:14004773-14004795 GCTGCATTACAGTCCCATTCAGG - Intergenic
1052723330 9:32199465-32199487 TCTTCACAACAGTGTCATTGAGG + Intergenic
1055619935 9:78114428-78114450 GCTTAAGTAAACTGGCATTGTGG - Intergenic
1055719212 9:79153047-79153069 GCTTCATGAAAGTGGCAGTATGG - Intergenic
1056169003 9:83964624-83964646 GCTGCAGTACAGTGGCATCTCGG - Intergenic
1056178470 9:84058894-84058916 GACTAATTACAGTGGCAGTGTGG - Intergenic
1058523733 9:105837076-105837098 GCTTCATTACAGGAGCTCTGAGG - Intergenic
1058955964 9:109949047-109949069 ATTTCATTACAGGAGCATTGAGG + Intronic
1061862899 9:133476985-133477007 GCACCAATACAGAGGCATTGGGG + Intronic
1190508479 X:51153294-51153316 GCTTCCTTACTGTGGCATTTTGG + Intergenic
1191949747 X:66575741-66575763 GCTTCTTCATAGTGTCATTGGGG - Intergenic
1192345977 X:70306241-70306263 TCTTCATTACTGTAGCTTTGTGG + Intronic
1195145040 X:102005199-102005221 TCTTCATTACTGTAGCCTTGTGG - Intergenic
1202133563 Y:21636538-21636560 GCTTCATTACATAGGCATGATGG - Intergenic