ID: 1079318132

View in Genome Browser
Species Human (GRCh38)
Location 11:19427220-19427242
Sequence CCTCCCCTGCAGAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 2, 2: 7, 3: 33, 4: 387}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079318132 Original CRISPR CCTCCCCTGCAGAAAGAGGA TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900537255 1:3184972-3184994 CCTCCCCTCCCCAAGGAGGAAGG - Intronic
900751204 1:4398949-4398971 CTTTCCCTGCAGAAAGAACATGG + Intergenic
902559305 1:17267075-17267097 GCTCCCCTGGAGGAAGAGAATGG - Intronic
902620595 1:17648537-17648559 CCTCCCCTACAGCAAGAGGAAGG - Exonic
902960748 1:19961504-19961526 CCTCCACTCCAGAAAGAGAGAGG - Intergenic
903686745 1:25137210-25137232 CTTCCTCTGCAGGAAGAGGGTGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904041886 1:27590109-27590131 CCTCCCCTCCAGGAGAAGGAGGG - Intronic
904302743 1:29565813-29565835 CCTCCCCTGATGGGAGAGGAAGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
908403102 1:63789241-63789263 CCTCCCCTGTGGCAAGAAGAAGG - Intronic
911068820 1:93815601-93815623 CCTCCCCAGAAGAATGGGGAGGG + Intronic
911707084 1:101026132-101026154 CCTCCTCTCCAGAAACAGGGAGG + Intergenic
912980586 1:114368174-114368196 CCTCCCCTAGAGGAAGAGGAAGG - Intergenic
915412517 1:155713257-155713279 CCTCCCTTGCAGAAACAGGAGGG - Intronic
915595681 1:156895143-156895165 CCTCCAGTGGAGAGAGAGGAAGG - Intronic
916653672 1:166853541-166853563 CCTGCCCTGCAGGAATAGGTGGG + Exonic
917691538 1:177474966-177474988 CCTCCCCTGGAGCAAGTGGCTGG + Intergenic
920414805 1:205791748-205791770 CTCCCCCTGGAGAGAGAGGATGG - Intronic
922718971 1:227890701-227890723 CCTCCAGGGCAGAAAGAAGAGGG + Intergenic
922765872 1:228156591-228156613 CCTCAGCTGCATAAAGAGGCCGG + Intronic
924711674 1:246534689-246534711 ACTCCCCTGCAGAGATAGAATGG + Intergenic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1063118634 10:3088549-3088571 CCACCCCTGCAAAGAGAGGTGGG - Intronic
1063835844 10:10010673-10010695 CTTCCCCAGTAGAGAGAGGAAGG - Intergenic
1064055238 10:12091637-12091659 CCACTCCAGCTGAAAGAGGAAGG + Exonic
1064278444 10:13929248-13929270 CATTCCATGCAGAAAGAGAATGG - Intronic
1065236861 10:23660757-23660779 TCTCCCCTGCAGATTGAGAATGG + Intergenic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1066004467 10:31133973-31133995 CCTCCCCCGCAGCCTGAGGAGGG + Intergenic
1066271852 10:33831700-33831722 CCTCTCTTGCAGGCAGAGGATGG + Intergenic
1066527447 10:36296734-36296756 CCTCCCCTCAAGTAAAAGGAAGG + Intergenic
1067432548 10:46253507-46253529 CCTCCCCTTCAGCAGCAGGAGGG + Intergenic
1067440711 10:46307940-46307962 CCTCCCCTTCAGCAGCAGGAGGG - Intronic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1069694365 10:70376019-70376041 CATCCCATGAAGAAAGGGGACGG - Intronic
1069919488 10:71807829-71807851 CCACCCCTGCAGGAAGAGGCAGG - Exonic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1072289240 10:93947437-93947459 CCTCCGCTTAAGAAAGAGAATGG - Intronic
1072403078 10:95125402-95125424 ACTCCCCTGCAGAAATGGAATGG - Intergenic
1072617793 10:97060782-97060804 CCTGGCCTGCAGAAACAGGGGGG + Exonic
1073917867 10:108427328-108427350 CCTCCCCGGTCGAAAGAGCAGGG - Intergenic
1074078694 10:110151418-110151440 CCTCAGCTCCAGGAAGAGGAGGG - Intergenic
1075674392 10:124286344-124286366 CCTGCCCTGCAGGAAGGGAACGG + Intergenic
1075715705 10:124554022-124554044 ACTCCACTGCAGATAGAAGAAGG + Intronic
1075744682 10:124718568-124718590 CCTCCCCTGCAGTAGGAGTCAGG - Intronic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1077289795 11:1783717-1783739 CCTGCCCTCCAGGCAGAGGAGGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078265774 11:9755582-9755604 CCACCCCTACATACAGAGGAGGG + Intergenic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078442208 11:11377457-11377479 CTTCCCCAGCAGAAAGAGGAAGG + Intronic
1078762916 11:14265893-14265915 ACTCCTCTGCAGGAAGAGGCTGG - Exonic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079976631 11:27099771-27099793 ACACCCCTGCAGAAAGAGTGAGG - Intronic
1080726509 11:34903761-34903783 ACTCCCCTACAGAAATAGAATGG + Intronic
1081590612 11:44420439-44420461 CCTCCACTGGAGTAAGGGGAAGG - Intergenic
1083104453 11:60344653-60344675 ACTTCCCTGCAGAAATAGAATGG - Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083830030 11:65225642-65225664 TCTCCCTCGCGGAAAGAGGAAGG - Intergenic
1084509968 11:69597301-69597323 CGTCCCCTGGGGACAGAGGATGG - Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1087424040 11:97967321-97967343 ATTCCCGTGCAGAAAGAGAATGG - Intergenic
1087637593 11:100719943-100719965 CCTCCCCTGCTGAATGTGGCTGG + Intronic
1087806909 11:102565299-102565321 CTTTCCCTGAAGAAAGAGGCCGG + Intergenic
1088282347 11:108148238-108148260 ACTCCCCCTCAGGAAGAGGAGGG + Intergenic
1088613865 11:111603200-111603222 CCTCCCCTGCCCGACGAGGAAGG + Intronic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1088953285 11:114591577-114591599 ACTCCCCTGCAAAAATAGAATGG + Intronic
1089075439 11:115734750-115734772 CTTCCCCTGCAGAGGAAGGAAGG - Intergenic
1089130317 11:116207218-116207240 CCTCCACTGCAGAACGAGCATGG + Intergenic
1089792312 11:120953853-120953875 CCTCCACTGCAGTAAGTGGAGGG - Intronic
1090817562 11:130312649-130312671 TTTCCCCTGCAAAAAGAAGAGGG + Intronic
1090934038 11:131325854-131325876 CCTTCCCTCCAGGTAGAGGAAGG - Intergenic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1093378126 12:18456387-18456409 TCTCTCCTGCAGAAAGAGAGGGG + Intronic
1094005445 12:25744438-25744460 CCTGTCCTGCACACAGAGGAAGG - Intergenic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1094605509 12:31945608-31945630 ACTGCCATGCAGAAAAAGGAGGG + Intergenic
1095640526 12:44480883-44480905 ACTCCCCTGCAGAAATAGAATGG + Intergenic
1096216059 12:49797869-49797891 CATCCCCAGCAGAAAGGGGTTGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096792471 12:54053610-54053632 CCTCCCCTGCAAAAGGAGATGGG - Intronic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1097260346 12:57716310-57716332 CCTCCCTTGGTGATAGAGGAGGG + Intronic
1097826917 12:64183595-64183617 CCTTCCCTGGAGAAAGAATATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1101712918 12:107285263-107285285 CATCTCCTGCAGAAAGAACAGGG - Intergenic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1103919087 12:124390149-124390171 CCTCCCCTGCAGAGGGCAGAGGG - Intronic
1104437907 12:128770452-128770474 CCTCCAGTGCTGACAGAGGACGG - Intergenic
1105700041 13:22928890-22928912 CATCCCCTGCAGATAAAGGGGGG + Intergenic
1107058536 13:36131352-36131374 CCTCCTCTGGAGAGAGAGGCTGG - Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1107552268 13:41487996-41488018 CCTCTCCTGAAGCAAAAGGAAGG + Intergenic
1107856995 13:44626081-44626103 CCTATCCTGAAGAAAGAGCAGGG - Intergenic
1109024638 13:57142531-57142553 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109025625 13:57149101-57149123 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109026615 13:57155674-57155696 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109027607 13:57162245-57162267 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109028593 13:57168810-57168832 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1110065502 13:71100608-71100630 CCTACCCTGAAGACAGGGGAAGG - Intergenic
1110888260 13:80666221-80666243 CACCCTCTGCAGATAGAGGAGGG + Intergenic
1111502334 13:89138107-89138129 CCTCCCATGGAGCAAGAGGTAGG + Intergenic
1112188340 13:97149865-97149887 ACTCCCCTGCAGAGAGAGGAGGG - Intergenic
1113800279 13:113082859-113082881 CCTGCCCAGCAGGATGAGGAGGG - Intronic
1117748022 14:58891363-58891385 GCTGCCCTGGAGAAACAGGAGGG - Intergenic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118709874 14:68510341-68510363 CCTTCCCTGGAGACAGAGGCCGG - Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119676788 14:76561793-76561815 CCTGCCATGCAGAAAGATGTGGG + Intergenic
1120450845 14:84665444-84665466 CATCCCCAGGAGAAAGGGGAGGG - Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121251879 14:92505697-92505719 CATCCCCTGCAAAACTAGGATGG + Intergenic
1121274453 14:92658003-92658025 CATCCCCTGGAGACAGAGGAGGG + Intronic
1121559528 14:94864445-94864467 CCGCCCCGGCAGATAGAGCAGGG - Intergenic
1122429789 14:101633110-101633132 CCTGACCTAAAGAAAGAGGAAGG + Intergenic
1123882139 15:24686552-24686574 CCTCTCCTGAAGACTGAGGACGG + Intergenic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1125967650 15:43887226-43887248 TCTCCGCAGCAGAGAGAGGAAGG - Intronic
1127003691 15:54541113-54541135 CCTTCTCTGGATAAAGAGGAAGG - Intronic
1128407709 15:67359936-67359958 CTTGCCCTGCAGCAAAAGGAAGG - Intronic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129568319 15:76649087-76649109 TCTCTCCTGCAGAAAGAGAGGGG - Intronic
1129706416 15:77797057-77797079 CCTCCCCTACTCACAGAGGATGG - Intronic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130629758 15:85555027-85555049 CCTCCCCCCCAAAAAAAGGAAGG + Intronic
1131071520 15:89469475-89469497 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131503902 15:92998665-92998687 CCTACCCTGCAGAATTAGGTAGG + Intronic
1132513539 16:355201-355223 CCTGCCCTGCAGGGACAGGAAGG + Intergenic
1133129114 16:3665267-3665289 TCTCCCCAGCAGCAGGAGGAGGG - Exonic
1133237259 16:4393037-4393059 CCAGCCCTGCTGGAAGAGGAGGG + Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1134053619 16:11155446-11155468 TCTCCCCTGCAGATAGCAGAAGG + Intronic
1134438656 16:14284296-14284318 CCTCCCCCCCAAAAAAAGGATGG + Intergenic
1134568993 16:15275332-15275354 CCTCCCCGCCTGAGAGAGGATGG + Intergenic
1134733444 16:16481030-16481052 CCTCCCCGCCTGAGAGAGGATGG - Intergenic
1134934058 16:18231252-18231274 CCTCCCCGCCTGAGAGAGGATGG + Intergenic
1135327053 16:21533173-21533195 CCTCCCATGCTGAATCAGGATGG + Intergenic
1135341098 16:21648679-21648701 CCTCCCCTGCCGCAAAAGAAGGG - Intronic
1136337369 16:29619013-29619035 CCTCCCATGCTGAATCAGGATGG + Intergenic
1137565752 16:49531560-49531582 ACCCCCAGGCAGAAAGAGGAGGG + Intronic
1138157856 16:54722494-54722516 CCTCCTCTGCAGCCACAGGAGGG - Intergenic
1138608665 16:58105743-58105765 ATCCCCCTGCAGACAGAGGAGGG - Intergenic
1138852954 16:60652065-60652087 GCTCTCCTACAGAAAGTGGAAGG - Intergenic
1139240819 16:65390272-65390294 CCACCGCTGCAGAGAGAGCAGGG - Intergenic
1139601484 16:67990121-67990143 CCGCCCCTGCAGAAGAAGAACGG - Exonic
1139813648 16:69647042-69647064 CCGCCCATGGAGGAAGAGGAGGG - Exonic
1141114849 16:81299698-81299720 TCTCCACTGCAGAAAGAGCCTGG - Intergenic
1141811661 16:86380154-86380176 CATTCCCATCAGAAAGAGGAAGG + Intergenic
1142003125 16:87675393-87675415 CCTGCCCAGGAGCAAGAGGAAGG - Intronic
1142040171 16:87888357-87888379 CCTCCCATGCTGAATCAGGATGG + Intronic
1142245384 16:88967891-88967913 CCTCCCTTGCAGCCAGAGGTAGG + Intronic
1143178084 17:4967966-4967988 CCGCCCCCGCAGACAGAGGCCGG + Intergenic
1144533187 17:16060112-16060134 CCTCCCCTTCAGGATGAGGAAGG + Intronic
1145755235 17:27385402-27385424 CCTTCCAGGCAGAAAGATGAGGG - Intergenic
1145816044 17:27795815-27795837 CCACCCCAGCATGAAGAGGAGGG + Intronic
1146320112 17:31840389-31840411 CCACCCCTGCACATAGAGGCAGG - Intergenic
1147210799 17:38871353-38871375 CCTCCCCTCCAGACTGGGGAGGG - Intronic
1148793400 17:50186010-50186032 CCTCCCCTGCAGTTCGAGTATGG - Exonic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151624969 17:75270931-75270953 CCTGCCCCCCAGTAAGAGGAAGG - Exonic
1151859911 17:76752755-76752777 CCTGCCCTGCTGAGAGAGGTGGG - Intronic
1152380699 17:79941102-79941124 CCTCGCCTGCAGACAGAGGACGG + Exonic
1152461496 17:80444602-80444624 CCTCCCCTGCCGCAGGAGCAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153354754 18:4122860-4122882 CCTTCCCTCCTGAAAGAGAAGGG - Intronic
1155177046 18:23310044-23310066 CCTTCCCTGGAGAGAGATGAGGG - Intronic
1156101080 18:33595636-33595658 CATACTCTGCAGAGAGAGGATGG - Intronic
1156627875 18:38931575-38931597 CTGCACCTCCAGAAAGAGGAGGG + Intergenic
1156929365 18:42622564-42622586 CATCCCCACCATAAAGAGGAGGG - Intergenic
1157135005 18:45045427-45045449 CCTCCCCTCCAAAAAGAAGCTGG + Intronic
1157558314 18:48627992-48628014 TCTCCCCTGCAGCAAGGAGACGG - Intronic
1157606314 18:48928086-48928108 ACTCCCCTGCAGCAAGAAGTGGG + Intronic
1157924917 18:51752955-51752977 CATCCCTGGCAGAAAGAGAATGG - Intergenic
1158935143 18:62357802-62357824 CATTCCCTGCAGACAGAGGCTGG + Intronic
1159026235 18:63184313-63184335 ACTTCCCTGCAGAGAGAGCATGG + Intronic
1159208564 18:65285815-65285837 CCACCACTGGAGAAAGATGAGGG - Intergenic
1161237725 19:3206135-3206157 TGTCCCCTGCGGAGAGAGGAGGG - Exonic
1161267350 19:3370387-3370409 CCTCCGCCGCAGAGAGGGGAGGG - Intronic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1164763644 19:30746510-30746532 CCTCTCCTGCAGAGAGAGAGAGG + Intergenic
1165357673 19:35313677-35313699 GCTCCCCTCCAGACAGATGAGGG - Exonic
1165427856 19:35755673-35755695 CCTCCCCTCCAGGATGAGCACGG - Exonic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1165946103 19:39443488-39443510 CATTCCCTGCAGAAAAAAGAGGG - Intronic
1165952727 19:39483247-39483269 CCTCCCCAGTGGAAGGAGGAGGG - Intronic
1166216998 19:41342294-41342316 CAGCCCCTGGAGGAAGAGGAAGG + Intronic
1167203638 19:48085452-48085474 CCTCCCTTGCAGCTAGAGGGAGG + Intronic
1167204398 19:48090764-48090786 CCTCCCTTGCAGCTAGGGGACGG + Intronic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168596492 19:57682034-57682056 CCTCCACTGCAGAAACTGGCGGG - Exonic
925349994 2:3194302-3194324 CCTGCCCTGCAGGAAGAGGCTGG + Intronic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
928481665 2:31690153-31690175 ACTCCCCTCCAGAAATAGAATGG - Intergenic
928752543 2:34487615-34487637 TCCCCACTGCAGAAAGAGGAAGG + Intergenic
929534147 2:42770085-42770107 CCTCCCCTTCCAAAATAGGATGG - Intronic
930023021 2:47012767-47012789 CCTCCCAAGCACAAAGAGGCTGG + Intronic
930970252 2:57386212-57386234 CTCTGCCTGCAGAAAGAGGAAGG + Intergenic
932461484 2:71884769-71884791 GCTCCCCTGCAGGTAGAGCAGGG - Intergenic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932626122 2:73297280-73297302 CCTCCCCAGAAGAGAGAGCAGGG - Intergenic
932863197 2:75315916-75315938 CCACCCCTGCCCAAAGAAGAAGG + Intergenic
933368620 2:81387702-81387724 ACTCCCCTGCAGAGATAGAATGG + Intergenic
933748085 2:85585098-85585120 CCTCCCCTAGAGAAAGAGAAAGG + Intronic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
935058760 2:99590315-99590337 CCTGCCCTGCAGAAACAGGCAGG + Intronic
935141875 2:100360603-100360625 TCTCTCCTGCAGAGAGAGAAAGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
935875843 2:107506181-107506203 ACTCCCCCTCAGAGAGAGGAGGG - Intergenic
936673067 2:114682188-114682210 CTTCCCCTTCAGAGAGAGGATGG - Intronic
937290138 2:120776983-120777005 CCTCCCCAGCAGTGAGAGGTGGG + Intronic
937536950 2:122900892-122900914 CCACCACTGCTCAAAGAGGAAGG - Intergenic
938229070 2:129642336-129642358 CTTCCCCTGCAGCTAGAGAATGG + Intergenic
938256789 2:129865531-129865553 TCTCCCCTCCAGAAACAGAAGGG + Intergenic
939410216 2:141815190-141815212 CTTGCCCTGAAGAAAAAGGATGG + Intronic
939955836 2:148527078-148527100 CATCCCATGCAGATAGAAGATGG + Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
941672638 2:168311038-168311060 CCTCCCCTTAAGCAAAAGGAAGG + Intergenic
942319955 2:174728267-174728289 CCTCCCCCGCAGCAACAGGTGGG + Intergenic
943393739 2:187305769-187305791 CCTTACCTAGAGAAAGAGGAAGG - Intergenic
943800405 2:192050479-192050501 CCACCCCTCCAGAAAAAGGAGGG - Intronic
945725034 2:213464908-213464930 ACTCTCCTGCAGAAATAGAATGG - Intronic
946145377 2:217726497-217726519 CCTCTGCTGCAGAAACATGAGGG + Intronic
947324681 2:228961475-228961497 CCTCCCCTGGGGAAGGAGCAAGG - Intronic
947556556 2:231098637-231098659 CCTCCCCTAGAGGAAGTGGAAGG - Intronic
947841565 2:233211091-233211113 CATTCCCTGCAGAATGAGGCAGG - Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168989197 20:2079779-2079801 CCTCCCTTGCAGCTACAGGATGG - Intergenic
1170412239 20:16104266-16104288 CCTACCCTGAAGAACAAGGAAGG + Intergenic
1171371722 20:24666682-24666704 CCTCCACTGCTGAAATAGTAGGG + Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1171960247 20:31488359-31488381 CCTCCCCCACAGCAAGAGGAGGG - Intergenic
1174161910 20:48557120-48557142 CCTTCCCTGGAGGAAGGGGAGGG - Intergenic
1174422871 20:50411708-50411730 CATCCCCTGCTGGAGGAGGAGGG - Intergenic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1175636269 20:60586885-60586907 GCTCCCCTCCAGAATCAGGAGGG - Intergenic
1176235143 20:64050405-64050427 CCACCGCTGCAGCAAGAGGCAGG + Intronic
1178836863 21:36105520-36105542 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179496508 21:41775227-41775249 CCTCCCCACCAGACAGAAGATGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179928708 21:44552420-44552442 CATCCCCAGCTGAAAGAGGCTGG - Intronic
1181336156 22:22131421-22131443 TCTCTCCTGCAGAAAGAGAGAGG + Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1182132858 22:27870829-27870851 CCTCCACAGCAGCAAGTGGATGG + Intronic
1182868830 22:33628092-33628114 GCTCCCAAGAAGAAAGAGGAGGG + Intronic
1183257311 22:36770834-36770856 CCTCCCCTGCACACTGTGGAAGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183987470 22:41577435-41577457 CCCACCCTGCACACAGAGGATGG + Exonic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184272636 22:43393389-43393411 CCTCTTCAGCAGAAAGAGGCCGG - Intergenic
1184288611 22:43486357-43486379 CCTCCCCTCCCCAAAGAGGCCGG - Intronic
1184930265 22:47675588-47675610 CCTTCCCGGAAGACAGAGGAGGG + Intergenic
1185073514 22:48670045-48670067 TCCCTCCTGCGGAAAGAGGAAGG + Intronic
1185109393 22:48892706-48892728 CCTCCCCAGCAGAGAGCGGGAGG + Intergenic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950627903 3:14261532-14261554 TCTCCCCTGCAGAAATAGGTTGG + Intergenic
950764557 3:15263750-15263772 CCTGCCTTGAAGAAAGAGGAGGG + Intronic
954391785 3:50271344-50271366 CCTCCCCTGCAGACAGAGCAAGG - Exonic
954613739 3:51959201-51959223 CCACCCCTGCACAAGGAGGCAGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955687890 3:61563399-61563421 CCTCCCCAGGGGAGAGAGGAGGG - Intronic
956072608 3:65470350-65470372 TATCCTCTGCAGAAAGAGGTAGG + Exonic
956737448 3:72248596-72248618 CCTCACCTCTACAAAGAGGATGG - Intergenic
960447243 3:117763488-117763510 CCTCCCCTGCCTAAAGAGAGAGG - Intergenic
960515334 3:118596505-118596527 CCTACCCTGGAGAAAGAAAATGG + Intergenic
960842314 3:121972421-121972443 TCTCCCCTGCAGAGAGAGAGGGG - Intergenic
961360634 3:126365066-126365088 CCTCCTCTGCAGGCAGAGGTGGG - Intergenic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
961998762 3:131273113-131273135 CCACACCTGCTGAAAGAGAATGG + Intronic
963080732 3:141391440-141391462 CTTCCCCTACAGTAAGAGGATGG + Intronic
966119907 3:176509859-176509881 ACTCCCCTACAGAAACAGAATGG - Intergenic
966341001 3:178924625-178924647 GCTCCACTCCAGAAAGATGAAGG - Intergenic
966735147 3:183181693-183181715 CATCCCCTGCATGAATAGGAAGG + Intronic
967814465 3:193787435-193787457 CCTGCTCTGCAGACAGAGGGAGG + Intergenic
968648202 4:1750166-1750188 CCCACTCTGCAGAGAGAGGAGGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968934194 4:3601463-3601485 CCTCCCTTGCACACAGAGGAGGG - Intergenic
969498584 4:7540018-7540040 CCTCCACAGCAGAAAGGGGGCGG - Intronic
970092904 4:12430264-12430286 CCTCCCCTACGGGAAGGGGAAGG - Intergenic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
971066678 4:23040725-23040747 CCTACCCAGCAGAAAGTAGATGG - Intergenic
972784748 4:42315793-42315815 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
973630186 4:52813063-52813085 CCTCTCCTCCATCAAGAGGAAGG + Intergenic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
974889971 4:67869961-67869983 CCTCCCCTGCCAAAAATGGAAGG + Intronic
976465389 4:85362564-85362586 TCTCCCCTGCAGAGAGAGAGGGG + Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977937879 4:102827256-102827278 CCTCTCCTGCTGGAGGAGGAGGG - Intronic
981931887 4:150198916-150198938 CCTGCCCTACAGAAAGTGGGGGG - Intronic
982000881 4:151020009-151020031 CCACCCCTGCAAAAAAAGGAAGG + Intergenic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
983090075 4:163493085-163493107 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
983296430 4:165873879-165873901 CCTCCCCCGGAGGAAAAGGAGGG - Exonic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
984605236 4:181778221-181778243 CCTCCGCAGCAAAAAAAGGATGG + Intergenic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
985952820 5:3236465-3236487 CCTCCTCTGTTCAAAGAGGAGGG + Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
986944633 5:13000948-13000970 GCTCCCCAGGAGCAAGAGGATGG + Intergenic
988686000 5:33526251-33526273 CAGCCCCTGCAGCAAGACGATGG + Exonic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990187210 5:53221722-53221744 TATCCCCTGCAGAAACAGAATGG - Intergenic
990349422 5:54900785-54900807 CCTACCCTGAAGAAAGGGGCTGG + Intergenic
993441390 5:87961123-87961145 CCTCCCATGCATAAATAGCAAGG + Intergenic
994079713 5:95694820-95694842 CCTCCCTGGTAGAAAGGGGAGGG - Intronic
996931600 5:128896002-128896024 CTTTGCCTGTAGAAAGAGGAGGG - Intronic
997280633 5:132642039-132642061 GCTACCCTGCAGGAAGTGGAGGG - Intronic
997357482 5:133272986-133273008 CATCCCCTGCAGGAGCAGGACGG + Intronic
997955564 5:138275935-138275957 CCTCCTCTCCAGAAAGGTGAGGG + Intergenic
998205269 5:140153150-140153172 GCTCCAGTGCATAAAGAGGAAGG - Intergenic
998536069 5:142932030-142932052 CCTGGCCTGCAGAGAAAGGAGGG - Exonic
998633962 5:143931884-143931906 CCTCTCCTGAAGCAAAAGGAAGG - Intergenic
999347410 5:150836546-150836568 GCTCCCCTAGAGGAAGAGGAAGG - Intergenic
1001032411 5:168272405-168272427 CCACCTCTGCAGAAAGTGAAGGG - Intergenic
1001057008 5:168458007-168458029 CCTCCCTTGCAGCTAGAGGCAGG - Intronic
1003017293 6:2478393-2478415 CCTCCCCTGCACACAAGGGAAGG + Intergenic
1003308802 6:4950990-4951012 CCTCCCATGCAGGCAGAGGCTGG - Intronic
1003518380 6:6836571-6836593 CCTGCTCTGCAGAAATAAGAAGG - Intergenic
1006528009 6:34624931-34624953 CCTCTCCTCCTGAAAGAGGATGG + Intronic
1007230393 6:40343993-40344015 GCTCCCCTGCAGATAGTTGAAGG - Intergenic
1010573730 6:77508102-77508124 ACTCCCCTGCAGAAATAGAATGG - Intergenic
1010733145 6:79412091-79412113 CGTTCCCTGAAGAAAGGGGAAGG + Intergenic
1014198671 6:118585535-118585557 ACTCCCCCACAGAAATAGGATGG + Intronic
1016073254 6:139766157-139766179 TCTCCCCAACTGAAAGAGGAAGG - Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1018684889 6:166296724-166296746 CCAGCCCTGGAGGAAGAGGAAGG - Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019867603 7:3727469-3727491 TCTCCCTGGCAAAAAGAGGATGG - Intronic
1019893391 7:3964351-3964373 CTTCTCCTCAAGAAAGAGGAGGG - Intronic
1020101041 7:5394590-5394612 CCTCGCCTGCAGAGAGAAGTTGG + Exonic
1021197326 7:17688024-17688046 CCTCTCCTGGAGAAAGAGACAGG + Intergenic
1021236911 7:18153566-18153588 TCTGCCCTGCAGAAAAAGGTGGG + Intronic
1023124927 7:36946006-36946028 CCTCTCCTGCCAAAGGAGGATGG + Intronic
1023615736 7:42017505-42017527 CCTCCCAGGCTGAAAGGGGAGGG + Intronic
1024075047 7:45813883-45813905 CCTCCCATGCTGAGAGAGGTCGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024311585 7:47974512-47974534 CCCTCCCTGCAGAACGAGGCTGG - Intronic
1025129523 7:56368238-56368260 CCTCCCATGCTGAGAGAGGTCGG - Intergenic
1025129705 7:56368967-56368989 CCTCCCATGCTGAGAGAGGTCGG - Intergenic
1025783444 7:64622341-64622363 ACTCCCCTGCAGAAATAGAATGG + Intergenic
1026915331 7:74116608-74116630 CCAGCCCTGAAGACAGAGGAGGG - Intronic
1026953765 7:74364243-74364265 CCTCCCCTGCAGGAAGGTGGAGG + Exonic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028251290 7:88542428-88542450 ATTCCCCTGCAGAAATAGAACGG - Intergenic
1029448552 7:100627969-100627991 CATCCCCTGGAAAAAGGGGAGGG + Exonic
1030140006 7:106294546-106294568 CCTCCCTTGCAGATACAGCATGG - Intergenic
1033028834 7:137805374-137805396 CCTTCCCTGCAGACAGCGTAAGG - Intronic
1033928626 7:146495486-146495508 CCTCCCCTGCAAAATAATGAAGG + Intronic
1033978114 7:147126971-147126993 AATCCCCTGCAGAAAGTGAAAGG + Intronic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034530809 7:151695354-151695376 CTCCCCCTGCAGGAAGTGGATGG - Intronic
1035224990 7:157428028-157428050 CGTCCCCAGCAGAGGGAGGAGGG + Intergenic
1036129732 8:6097913-6097935 TCTCTCCTGCAGAAAGAGAGGGG + Intergenic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036493843 8:9251747-9251769 CCTTCACTGGAGGAAGAGGAGGG + Intergenic
1039517250 8:38144381-38144403 CCACCCCTGCAGTAGGAGGTAGG + Exonic
1041781989 8:61586775-61586797 CCTCCCCTGTAGGGAGAGGTAGG - Intronic
1042785177 8:72537729-72537751 CCTCCCCTCCACAGAGAGGAGGG - Exonic
1043691586 8:83160166-83160188 CATCCCCCCCAAAAAGAGGAAGG + Intergenic
1045777473 8:105822637-105822659 TCTCTCCTGCAGAGAGAGGGGGG + Intergenic
1047445134 8:124912817-124912839 TCTCCCCTGCAGAGAGAGATGGG - Intergenic
1047611278 8:126523268-126523290 CATCTCCTGCAGAAAGAAAATGG - Intergenic
1047710843 8:127550747-127550769 ACTACCCTGCAGAGAGTGGAGGG + Intergenic
1048223714 8:132565711-132565733 CCCCCACTGAAGAAAGATGAAGG - Intergenic
1049497564 8:142943490-142943512 CCTCCCCTGCACACAGACCAGGG + Intergenic
1049511302 8:143028154-143028176 CCTCCCCTGCAGGTTGAGGTTGG - Intergenic
1049549351 8:143249681-143249703 TCTCCCCAGCACCAAGAGGATGG + Exonic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1053107789 9:35427144-35427166 CCTGCCATGAAGAAAGAAGAAGG - Intergenic
1053109651 9:35447216-35447238 CTTCTCCTGCAGAAAAATGAAGG - Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054455957 9:65430516-65430538 CCTCCCTTGCACACAGAGGAGGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1055954148 9:81758333-81758355 CCACCCATGCAGAAAGAGATAGG - Intergenic
1056251508 9:84753212-84753234 CCTCCCCTGAAGAAACATCAAGG - Intronic
1057936927 9:99248135-99248157 CCTCCCCTTCAGGGAGAGGAAGG - Intergenic
1059517578 9:114910013-114910035 ACTGCCCTACAGAAAGAGTAAGG - Intronic
1060085447 9:120695884-120695906 CCTCCCCTGCAGCCAGGGCATGG + Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1062118813 9:134822981-134823003 CGGACCCTGCAGAGAGAGGAGGG - Exonic
1062239119 9:135526429-135526451 CCACCCCTGCAGAACGCGGCTGG + Exonic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186457714 X:9723042-9723064 CCTCCCTTGCAGCTAGAGCAAGG - Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186601972 X:11048202-11048224 CCTCCCCTTAAGCAAAAGGAAGG + Intergenic
1189277179 X:39795312-39795334 CCTCCGCTGCAAAAAAAGGAAGG - Intergenic
1190261214 X:48798511-48798533 CCTCCTCTGCAGATAGATGTGGG + Intergenic
1191105723 X:56770903-56770925 CCCCCCCCCCAAAAAGAGGAAGG - Intergenic
1191106716 X:56776305-56776327 CCCCCCCCCCAAAAAGAGGAAGG - Intergenic
1192998951 X:76542414-76542436 GCTCCCCTGCAGAAATATAATGG - Intergenic
1195223145 X:102765754-102765776 CCTCCCCTGAAGTAAGGAGAGGG + Intergenic
1195502151 X:105613746-105613768 CTTTGCCTGCAGAAAGGGGAGGG + Intronic
1196262755 X:113603957-113603979 CTTCACCTGTAGCAAGAGGAGGG + Intergenic
1197482830 X:127008072-127008094 CCAGCCCTGGAGAAAGATGAAGG + Intergenic
1198742224 X:139853198-139853220 CCTCCCCTAGGGGAAGAGGAAGG + Intronic
1199637513 X:149827161-149827183 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1200010414 X:153115921-153115943 CCTCCCCTGCAGCCTCAGGAGGG + Intergenic
1200029186 X:153284001-153284023 CCTCCCCTGCAGCCTCAGGAGGG - Intergenic
1200177285 X:154125938-154125960 CCTCTCCTCAAGCAAGAGGAAGG - Intergenic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1200768082 Y:7097680-7097702 CCTCCCTTGCAGCTAGAGCAAGG - Intergenic
1201296960 Y:12472000-12472022 ACTTCCCTGCAGAAAGAGACTGG - Intergenic