ID: 1079319938

View in Genome Browser
Species Human (GRCh38)
Location 11:19443269-19443291
Sequence TGGATGAAATGCTACACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079319933_1079319938 14 Left 1079319933 11:19443232-19443254 CCTTATCCTTGCTGAGTTGCTCC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118
1079319936_1079319938 -7 Left 1079319936 11:19443253-19443275 CCTCCACTGCGACACTTGGATGA 0: 1
1: 0
2: 2
3: 6
4: 61
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118
1079319934_1079319938 8 Left 1079319934 11:19443238-19443260 CCTTGCTGAGTTGCTCCTCCACT 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118
1079319930_1079319938 28 Left 1079319930 11:19443218-19443240 CCCTCTATGCCAGGCCTTATCCT 0: 1
1: 0
2: 0
3: 18
4: 190
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118
1079319932_1079319938 19 Left 1079319932 11:19443227-19443249 CCAGGCCTTATCCTTGCTGAGTT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118
1079319931_1079319938 27 Left 1079319931 11:19443219-19443241 CCTCTATGCCAGGCCTTATCCTT 0: 1
1: 0
2: 7
3: 138
4: 1306
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118
1079319937_1079319938 -10 Left 1079319937 11:19443256-19443278 CCACTGCGACACTTGGATGAAAT 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079319938 Original CRISPR TGGATGAAATGCTACACTGC AGG Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901953070 1:12763889-12763911 AGGAAGGAAGGCTACACTGCTGG - Intergenic
916732241 1:167576676-167576698 TGAATAAAAGGGTACACTGCTGG + Intergenic
920028198 1:203017174-203017196 TGGGTGAAATTCTACTCTCCCGG - Intronic
923588623 1:235298925-235298947 TGAATGAAATGCCACTGTGCTGG - Intronic
1064217019 10:13409077-13409099 TGGATGATATGCTAAACAACGGG - Intergenic
1064916800 10:20467269-20467291 TCAATGAAATTCTACACAGCGGG - Intergenic
1065089396 10:22215852-22215874 TGGATGAAATATTACACAGCAGG + Intergenic
1068392571 10:56417170-56417192 TGGATTAAATGCTTCTCTTCTGG - Intergenic
1068466283 10:57397075-57397097 TTGATTTTATGCTACACTGCAGG + Intergenic
1069030322 10:63589326-63589348 TGGAGGAAAAGCTCCACTGGAGG - Intronic
1069978734 10:72237258-72237280 TGTAAGAAATGCTACACTTAAGG + Intergenic
1070244231 10:74715511-74715533 TGGAAGAAATGGTACATTCCTGG - Intergenic
1074138308 10:110646890-110646912 TGGATGAAATTCTCCTCTGGTGG + Intronic
1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG + Intronic
1080028425 11:27635897-27635919 GGGATGAAATTTTCCACTGCTGG + Intergenic
1080440357 11:32288630-32288652 TGAAAGAAAGGCTGCACTGCAGG + Intergenic
1080682399 11:34488999-34489021 TGGGTGAGATGCTACACCCCGGG + Intronic
1083017533 11:59470841-59470863 TGAAGCAAATGCAACACTGCTGG + Intergenic
1086955621 11:92932150-92932172 TGGATGAACTGCTTCCCTGTGGG + Intergenic
1087301816 11:96444470-96444492 TGGATGAAATGCACAAATGCTGG - Intronic
1088504366 11:110514015-110514037 AGGATGACATGCTGCACCGCAGG - Intergenic
1092784551 12:12015553-12015575 TGGATGAAGTGCTGCCCTGCGGG - Intergenic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1093891927 12:24532113-24532135 TGGATTATTTTCTACACTGCAGG - Intergenic
1096558180 12:52416985-52417007 TGATTGAAATGCAACACTGTGGG + Intergenic
1100189850 12:92178948-92178970 TTAATGCAATGCTACAGTGCAGG + Intergenic
1101199103 12:102416174-102416196 TGGATGAAATGCTTCACTTCTGG + Intronic
1101594854 12:106155193-106155215 TGTAGGAAATATTACACTGCAGG + Intergenic
1102514744 12:113438863-113438885 TGGATGGATTGATACACTGATGG - Intergenic
1102762772 12:115403298-115403320 TGAGAAAAATGCTACACTGCTGG - Intergenic
1108062328 13:46545764-46545786 TAAATGAAATGATACTCTGCAGG - Intergenic
1109689341 13:65865456-65865478 TGGATGAAATGCTTCCCTCCAGG - Intergenic
1113641223 13:111958457-111958479 TGGAAGAAAAGCTAATCTGCTGG + Intergenic
1119637494 14:76288492-76288514 TGGATGAAACCCAAAACTGCTGG - Intergenic
1123755732 15:23396366-23396388 TGTTTTAAATGCTGCACTGCAGG - Intergenic
1124655856 15:31506544-31506566 TTGATGAAATGCTAGAGTGAAGG + Intronic
1126089328 15:45037585-45037607 TGCGTGAAATGTTAAACTGCAGG - Intronic
1128684554 15:69674179-69674201 TGGATGAAAAGCCACCCTCCTGG - Intergenic
1129147156 15:73658818-73658840 TGGCTGCAATGTTTCACTGCAGG - Intergenic
1131069283 15:89455112-89455134 TGGAGGAAACGCTACACAGCAGG - Intergenic
1202971467 15_KI270727v1_random:242076-242098 AGTATCAGATGCTACACTGCTGG + Intergenic
1134095332 16:11415023-11415045 GGGATGAAAGGCTTCTCTGCAGG + Intronic
1134875994 16:17699219-17699241 TGGATGAAATGTGACACAGCTGG - Intergenic
1138241799 16:55433556-55433578 CGAATGCCATGCTACACTGCTGG - Intronic
1149218609 17:54388875-54388897 AGGCTGAAAGGCTAGACTGCTGG + Intergenic
1152215559 17:79029784-79029806 TGGATGAAGTGCCACCCTGCTGG + Intronic
1153408739 18:4769979-4770001 TGGATGGAACCCCACACTGCAGG - Intergenic
1155290287 18:24333816-24333838 TGGGAGGAATGCTACACTTCTGG - Intronic
1155457000 18:26028327-26028349 TGGGTGAAATCATACACTGCTGG + Intronic
1163919579 19:20276167-20276189 TGGGAGAGATGCCACACTGCGGG + Intergenic
1167972766 19:53198764-53198786 TGAATGAAATGATATACAGCAGG + Intergenic
926170018 2:10547274-10547296 TGGATGAGATACTTTACTGCTGG - Intergenic
927706651 2:25300284-25300306 GGCCTGGAATGCTACACTGCTGG - Intronic
929226113 2:39513288-39513310 TGGATGAGCTGCCACTCTGCTGG + Intergenic
931686160 2:64795975-64795997 TGGATGAAATGCCACACCGCAGG - Intergenic
938668870 2:133567809-133567831 TTCATGAACTGGTACACTGCAGG - Intronic
939492160 2:142889352-142889374 GGGAAGAAATGCTACACCGAGGG - Intronic
939521938 2:143242148-143242170 TAGATGAAATGCCACTTTGCAGG - Intronic
944958013 2:204835033-204835055 TTAATGAAATGGTACCCTGCAGG + Intronic
948184248 2:236007357-236007379 CGGGTGAAATGATACACTTCAGG - Intronic
1170892473 20:20387789-20387811 TGGAAGACACGCTTCACTGCAGG + Intergenic
1173509328 20:43614092-43614114 TAGCTGAAATGCTACTTTGCAGG - Intronic
1173735595 20:45359177-45359199 TGAATGAAATGTTAAACTTCAGG - Intergenic
1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG + Intronic
1179160855 21:38897117-38897139 AAAATGAAATGCTACACAGCCGG + Intergenic
1180196681 21:46200838-46200860 TTGATGAAATACTAATCTGCAGG - Intronic
1183053586 22:35286285-35286307 TGGCTCAAATGTAACACTGCTGG - Intronic
1184808917 22:46815713-46815735 TGGATGAGCTGCTACAGGGCAGG - Intronic
1184935920 22:47720387-47720409 GGGATGAATAGCGACACTGCAGG + Intergenic
949094741 3:72968-72990 TGTAAGAAATACTACACTGAAGG - Intergenic
951890053 3:27560067-27560089 TGGATGAAATGCTGTGCTGCAGG + Intergenic
953932180 3:47010929-47010951 TGGGTGGAATGCTACCCTGGTGG - Intergenic
955658235 3:61267646-61267668 TGGATGAAGTGCTCCATTCCTGG - Intergenic
955803667 3:62711386-62711408 TGAATGAAATGTTACATTTCAGG + Intronic
956339709 3:68208760-68208782 TGGAGGAAATTCTGCACAGCAGG - Intronic
957632116 3:82729558-82729580 TCAATGAAATGTTACACTGTAGG + Intergenic
958960667 3:100506518-100506540 TGTATAAAATGTTACACTGAAGG - Intronic
961237675 3:125381697-125381719 TGAATAAACTGCTTCACTGCAGG + Intergenic
962923476 3:139971639-139971661 TGAATGAAATGCTAAATTTCTGG - Intronic
964832057 3:160895180-160895202 TGGGTGAAATGTGGCACTGCAGG - Intronic
967406029 3:189117464-189117486 TGGTTGAAGTGCTAAACTACAGG - Intronic
974669729 4:65014263-65014285 TTGATGACCTGCCACACTGCTGG + Intergenic
974694218 4:65344467-65344489 TGGATGATCTGCTGCACAGCTGG + Intronic
977254419 4:94725192-94725214 TGGATGAGATGCTGCACAGAGGG + Intergenic
983028350 4:162765958-162765980 TGCATTAAATGCCAGACTGCAGG - Intergenic
987564145 5:19563583-19563605 TAAATGAAAGGCTTCACTGCTGG + Intronic
987846923 5:23298972-23298994 AGGACAAAATGGTACACTGCTGG - Intergenic
989679031 5:44007589-44007611 TGGATGGAAGGCTATACTTCAGG + Intergenic
991608923 5:68430769-68430791 AGGATGAAATGGTACACTTTGGG - Intergenic
994745372 5:103671222-103671244 TAGTTGAAATGCTTCAATGCTGG - Intergenic
995667338 5:114557452-114557474 TGTATTAAATACTACACTGGAGG + Intergenic
997897911 5:137736204-137736226 TGGATGATAAACTCCACTGCAGG - Intergenic
1000628813 5:163568483-163568505 GGGATTAAATGATAAACTGCAGG + Intergenic
1001980676 5:176035421-176035443 ACCATCAAATGCTACACTGCTGG - Intergenic
1002236786 5:177808644-177808666 ACCATCAAATGCTACACTGCTGG + Intergenic
1003198404 6:3935691-3935713 TGCCTGAAATAATACACTGCTGG + Intergenic
1007203237 6:40128920-40128942 GGGAAGAAAGGCTTCACTGCGGG - Intergenic
1008905320 6:56671344-56671366 TGGATCAAATTCTGCTCTGCAGG - Intronic
1010373158 6:75135103-75135125 TGGATGAAATTTTGCAGTGCTGG - Intronic
1012290391 6:97448395-97448417 GCGATGAAATACTACACAGCAGG - Intergenic
1017556797 6:155580343-155580365 TGCATGAAATGCAACAGTGCCGG + Intergenic
1018630675 6:165819408-165819430 TGCATGAAATGGAACAGTGCAGG - Intronic
1024252985 7:47520292-47520314 TGGATGTAATGCTACTCTCTGGG - Intronic
1028059191 7:86288595-86288617 GGGATGAAATGCTACACAATGGG + Intergenic
1033680406 7:143588424-143588446 TGGGTGAAATGACACACTGTTGG - Intergenic
1033704488 7:143873388-143873410 TGGGTGAAATGACACACTGTTGG + Intronic
1036141558 8:6213650-6213672 TGGCTGAAATGCTGCTCTGCCGG + Intergenic
1037319716 8:17631344-17631366 TGGCTGAGAAGCTCCACTGCAGG - Intronic
1037773189 8:21815079-21815101 TGGATGAAATGTTTTCCTGCTGG - Intergenic
1041783640 8:61607031-61607053 AGGAGGAAATGACACACTGCTGG - Intronic
1044280047 8:90343887-90343909 TGGATTACATGCTTCACTACAGG + Intergenic
1045070470 8:98499106-98499128 GGGAAAAGATGCTACACTGCTGG + Intronic
1046077106 8:109326033-109326055 TGGATGAAACTCGATACTGCAGG + Intronic
1047316823 8:123742154-123742176 GGGATGAGATTCTATACTGCAGG + Intergenic
1048140513 8:131789877-131789899 TGGATGCAATGTTATGCTGCAGG - Intergenic
1049994619 9:1023246-1023268 TGGAAGAAATACTAGAATGCAGG - Intergenic
1050751040 9:8937533-8937555 TTGCTAAAATGCTAGACTGCGGG - Intronic
1058746759 9:107999172-107999194 TGGATGTAATGCGACACCGTGGG - Intergenic
1062699783 9:137892823-137892845 TGGGTGGAATTCGACACTGCAGG + Intronic
1185791640 X:2931898-2931920 TGGAAGAAATCCTATGCTGCTGG + Intergenic
1189729239 X:44001509-44001531 TGAGTGAAATGCTAAACTTCAGG - Intergenic
1190561201 X:51687103-51687125 TGAATGAAAAGCTTCACTGAAGG - Intergenic
1190563090 X:51706214-51706236 TGAATGAAAAGCTTCACTGAAGG + Intergenic
1191793290 X:64993844-64993866 AGGATGAAATGAAAGACTGCAGG - Intronic
1193876677 X:86869930-86869952 TGGTTTAAATGCTACCCTGTGGG + Intergenic
1199478135 X:148268809-148268831 TGGATGTAATACTACATTTCAGG - Intergenic
1201282003 Y:12350390-12350412 TGGAAGAAATCCTGTACTGCTGG - Intergenic
1202280202 Y:23176677-23176699 TGGATGAATTGCTAACCTTCGGG + Intronic
1202280931 Y:23187522-23187544 TGGATGAATTGCTAACCTTCGGG + Intronic
1202436633 Y:24845385-24845407 TGGATGAATTGCTAACCTTCGGG - Intronic