ID: 1079320153

View in Genome Browser
Species Human (GRCh38)
Location 11:19445205-19445227
Sequence TGTGGTCCTGAAGATAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079320153 Original CRISPR TGTGGTCCTGAAGATAGACA GGG Intronic
900777904 1:4598649-4598671 TTTGGGACTGAAGAGAGACATGG + Intergenic
902910976 1:19597093-19597115 TGCGGTCGTGAAGATAGGTAAGG + Exonic
904705464 1:32386956-32386978 TCTGGTACTGAAGAAACACAGGG - Intronic
911279513 1:95905275-95905297 TGTGGTCCATGAGACAGACAAGG + Intergenic
911726053 1:101242046-101242068 TGTGGTTCAGAAGATAGGCTGGG - Intergenic
911986454 1:104631187-104631209 TGTGTTCCTTAATATAGACCTGG - Intergenic
912661171 1:111532286-111532308 TGTGGTTGAGAAGATAGACATGG - Intronic
914811763 1:151033880-151033902 TGTTGCCTTGAAGATAGGCATGG - Exonic
916364862 1:164014608-164014630 TGTGATCATGAAGAGACACATGG - Intergenic
916455069 1:164962695-164962717 AGTGGTCATGAAGATAGAGCAGG - Intergenic
917680229 1:177358463-177358485 TTTGGCCCTGAAGATTGAGAAGG + Intergenic
918026861 1:180758808-180758830 TGTGGTGCTGAAAAAAGAAATGG - Intronic
919271606 1:195355889-195355911 CTGGGTCCTGAAGAAAGACATGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064088936 10:12367000-12367022 AGTGGTCATGAGGATAGAGATGG - Intronic
1064156099 10:12904520-12904542 TGTGGTCCTAAGGATAGAGGAGG - Intronic
1064256853 10:13749621-13749643 TGTGGTGATAAAGAAAGACATGG + Intronic
1064347726 10:14548185-14548207 GGTGGGCCTGAAGATCGAGAGGG + Intronic
1066757861 10:38728988-38729010 TGTGTACCTGAACATAGAGAAGG - Intergenic
1071988369 10:91075303-91075325 TGTGGTCCTGCAGGGACACAGGG - Intergenic
1072075049 10:91962654-91962676 TTTGTGTCTGAAGATAGACAAGG - Exonic
1074468856 10:113708537-113708559 TGTGGTCCTGAACCAAGAAATGG + Intronic
1075684081 10:124351883-124351905 CTGGGTCCTGAAGATAAACAGGG - Intergenic
1077899341 11:6476899-6476921 TGTGGCCAGGAAGATAGACAGGG + Exonic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1080172145 11:29317713-29317735 TGTGTTCCTAAACATAGAAAAGG + Intergenic
1080364404 11:31554098-31554120 TGTTTTCCTGCAGCTAGACAGGG - Intronic
1084678205 11:70649204-70649226 GGGGGTCATGGAGATAGACAGGG - Intronic
1085041951 11:73331723-73331745 TGTTGTCCTGGAGAGAGAGAGGG + Intronic
1087074625 11:94117959-94117981 TGTGGTCTGGAGGATAGAAATGG - Intergenic
1088077020 11:105862336-105862358 TTTGGTCCTGAAGATAGTCATGG - Intronic
1089848309 11:121476077-121476099 TGTGCCCCTGAAGATATACGTGG + Intronic
1090057530 11:123436372-123436394 TGTTGGCTTGAAGATAGAGATGG + Intergenic
1090118188 11:123996982-123997004 TGTGGTGCTAAAGATTGAGAGGG - Intergenic
1090338088 11:125988237-125988259 CTTGTTCCTGAAAATAGACACGG + Intronic
1090384896 11:126352041-126352063 TGTGGTCCTAAACAGAGGCAGGG + Intergenic
1091117744 11:133030428-133030450 TGTGGTTCAGGAGAGAGACAAGG - Intronic
1092981774 12:13802142-13802164 TGAAATCATGAAGATAGACACGG + Intronic
1096599458 12:52718962-52718984 TGTGGTCCTGAAGAAGGTGAGGG - Intergenic
1096773913 12:53952769-53952791 TTTGGTCATAAAGATAAACAGGG - Intergenic
1097694922 12:62766634-62766656 TGTGGTCCTGAAAAAAGAGGAGG + Intronic
1101273758 12:103176659-103176681 TGAGGTCCTGAAGATAGTCATGG + Intergenic
1104398445 12:128455442-128455464 TGTGGTCCTGAAAGATGACAAGG + Intronic
1104763841 12:131313881-131313903 TGTGGCCATGAAGAGAGAAAGGG - Intergenic
1104815655 12:131644175-131644197 TGTGGCCCTGAAGAGAGGAAGGG + Intergenic
1105761842 13:23522311-23522333 TGTGCTCCTGAAGAAAGGGAAGG + Intergenic
1107777575 13:43862594-43862616 GGTGGTAATGAAGACAGACATGG - Intronic
1109187064 13:59282569-59282591 TGTTGTCCAGAAAATAGAGATGG + Intergenic
1109488729 13:63065232-63065254 TGTGTACCTGAAGATACATAAGG + Intergenic
1110667685 13:78137322-78137344 TGTACTCCTGAAGACATACAGGG - Intergenic
1111211315 13:85083627-85083649 TGTAGTTCTGTAGATAGACCCGG - Intergenic
1111247406 13:85558116-85558138 TGTTGTCCTGAAGAAAGACATGG - Intergenic
1112242920 13:97700040-97700062 TGTTTTTCTGATGATAGACAGGG - Intergenic
1115531197 14:34328875-34328897 TGTGGTATTGAAGAAAGGCAAGG - Intronic
1118635728 14:67747408-67747430 TGTGGTCCTGAAGAGACTGAAGG + Exonic
1123441256 15:20293678-20293700 TGTGTACCTGAACATAGAGAAGG - Intergenic
1125224057 15:37374529-37374551 AATGGTTCTAAAGATAGACAGGG - Intergenic
1125491036 15:40148619-40148641 TGTGATGGTGAAGAGAGACAGGG - Intergenic
1126771149 15:52057249-52057271 GGTGGTCCTGTTGAAAGACAAGG + Intronic
1128689148 15:69710057-69710079 TGTAGTCCCGCAGATAGACCAGG - Intergenic
1130702565 15:86199914-86199936 TGGGGTTGTGAAGATAAACATGG + Intronic
1130999862 15:88931380-88931402 AGTGGTCCAGAAGATAAACAAGG + Intergenic
1131302452 15:91211371-91211393 TGTGATCCTGAAGACTGCCATGG - Intronic
1133254033 16:4505468-4505490 TCTGGTCCTGCAGAGACACAAGG - Exonic
1136520534 16:30792836-30792858 TGAGGTCCTGGAGGTAGACCCGG + Intergenic
1136725007 16:32350236-32350258 TGTGTACCTGAACATAGAGAAGG + Intergenic
1136843336 16:33556289-33556311 TGTGTACCTGAACATAGAGAAGG + Intergenic
1138228718 16:55323112-55323134 TGTGGCCCAGAAGATAGCAACGG - Intergenic
1138394143 16:56691316-56691338 AGTGGTCCTTCAGAGAGACAGGG + Intronic
1139311773 16:66033621-66033643 TGTGGGGCAGAAGACAGACAAGG - Intergenic
1140859142 16:79004202-79004224 TGTGGTTCTGAAGGTGCACAGGG - Intronic
1141153879 16:81583334-81583356 TGTGGGCCTGATGGTAGAAAAGG + Intronic
1203001423 16_KI270728v1_random:167518-167540 TGTGTACCTGAACATAGAGAAGG - Intergenic
1203133026 16_KI270728v1_random:1703922-1703944 TGTGTACCTGAACATAGAGAAGG - Intergenic
1203153501 16_KI270728v1_random:1856587-1856609 TGTGTACCTGAACATAGAGAAGG + Intergenic
1147339397 17:39744837-39744859 TGTGGTCCTAAAGGCAGATATGG + Intronic
1149501006 17:57152425-57152447 TTTGGTCTTGAACACAGACAGGG - Intergenic
1149598020 17:57875420-57875442 TGTGGTCCTGAAGGAAGGCCAGG + Intronic
1151787381 17:76281689-76281711 TGTGGACCTGCAGAAAGACCAGG + Intronic
1154008883 18:10559081-10559103 TCTGTTCCTGAAGCAAGACATGG - Intergenic
1155016262 18:21843623-21843645 TATGGTCATGAAGAAAGCCATGG - Intronic
1155998027 18:32352668-32352690 TCTGGTCCTGAGGAAAGAAAAGG - Intronic
1156437599 18:37149620-37149642 TGTGTACCTGAATATAGAAAAGG + Intronic
1159762197 18:72441886-72441908 TGTAGTATTGAAGAAAGACATGG - Intergenic
1159809302 18:72997248-72997270 GGTGGTTCTGATGAGAGACAAGG - Intergenic
1160236619 18:77090801-77090823 GGTTGTCCTGCAGATAGGCAGGG - Intronic
1161391600 19:4024020-4024042 TGTGGGACTGAAGACAAACACGG - Exonic
1161682003 19:5684803-5684825 TGTGGGCCTGCAGAGGGACAGGG - Exonic
1162469052 19:10861248-10861270 TGGAGTCCCGGAGATAGACATGG - Intronic
1167380971 19:49137936-49137958 GGTGGCCCTGATGATAGTCAAGG - Intronic
925566853 2:5264525-5264547 TGTGATTCTGACGATAGAGAGGG + Intergenic
925584442 2:5450250-5450272 TGTGGTCCTGAAATAAGAAAAGG + Intergenic
925933313 2:8728644-8728666 TGCGTTCCTGTAGATAGAAAAGG - Intronic
928234499 2:29527945-29527967 TGAGGTCCTGCAGAAAGGCAAGG + Intronic
929373850 2:41260214-41260236 AGTTGTCCTGTAGATAGAAATGG - Intergenic
929944636 2:46361171-46361193 TGTGGAACTGAACATAGACGTGG + Intronic
930559756 2:52946737-52946759 TGAGGTCCTGAAAATAGATCAGG + Intergenic
931968558 2:67560602-67560624 TGTGGTCTTTAAGAAACACATGG + Intergenic
933577602 2:84087396-84087418 TGTGTTCCTGGAGATGGAGAGGG - Intergenic
938030435 2:127987804-127987826 TGTGTTTCTAAAGATAGACTGGG - Intronic
938994149 2:136659561-136659583 TGTGCACCTGTAGACAGACAGGG - Intergenic
939357644 2:141124909-141124931 AGTGGTCCAGAAAACAGACACGG - Intronic
942159570 2:173168916-173168938 AGTGGTACTGAAGAGTGACATGG - Intronic
942183684 2:173404115-173404137 TGTGCTCCTGGAGACAGAAATGG + Intergenic
943058088 2:183008465-183008487 TGAGGTCTTAGAGATAGACAAGG - Intronic
943687261 2:190831595-190831617 TGGGCACCTGAAGATAGAAACGG + Intergenic
944786805 2:203079799-203079821 TGCTGTCCTGAATGTAGACAAGG - Intronic
946537270 2:220645371-220645393 TGTGGGCCTGAACTGAGACAAGG - Intergenic
948549020 2:238755667-238755689 TGTAGCCCTGAAAATAGAAACGG + Intergenic
1169906471 20:10609646-10609668 TGTGGGCCTGAACAGGGACATGG - Intronic
1172102740 20:32495371-32495393 TGCGGTGCCGAAGATAGTCAAGG - Intronic
1172631901 20:36384207-36384229 CGTGGTGCTGAAGATAGAGAGGG + Intronic
1174356520 20:50001886-50001908 TATGGCCCTCAAGATTGACAGGG - Intergenic
1177890743 21:26800995-26801017 TGTGATCCTGCAGACAGACGAGG - Intergenic
1178156979 21:29866035-29866057 TTTGGTACTGATGATAAACATGG - Intronic
1178329138 21:31672027-31672049 GGGGGTCCTGAAGACAGAGACGG - Exonic
1179109340 21:38432952-38432974 AGTGGCCCTGAAGACAGTCATGG + Intronic
1180309416 22:11157401-11157423 TGTGTACCTGAACATAGAGAAGG - Intergenic
1180547893 22:16519212-16519234 TGTGTACCTGAACATAGAGAAGG - Intergenic
1182211567 22:28681159-28681181 TGTGTACCTGAACATAGAGAAGG + Intergenic
949148117 3:728956-728978 TGTTGTCCTGAACATTGTCAAGG + Intergenic
949713685 3:6902209-6902231 TGTGGACCTGAAGTAATACAAGG - Intronic
953433259 3:42856883-42856905 TGTGTTCCAGGAGAAAGACAGGG - Intronic
954380808 3:50218058-50218080 TGTGGTCCTGAATGTGGAGAGGG + Intronic
955193782 3:56786070-56786092 TGTGCTCCTGAGGACACACATGG - Intronic
956352862 3:68357271-68357293 TTTCTTCATGAAGATAGACAAGG - Intronic
960432814 3:117590569-117590591 TGTGTTCCTTAAGATTGTCAAGG - Intergenic
960732652 3:120743549-120743571 TCTGGTCTTAGAGATAGACATGG + Intronic
961859668 3:129905611-129905633 TTTGGTCCTGGAGAAACACAAGG - Intergenic
963307603 3:143670560-143670582 TGTGGCCCTGGAGAGAAACATGG + Intronic
963360162 3:144261952-144261974 TGTGTTCTTGAAGTTAGACATGG - Intergenic
964069305 3:152612315-152612337 TGTAAACCTGAAGAAAGACAGGG + Intergenic
965786449 3:172340195-172340217 TGTGGAACTGAAGAGAGAAACGG - Intronic
967216737 3:187217617-187217639 TGAGGTCGCGAAGTTAGACAAGG + Intronic
967565909 3:190971933-190971955 TGGGGTCCTGAAGGTAGGAAAGG + Intergenic
971187430 4:24393687-24393709 TGTGGTACTGACGACAGAAATGG - Intergenic
972145416 4:36018868-36018890 TGTTGTCTTGAAGGTAGATAGGG + Intronic
972569529 4:40297772-40297794 GGTGGTGCTCAAGATAGACATGG - Intergenic
974200545 4:58633727-58633749 TGTGGACCAGAAGAAAGAAAGGG + Intergenic
975423936 4:74204136-74204158 TGTGGTTAAGAGGATAGACATGG + Intronic
975652644 4:76609589-76609611 TCTGATCCTGAAGAGAAACATGG - Intronic
977824329 4:101512352-101512374 TGTTGTGTTGAAAATAGACATGG - Intronic
979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG + Intergenic
981830430 4:148993744-148993766 TATGATCCTGAAGAAACACAGGG + Intergenic
982898203 4:160961461-160961483 TGGGGTTCTGAAGATAGATGGGG + Intergenic
989392822 5:40920349-40920371 TGTGGATCTGAAGAAAGAGATGG + Intronic
992180735 5:74195839-74195861 TGTGGTCCTGAAGATGTGGATGG + Intergenic
992519561 5:77536645-77536667 TGTGGACCTAAACATAGAAAAGG - Intronic
993573957 5:89578441-89578463 TGTGATCATGGAGAGAGACATGG + Intergenic
993982879 5:94564149-94564171 TGTGGTATTCAAGATAGAAATGG - Intronic
997956886 5:138285793-138285815 TGTGGTCCTGATGATGCATAGGG + Exonic
998670718 5:144349893-144349915 TGTGGTTTTGAAGTTAGAGAAGG - Intronic
999098626 5:149004230-149004252 TTTGGTTCTGAAGAAAGAAATGG + Intronic
1001308784 5:170595531-170595553 GGTGGTCCTGGAGATGGGCAGGG - Intronic
1001754860 5:174160429-174160451 TCTGGAAATGAAGATAGACAAGG - Intronic
1002056790 5:176602673-176602695 CATGGTCCTAAAGATAGACCTGG + Intronic
1002056796 5:176602693-176602715 TGGGGTCCTGAAGATGGTCCTGG + Intronic
1002809505 6:613568-613590 TGTAGTCCTGAAGATGGTTATGG - Intronic
1003023920 6:2536602-2536624 TGTGGTCTTGAAGGTCGAGAGGG + Intergenic
1006166712 6:32069700-32069722 TGTGGTCCAGTACAAAGACAGGG - Intronic
1006977554 6:38117461-38117483 TGTGGTCAAGAAGAGAGAAAGGG - Intronic
1010442594 6:75914763-75914785 AATGGTCCTGAAGAGAGAGATGG + Intronic
1013276268 6:108587643-108587665 TGTGTTCCTGCAAACAGACAAGG + Intronic
1016751849 6:147639052-147639074 TGTGATTCTAAAGATAGACAAGG + Intronic
1017114890 6:150967297-150967319 GGTGCTCCTGAAGGAAGACAAGG - Intronic
1019292678 7:258143-258165 TGGGGTGCTGGAGATAGGCAGGG + Intronic
1019292687 7:258179-258201 TGAGGTGCTGGAGATAGGCAGGG + Intronic
1019292708 7:258251-258273 TGAGGTGCTGGAGATAGGCAGGG + Intronic
1020096786 7:5374100-5374122 TGTGGTCGAGAAGAAAGACTTGG - Exonic
1020254384 7:6494517-6494539 TGTTGTCTTGAAGACTGACAAGG + Intergenic
1020554003 7:9646443-9646465 TGTAGACCAGAAGATAGAGATGG - Intergenic
1021105240 7:16630966-16630988 TGTGTTCCTGAAGATTGAGTGGG - Intronic
1021254805 7:18377890-18377912 TTTGGTCCTGTAGATAGAGTAGG + Intronic
1021715234 7:23455663-23455685 CCTTGTCCTGAAGAAAGACATGG - Intronic
1022071877 7:26923831-26923853 TCTTGTCCTGAACATGGACATGG + Intronic
1023052373 7:36264292-36264314 TGGGGTCAGGACGATAGACATGG + Intronic
1026279921 7:68913266-68913288 TGTGGTGCTCCAGATGGACATGG - Intergenic
1028391552 7:90322213-90322235 GGTGGTCCTGCAGATAGAAGGGG - Intergenic
1031355869 7:120785637-120785659 TGTGGTCCTGGAGAGGGATAAGG - Intergenic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1033805857 7:144953575-144953597 TGGGGTCCTGAAGCTGCACAGGG + Intergenic
1034282794 7:149865453-149865475 TGTGGTTCTGAAGCTAGAGCAGG - Exonic
1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG + Intronic
1039404558 8:37301410-37301432 TGAGGGCCTGAGGATAGACATGG + Intergenic
1041789081 8:61671301-61671323 TATGGTACTAAAGATAGAAAAGG - Intronic
1042265820 8:66908400-66908422 TGTGGTCTTAAACATAGACTAGG - Intronic
1045024437 8:98073110-98073132 TGTGGGCCTGGAGTTAGACTGGG + Intronic
1045748161 8:105448941-105448963 TGTGGTTCTTAAGATCGCCAGGG - Intronic
1046830793 8:118743649-118743671 TTTGGTGTTGAAGATGGACAAGG + Intergenic
1047268814 8:123334958-123334980 TTTGGGCCTGAAGAAAGTCAGGG + Intronic
1048952119 8:139504994-139505016 TGTGCTCCTTAAGAAAGCCAGGG + Intergenic
1054818407 9:69497668-69497690 TGTTGTCCTGAAGAAAGAGCAGG - Intronic
1054913985 9:70479184-70479206 TCTGGTCCTGAAGTGAGAAAGGG + Intergenic
1060059866 9:120449415-120449437 GTTGGTGCAGAAGATAGACAAGG - Intronic
1187815755 X:23229957-23229979 TGTGGGCCTGAGGGTAAACAGGG + Intergenic
1188409485 X:29853502-29853524 TGTGGTTCTAAGGAGAGACAGGG - Intronic
1190922861 X:54872811-54872833 TGCGGGCTTGAAGATAGACAAGG - Intergenic
1194528706 X:95015746-95015768 TGTGCTTCTGAATATATACAAGG - Intergenic
1195199013 X:102529230-102529252 TGTGATCCTGAATTTAGCCATGG - Intergenic
1195611986 X:106877893-106877915 TGTAGTTCTGAAGACAGAAATGG - Intronic
1196410089 X:115409321-115409343 TGTGGTACTGGAGCAAGACATGG - Intergenic
1196668874 X:118345534-118345556 TGGGGTCCTTGAGATATACACGG - Intergenic
1199538228 X:148927950-148927972 TGTATTCCTGAAGATACAGATGG + Intronic
1199994195 X:153009474-153009496 TGTGGCTCAGAATATAGACAGGG - Intergenic
1200249126 X:154542818-154542840 TGTGTTTCAGAAGATACACATGG - Intronic