ID: 1079320628

View in Genome Browser
Species Human (GRCh38)
Location 11:19448542-19448564
Sequence CCCATGAAGAACCACGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079320628_1079320631 0 Left 1079320628 11:19448542-19448564 CCTGGCACGTGGTTCTTCATGGG 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1079320631 11:19448565-19448587 GAGACCATTTGCTATTTAGTCGG 0: 1
1: 0
2: 1
3: 9
4: 130
1079320628_1079320633 18 Left 1079320628 11:19448542-19448564 CCTGGCACGTGGTTCTTCATGGG 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1079320633 11:19448583-19448605 GTCGGACATTTTGTTTTACGAGG 0: 1
1: 0
2: 1
3: 1
4: 34
1079320628_1079320635 24 Left 1079320628 11:19448542-19448564 CCTGGCACGTGGTTCTTCATGGG 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1079320635 11:19448589-19448611 CATTTTGTTTTACGAGGTCTGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1079320628_1079320634 23 Left 1079320628 11:19448542-19448564 CCTGGCACGTGGTTCTTCATGGG 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1079320634 11:19448588-19448610 ACATTTTGTTTTACGAGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079320628 Original CRISPR CCCATGAAGAACCACGTGCC AGG (reversed) Intronic
902148772 1:14425537-14425559 CCCATGCATAACCAGTTGCCAGG - Intergenic
904774046 1:32895891-32895913 CCCAGGAGGCACCACGTACCAGG + Exonic
905389627 1:37628094-37628116 CCCATGCAGAGCCTCATGCCTGG - Intronic
909075470 1:71046946-71046968 CTGATGAAGCACCACGTCCCGGG + Exonic
912853515 1:113147309-113147331 CCCATGCAGAGCCCCCTGCCAGG - Intergenic
917740221 1:177954339-177954361 GCCATGAAGAACCACTTGTGGGG - Exonic
917929480 1:179813665-179813687 TCCATGGAGAACCTAGTGCCAGG - Intronic
919801108 1:201355120-201355142 CACACGCTGAACCACGTGCCAGG + Intergenic
920400435 1:205672864-205672886 CCCGTGAAGAAGCAACTGCCGGG - Intronic
923203916 1:231739623-231739645 CCCTTGAAGAACTCAGTGCCTGG - Intronic
1071889383 10:89986146-89986168 CCCCTGAAGAACCACATTCTGGG - Intergenic
1074510111 10:114104005-114104027 CCCTTGAAGAACCATGTTCAGGG + Intergenic
1077035104 11:490649-490671 CCCACCAGGAGCCACGTGCCCGG + Exonic
1078712931 11:13812842-13812864 CTCATGGAGAACCTCTTGCCAGG - Intergenic
1079320628 11:19448542-19448564 CCCATGAAGAACCACGTGCCAGG - Intronic
1082893440 11:58164387-58164409 GGAATGAAGAACCACGTGTCTGG + Intronic
1084441736 11:69178591-69178613 CCCATAAAGAATCCCTTGCCAGG + Intergenic
1103284753 12:119791364-119791386 CCCAAGAACATCCACATGCCAGG + Intronic
1106353621 13:28957986-28958008 ACCTTGAAAAACCACATGCCTGG + Intronic
1106498699 13:30307145-30307167 CCCATGATGCACCGCGAGCCTGG + Intronic
1108530262 13:51321574-51321596 TCCATGAAGATCCATTTGCCTGG + Intergenic
1109624644 13:64958792-64958814 TCCATGATGAACCACCTGCCTGG - Intergenic
1112506174 13:99977409-99977431 CCCATGAAGGACCACATGTGTGG - Intergenic
1113661349 13:112108214-112108236 CACATGAAGAACCTCCTGCTGGG - Intergenic
1114277417 14:21159279-21159301 CCCATGAGGAAACAAGTGGCTGG + Intergenic
1114277949 14:21164959-21164981 CCCATGAGGAAACAAGTGGCTGG - Intergenic
1116872911 14:50084736-50084758 GCCATGAAAGACCACGAGCCAGG - Intronic
1118615246 14:67570686-67570708 CACGTGAATAACCACGTGTCAGG + Intronic
1122996840 14:105269723-105269745 CCCATGAAGGCCCATGTCCCAGG + Intronic
1125593962 15:40872803-40872825 CCCATGAAAATCAAAGTGCCAGG + Exonic
1128578301 15:68791073-68791095 CCCTTGAAGACCCTCATGCCAGG + Intronic
1130461228 15:84159419-84159441 CCCATGAAGTACCATGTACATGG + Intergenic
1131149758 15:90039856-90039878 CCCATAAAGAAAAAAGTGCCTGG + Intronic
1132588741 16:717247-717269 CCCATGAAGAGGAAGGTGCCTGG - Exonic
1132945745 16:2530721-2530743 CCAGGGAAGAACCACCTGCCTGG + Exonic
1135176584 16:20235083-20235105 CCCAAGAAGATCCAAATGCCTGG - Intergenic
1136936573 16:34472772-34472794 CCCATGAACAAACACCTCCCAGG - Intergenic
1136963246 16:34875798-34875820 CCCATGAACAAACACCTCCCAGG + Intergenic
1137589820 16:49686730-49686752 CCCATAAAGACCCAAGTGACTGG + Intronic
1143763426 17:9121287-9121309 CCCATGAACCAGCACGTCCCCGG + Intronic
1144673123 17:17144086-17144108 CCCATGGAGAACCTGGTGCAAGG - Intronic
1152328846 17:79658771-79658793 CCGATGAATGAGCACGTGCCTGG - Intergenic
1153804402 18:8699829-8699851 CCCATGAAGAACCACTGGTCAGG + Intergenic
1160574299 18:79842034-79842056 CCCCTGCAGACCCAGGTGCCAGG + Intergenic
1160828423 19:1091420-1091442 CCCCTGGAGGACCCCGTGCCGGG + Intronic
1161085364 19:2332713-2332735 CAGAAGAAAAACCACGTGCCAGG - Intronic
1161411551 19:4120991-4121013 CCCCTCAAGAACCAGGTGTCAGG - Intronic
1161504955 19:4639077-4639099 CCCGTGCAGAACCACGTGGTTGG + Intergenic
1163019229 19:14473749-14473771 CCGATGAAGCACCACGTGCCCGG + Exonic
1163405179 19:17117475-17117497 ACCAGGAGGAACCACGTGTCGGG - Intronic
1164965443 19:32479295-32479317 CCCCTGATGAACCTGGTGCCTGG - Intronic
1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG + Intergenic
1167052146 19:47085764-47085786 GGGATGAAGGACCACGTGCCTGG + Intronic
1167782856 19:51611716-51611738 CACATCATGAACCAAGTGCCAGG + Intergenic
927554605 2:24023082-24023104 CCCACGAAGAAGCAGGTGGCGGG + Intronic
928262725 2:29782321-29782343 CCCATGAAGAAACTCATGCCTGG - Intronic
933524435 2:83417162-83417184 CCCATGAAGAACCATGGGACAGG + Intergenic
949055378 2:241925340-241925362 CCGATGTTGAGCCACGTGCCAGG + Intergenic
1173163844 20:40672144-40672166 CCCAGTAAGAACCTCCTGCCTGG + Intergenic
1174204119 20:48827254-48827276 CCCAGGAATAACTACGCGCCCGG - Intronic
1174574217 20:51525476-51525498 CCCAAGCAGCCCCACGTGCCTGG - Intronic
1180187163 21:46145634-46145656 CCCAGGAAGAGCCAGGGGCCCGG + Intronic
1180226816 21:46398479-46398501 CCTCTGGGGAACCACGTGCCAGG - Intronic
1183157693 22:36087821-36087843 GCCATAAAGAACTACGTGCCAGG + Intergenic
1183555506 22:38523359-38523381 ACCATGAAGAACCACCTGTAAGG - Intronic
1185069693 22:48649233-48649255 CCCAGGAAGAACCGTGGGCCAGG + Intronic
1185261465 22:49867342-49867364 CCCCTGAAGAAGCGTGTGCCAGG + Intronic
956401352 3:68883318-68883340 ACCATGAAGGAGCACGTGCAGGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961434435 3:126906862-126906884 CCAATGAAGAAGCACGTTCAGGG + Intronic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
975855338 4:78618332-78618354 GCCAGGAAGACCCAGGTGCCAGG + Intergenic
980234316 4:130085461-130085483 ACCATGAAGAACAGTGTGCCAGG + Intergenic
981529674 4:145740074-145740096 CCCTTGAAGATCCACGTGAACGG - Intronic
984597653 4:181689139-181689161 CACATGCAGAACCCCCTGCCTGG + Intergenic
985424462 4:189815278-189815300 CCCATGAAGAACCATAAGACAGG + Intergenic
991983401 5:72257516-72257538 CCCATGAAGATTCATGTGCATGG + Intronic
995764037 5:115596466-115596488 CCCATAAAGACCCATGTGCAGGG - Intronic
997411187 5:133692264-133692286 CCCAAGATGAGCCAAGTGCCTGG + Intergenic
999191657 5:149752402-149752424 CCCAGGAAGACCCAGCTGCCTGG + Intronic
1005115167 6:22328086-22328108 CCCATGAAGAACAATATCCCTGG - Intergenic
1015755411 6:136601064-136601086 GCCATGAATAAGCACGTGCTGGG + Intronic
1018834724 6:167474323-167474345 CCCATGAGCAGCCCCGTGCCAGG + Intergenic
1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG + Intronic
1019633438 7:2062642-2062664 CCCAGCAAGACCCTCGTGCCTGG - Intronic
1034414697 7:150958304-150958326 GCCATGGACAACCACGTGGCAGG - Exonic
1034866901 7:154649682-154649704 CCCATGAGGCCCCAGGTGCCAGG - Intronic
1035062736 7:156081205-156081227 CACAGGAAGAACCAAGTGCCAGG + Intergenic
1036062351 8:5337677-5337699 CAGATGAAGTACCATGTGCCTGG + Intergenic
1037120936 8:15286338-15286360 CCCATGGAGGGCCACGTGACTGG + Intergenic
1039431989 8:37532034-37532056 CCCAAGAAGGACCACGGCCCCGG - Intergenic
1040846517 8:51847780-51847802 TCCATTAAGAACCAAGGGCCAGG + Intronic
1041121872 8:54594027-54594049 ACCAAGAAGAACCAAGTTCCTGG - Intergenic
1041121881 8:54594096-54594118 ACCAAGAAGAACCAAGTTCCTGG - Intergenic
1041121890 8:54594165-54594187 ACCAAGAAGAACCAAGTTCCTGG - Intergenic
1041121899 8:54594234-54594256 ACCAAGAAGAACCAAGTTCCTGG - Intergenic
1041121908 8:54594303-54594325 ACCAAGAAGAACCAAGTTCCTGG - Intergenic
1044299473 8:90567046-90567068 CCCATGAAGACCCTGGTACCTGG + Intergenic
1048425536 8:134319714-134319736 CCAATGAGGAACCCAGTGCCTGG + Intergenic
1053033459 9:34803172-34803194 CCAATCAAGAATCACGTTCCAGG + Intergenic
1057445950 9:95114759-95114781 CCCATGAGGAACCACCTGCAGGG + Intronic
1060407488 9:123379994-123380016 CCCAGGAAGAGCCATGTGCCAGG + Exonic
1185914149 X:4016727-4016749 CCCAGGAAGAATCACGTTTCTGG - Intergenic
1186961497 X:14741554-14741576 CACAAGAAGCACCAAGTGCCAGG + Intergenic
1192324362 X:70119690-70119712 GCCCTGAAGAACCAGATGCCAGG + Intergenic
1194161041 X:90453020-90453042 CCCATGAAAAACAACATGGCAGG - Intergenic
1195625941 X:107005935-107005957 CCCATGCTGAACCAACTGCCAGG - Intergenic
1196566492 X:117210641-117210663 CCCCTGCAGATCCACATGCCAGG + Intergenic
1200507330 Y:4029950-4029972 CCCATGAAAAACAACATGGCAGG - Intergenic
1202378027 Y:24255725-24255747 CCCATGAAGTACCATGTACATGG - Intergenic
1202492755 Y:25414396-25414418 CCCATGAAGTACCATGTACATGG + Intergenic