ID: 1079321150

View in Genome Browser
Species Human (GRCh38)
Location 11:19452557-19452579
Sequence AGGATGTTTTCAACTCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 17, 3: 91, 4: 486}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079321150 Original CRISPR AGGATGTTTTCAACTCACAA TGG (reversed) Intronic
900559525 1:3296834-3296856 AGGATATTTTCAACTCGCAGTGG - Intronic
900729735 1:4248354-4248376 ATGATATTTTCAACTTGCAATGG + Intergenic
902065805 1:13685477-13685499 AGGATATTTTCAACTTAAAATGG + Intergenic
903588305 1:24434728-24434750 AGTATGTTTTCTGATCACAATGG + Intronic
903595797 1:24493385-24493407 ACGATATTTTCAACTTACAATGG + Intergenic
903746970 1:25593746-25593768 AGGATATTTTCAATTTACGATGG - Intergenic
904390647 1:30183501-30183523 AGAATATTTTCAATTTACAATGG - Intergenic
905350220 1:37340578-37340600 ATGATATTTTCAACTTACAATGG + Intergenic
905388811 1:37623196-37623218 AGGATGTTCTCAGCTCAGAGAGG + Intronic
907545441 1:55255755-55255777 AGGATATTTTCAACTTAGGATGG + Intergenic
908014008 1:59813741-59813763 AGCAAATTTTCAACTGACAAAGG + Intergenic
908382503 1:63609921-63609943 ATGATATTTTCAACTTACAATGG + Intronic
909541890 1:76800824-76800846 GAGATGTTTTCAACTCTGAAAGG - Intergenic
909657609 1:78048132-78048154 ATGATATTTTTGACTCACAATGG + Intronic
909903798 1:81172015-81172037 AGAATATTATCAAGTCACAAAGG - Intergenic
910103227 1:83600544-83600566 AGTATTTTTTCCACCCACAATGG + Intergenic
912878027 1:113382226-113382248 ACCATATTTTCAACTTACAATGG - Intergenic
913132871 1:115858028-115858050 AGTATCTTCTCAGCTCACAATGG - Intergenic
913305499 1:117426473-117426495 AGGATGTTTTCAATTTGCAATGG - Intronic
913833998 1:123297871-123297893 TGTGTGTTTTCAACTCACAGAGG + Intergenic
914789233 1:150862002-150862024 AGGATGTTTTCAATTTACAATGG + Intronic
915024887 1:152818387-152818409 AGGTTGTTTTCAGCTGGCAAGGG + Intergenic
915035593 1:152921309-152921331 GTGATATTTTCAACTTACAATGG + Intergenic
915806291 1:158856563-158856585 ATGATAGTTTCAACTCACAGTGG + Intergenic
916223748 1:162469271-162469293 CCGATGTTTTCAACTTACGATGG - Intergenic
916596960 1:166252967-166252989 ATGATATTTTCAATTTACAATGG + Intergenic
917582572 1:176393763-176393785 AGCATGTTCTCAAGCCACAATGG - Intergenic
918507275 1:185269923-185269945 AGGATGTTTTCAATTTACGATGG + Intronic
918668760 1:187185729-187185751 AAGGAGTTTTCAACTCAAAATGG + Intergenic
918725919 1:187923815-187923837 AGGCAGTCCTCAACTCACAATGG - Intergenic
918969081 1:191390219-191390241 AGTATCTTTTCCAATCACAATGG + Intergenic
919847886 1:201652842-201652864 ACAATATTTTCAACTTACAATGG - Intronic
921250983 1:213297859-213297881 ATGATCTTTTCACCTCCCAAAGG + Intergenic
921665699 1:217868369-217868391 AGGATATTTTCAATTTACAATGG - Exonic
923013581 1:230108402-230108424 AGGATATTTTCAACTTATGATGG - Intronic
923549506 1:234951709-234951731 AAGATATTTTCAACTTAGAATGG - Intergenic
923768382 1:236914234-236914256 AGGATATTTCCAACACACCATGG - Intergenic
923913651 1:238478582-238478604 AGGATATTTTCAACTTCCAGTGG + Intergenic
924074724 1:240321976-240321998 AAGATATTTTCAACTTATAATGG - Intronic
924868952 1:248019375-248019397 ACAATATTTTCAACTCATAATGG + Intronic
1063233358 10:4087807-4087829 AAAATATTTTCAACTAACAATGG + Intergenic
1063268998 10:4486103-4486125 AGGCTGTTGTCTCCTCACAAGGG - Intergenic
1063420394 10:5907849-5907871 AGTATCTTTTTAAATCACAATGG - Intronic
1064437278 10:15322160-15322182 AAGCTGTTTTCAACCCCCAATGG - Intronic
1065271663 10:24039324-24039346 AGGATTTTTTCACTTTACAATGG + Intronic
1065702796 10:28441988-28442010 GCGATGTTTTCCACTCACAGTGG + Intergenic
1066063290 10:31743327-31743349 AAGATATTTTCAACTTGCAATGG - Intergenic
1066133265 10:32415711-32415733 ACGATATTTTCAACTTACAATGG - Intergenic
1066821327 10:39494195-39494217 TGGGTGCATTCAACTCACAAAGG + Intergenic
1067469788 10:46528082-46528104 TGGATGTTTTCACCACAAAAAGG + Intergenic
1067841662 10:49685444-49685466 AAAATATTTTCAACTTACAATGG + Intronic
1068272483 10:54746964-54746986 ACAATATTTTCAACTTACAATGG + Intronic
1068625364 10:59240351-59240373 TTGATATTTTCAACTTACAATGG - Intronic
1071214388 10:83382857-83382879 AACATGTTTTCAACTCATACAGG - Intergenic
1071718860 10:88122965-88122987 AATATGTTTTCAACTCACTGAGG + Intergenic
1072020922 10:91400193-91400215 AGAATATTTTCAACTTACCATGG - Intergenic
1073713671 10:106076094-106076116 AGGATATTTTCAAGTTACAAAGG + Intergenic
1073906327 10:108284942-108284964 AGGATATTTTCAACTTACAATGG - Intergenic
1074466460 10:113686666-113686688 ATGATATTTTCAACTTACATTGG - Intronic
1074484475 10:113860828-113860850 ATGATATTTTCAACTTACCATGG - Intronic
1075144927 10:119874392-119874414 ATGATATTTTCAATTTACAATGG - Intronic
1077036849 11:499474-499496 AGGCTGTGGTCAACTCACAATGG + Intronic
1078489686 11:11757471-11757493 AGAAACCTTTCAACTCACAATGG + Intergenic
1078532458 11:12147825-12147847 AAGATGTTTTTAACTCCCCAGGG - Intronic
1078704649 11:13730586-13730608 AGCATGTTTTCAACACATTATGG - Exonic
1079321150 11:19452557-19452579 AGGATGTTTTCAACTCACAATGG - Intronic
1080644075 11:34175290-34175312 AGGATATTTTCAACTTACTATGG - Intronic
1080820840 11:35804991-35805013 AGAAATTTTTCATCTCACAAGGG - Intronic
1081520520 11:43877046-43877068 ATGATATTTTCAACTTACAATGG + Intergenic
1082186592 11:49189595-49189617 AGGATATTTTCAATTTATAATGG + Intronic
1083199485 11:61111567-61111589 AGGATGTTTTCAGCTTACAATGG - Intronic
1085334015 11:75677241-75677263 ACAATGTTTTCAATTTACAATGG - Intergenic
1085369346 11:75984492-75984514 ATGATACTTTCAACTTACAATGG + Intronic
1086184702 11:83999254-83999276 AGGATTTTTTCACCTACCAATGG - Intronic
1086679746 11:89655777-89655799 AGGATATTTTCAATTTATAATGG - Intergenic
1087248469 11:95869284-95869306 ATGGTATTTTCAACTTACAATGG + Intronic
1087317974 11:96626665-96626687 AGGATGTCTGGAACTCAGAAAGG + Intergenic
1087945425 11:104154502-104154524 GGGATGATTTCAAATCACAATGG + Intronic
1088241958 11:107782092-107782114 AGGAGGTTTTCAACTAAAGAAGG + Intergenic
1088544619 11:110947069-110947091 AGGATGTTTTCAAGAAAGAAGGG - Intergenic
1088961033 11:114664993-114665015 AGGATATTTTCAACTTATGATGG + Intergenic
1090297993 11:125607304-125607326 AAGATATTTTCAACTTAAAATGG + Intronic
1091082753 11:132687181-132687203 AGGAATTTTTCCACTCACCAGGG + Intronic
1091614697 12:2041150-2041172 AGTATGTTTTTAACCCAGAAAGG - Intronic
1093271296 12:17065520-17065542 ACGATATTTTCAATTTACAATGG - Intergenic
1093659735 12:21741461-21741483 AGTATCTTTTCTAGTCACAATGG - Intronic
1094002767 12:25713913-25713935 AGGAAGCTTTCAGCTCACAGTGG + Intergenic
1094007701 12:25772841-25772863 ATGGTATTTTCAACTTACAATGG - Intergenic
1094106995 12:26824039-26824061 AGAATATTTTCAACTTACAATGG - Intronic
1094503528 12:31041140-31041162 AGGAACATTTCAACTCACATGGG - Intergenic
1094645206 12:32316607-32316629 AGGATATTTTCAATTTACAATGG + Intronic
1094743514 12:33316106-33316128 ATGATATTTTCAACCTACAATGG - Intergenic
1095460590 12:42440463-42440485 AGTATGCTTTCAGATCACAATGG - Intronic
1095530227 12:43178427-43178449 AGGATATTTTGAACTTACAATGG - Intergenic
1095530229 12:43178474-43178496 ATGATATTTTGAACTTACAATGG + Intergenic
1096062669 12:48715269-48715291 AGGGTGTGTTCATCTCAAAATGG - Intronic
1097334617 12:58368405-58368427 TGGATGATTTCATCTCGCAAAGG - Intergenic
1098020413 12:66149691-66149713 ACGATATTTTCAACTTACAGTGG - Intronic
1098373688 12:69788847-69788869 AGAATCTTTTCCACTCACAATGG + Intronic
1098383540 12:69895105-69895127 CTGGAGTTTTCAACTCACAAGGG - Intronic
1098492327 12:71096190-71096212 GGGATAATTTCAATTCACAATGG + Intronic
1098869752 12:75803333-75803355 AGGATTTTCTCAACTCTCTAGGG + Intergenic
1099557972 12:84134067-84134089 ACAATATTTTCAACTTACAATGG + Intergenic
1100954799 12:99894955-99894977 ATGATGTTTTCAGTTTACAATGG + Intronic
1101799442 12:108007982-108008004 AGGATGGCTTCAACTGGCAAGGG - Intergenic
1102825042 12:115942004-115942026 AGAGTGTTTTCAACTTACGATGG + Intergenic
1104391580 12:128395484-128395506 AGAATATTTTCAATTTACAATGG - Intronic
1105051814 12:133060430-133060452 ACAATGTTTTCAACTTACAATGG - Exonic
1105791383 13:23802973-23802995 ATGATAGTTTCAACTTACAATGG + Intronic
1107511415 13:41089637-41089659 AGCATGCTTTCAGATCACAATGG - Intergenic
1107685521 13:42893834-42893856 ATAATGTCTTCAACTCACAATGG + Intronic
1107951942 13:45470976-45470998 AGGATATTTTCAACTTCCGAAGG + Intronic
1108199472 13:48028515-48028537 ATCTTGTTTTCAACTTACAATGG - Intergenic
1108994364 13:56707946-56707968 AGTATGTTTTCAACTCACTAGGG + Intergenic
1109153982 13:58881304-58881326 ATGATATTTTCAACTTACACTGG - Intergenic
1109401659 13:61838837-61838859 ACAATATTTTCAACTGACAAAGG + Intergenic
1109490046 13:63085885-63085907 AGGATATTTTAAATTTACAATGG - Intergenic
1109942552 13:69390056-69390078 AGGCTGTTTTCAACTAACACAGG - Intergenic
1110311109 13:74050234-74050256 AGGATGCTTTGAAATCCCAAAGG + Intronic
1110753698 13:79146296-79146318 AGGAGGTTATTAAGTCACAAGGG - Intergenic
1110779723 13:79450830-79450852 AGGAGGTTTTCAATTCTAAAAGG + Intergenic
1110972413 13:81781746-81781768 ATGAGGTTTTCCACTCACAGAGG - Intergenic
1112198063 13:97245205-97245227 TAAATGGTTTCAACTCACAAAGG + Intronic
1112608420 13:100930780-100930802 ATAATATTTTCAACTTACAATGG - Intergenic
1113256076 13:108507139-108507161 AAAATATTTTCAACTTACAATGG + Intergenic
1113886376 13:113661146-113661168 AGTATGTTCTCCAATCACAATGG + Intergenic
1114016832 14:18437937-18437959 AGAATGTTTTTCCCTCACAAAGG - Intergenic
1114018618 14:18455750-18455772 AGAATGTTTTTCCCTCACAAAGG - Intergenic
1114026761 14:18534681-18534703 TGAATGTTTTTACCTCACAAAGG + Intergenic
1115303082 14:31906003-31906025 AGGGTATTTTCAATTTACAATGG - Intergenic
1115343471 14:32317525-32317547 ACAATATTTTCAACTTACAATGG + Intergenic
1115494259 14:33986669-33986691 AGGTTGTTTTCTACTAACATAGG + Intronic
1116492754 14:45526066-45526088 AGTATCTTTTCCAATCACAATGG - Intergenic
1119193246 14:72698764-72698786 AGGATATTTTCAACTTATGATGG + Intronic
1119341113 14:73878818-73878840 AGGATATTTTCAACTAATGATGG + Intronic
1119611028 14:76062508-76062530 ACAATATTTTCAACTCACAATGG - Intronic
1120463459 14:84826238-84826260 AGGATCTTTTCAGATCCCAAAGG + Intergenic
1120473959 14:84963144-84963166 ACAATATTTTCAACTTACAATGG - Intergenic
1120929329 14:89832587-89832609 ACGATATTTACAACTTACAATGG - Intronic
1121070890 14:91019760-91019782 AGGATATTTTCAACTTATAATGG + Intronic
1121588870 14:95083889-95083911 AAGATATTTTCAACTTACGATGG + Intergenic
1122756131 14:103981612-103981634 TTAATGATTTCAACTCACAATGG - Intronic
1123727153 15:23114492-23114514 ATGATATTTTCAACTTACGATGG - Intergenic
1124685635 15:31779583-31779605 AGACTTTTTTCAACACACAAAGG - Intronic
1125214514 15:37255063-37255085 TTGCTATTTTCAACTCACAATGG - Intergenic
1125219448 15:37316936-37316958 AGTATGTTTTCAAATAGCAATGG + Intergenic
1126607306 15:50491299-50491321 AGGATGTGTTCAACTTACTTAGG - Intronic
1127095347 15:55507264-55507286 AGGATATTTTCAACTTATGATGG - Intronic
1127212717 15:56790795-56790817 AGGGTATTTTGAACTTACAATGG + Intronic
1127230960 15:56994345-56994367 AGGAAGATTTCAACTCACAATGG + Intronic
1127367890 15:58308826-58308848 AGGATATTTTCAACTTACAATGG + Intronic
1128129099 15:65213796-65213818 ATGATATTTTCAACTTACAGTGG - Intergenic
1128970843 15:72104330-72104352 ATGGTATTTTCAACTTACAATGG + Intronic
1129437381 15:75552688-75552710 ATGATATTTTCAACTTACGATGG + Intronic
1130288481 15:82574861-82574883 ATAATATTTTCAACTTACAATGG - Intronic
1130419687 15:83732420-83732442 TGTATGTTTTGAACTGACAAAGG - Intronic
1131729359 15:95262979-95263001 AGGTTGTTTTCATCTTGCAAAGG - Intergenic
1132009104 15:98258700-98258722 GGGATGTTTTAAATTCAGAAGGG - Intergenic
1132195027 15:99908280-99908302 AGGATGTTTTGACTTTACAATGG + Intergenic
1132581683 16:687598-687620 AGGATGTTCACAGCCCACAACGG - Exonic
1133089277 16:3390776-3390798 AGGAACTTCTCAACTCACAGAGG - Intronic
1133169857 16:3975682-3975704 AGAATGTTTTAAAGTCACATGGG - Intronic
1133596616 16:7299859-7299881 ATGATATTTTCAACTTACAATGG - Intronic
1133596618 16:7299906-7299928 AGGATATTTTCACCTTACCATGG + Intronic
1134237147 16:12475521-12475543 ACGATATTTTCAACTCACAATGG - Intronic
1135534476 16:23282542-23282564 AAGATATTTTCAACTCATGATGG - Intronic
1136019547 16:27431236-27431258 AGGATGCTTGCCACTCAGAAAGG - Intronic
1137679995 16:50333349-50333371 ATGATATTTTCAACTTACAGTGG - Intronic
1138326261 16:56172337-56172359 AGTATGTTTTCTAACCACAATGG - Intergenic
1138628251 16:58270195-58270217 ATGATATTTTCAACTTACAATGG - Intronic
1139274848 16:65718101-65718123 TGGCTGCTTTCAAGTCACAATGG + Intergenic
1140419357 16:74805293-74805315 AGTATGTTCTCTAATCACAATGG - Intergenic
1140432983 16:74920710-74920732 ATGATATTTTCAACTTACAATGG + Intronic
1140522094 16:75590503-75590525 AGGATGTTTCCATCTCCCAGAGG + Intergenic
1140666885 16:77235999-77236021 AGGATGTTTTGAAGTCATCAGGG + Intergenic
1140906325 16:79412396-79412418 AGGCTGTGTACTACTCACAATGG - Intergenic
1142543959 17:685626-685648 AGGATATTTTCAACTTACGATGG + Intronic
1142901436 17:3014498-3014520 ATGGTGTTGTCAACGCACAAGGG + Intronic
1143438864 17:6952349-6952371 ACGATATTTTCAACTTACAATGG + Intronic
1144445956 17:15329474-15329496 AGGATATTTTCAATTCTTAAAGG + Intronic
1145910305 17:28538493-28538515 ACGATGTTTCCCACTCACGATGG + Exonic
1147480680 17:40759666-40759688 AGAAAGTTGTCAAATCACAAAGG - Intergenic
1148290390 17:46442876-46442898 AGGATATTTTCAACTTACGATGG - Intergenic
1148312558 17:46660449-46660471 AGGATATTTTCAACTTACGATGG - Intronic
1149095188 17:52831576-52831598 ATTATGTTTTCAACATACAATGG + Intergenic
1149253905 17:54802256-54802278 ATGATATTTTCAACCTACAATGG - Intergenic
1151092319 17:71456492-71456514 ATGATATTTTCAACTTACGATGG + Intergenic
1151171794 17:72252835-72252857 AGGATGTATTAAACTCTCATGGG - Intergenic
1152402023 17:80072154-80072176 AGGATATTTTCAACTTACGATGG + Intronic
1153317053 18:3733583-3733605 AAGGTATTTTCAACTCACAATGG + Intronic
1154076745 18:11210804-11210826 AGGACATTTTCAATTTACAATGG + Intergenic
1154938061 18:21081164-21081186 AGTATCTTTTCCAATCACAATGG + Intronic
1155095614 18:22552557-22552579 GTGATGTTTTCATCACACAAAGG + Intergenic
1155456846 18:26025944-26025966 AGGATATTTTCAGCTTACAGTGG - Intronic
1155681026 18:28486437-28486459 AGCATGTTTTCCAGTCACAATGG + Intergenic
1156146583 18:34188430-34188452 ATAATATTTTCAACTTACAATGG - Intronic
1156282013 18:35648434-35648456 AAGATGTTTTCAACTTATGATGG + Intronic
1156615573 18:38780275-38780297 ATGATATTTTCAATTTACAATGG - Intergenic
1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG + Intergenic
1156956796 18:42976119-42976141 AGTATCTTTTCCAATCACAATGG - Intronic
1157564810 18:48672761-48672783 AGCATGTTCTCAACCCACAGAGG + Intronic
1157923175 18:51734510-51734532 AGGATTTATTCATCTCTCAATGG - Intergenic
1158094523 18:53755613-53755635 AGGATGTGTTTAAGTCATAAGGG - Intergenic
1158144707 18:54298998-54299020 ATGATATTTTCAATTTACAATGG - Intronic
1158828643 18:61253633-61253655 AGGATATTTTAAATTTACAATGG - Intergenic
1158828705 18:61254087-61254109 AGGATATTTTTAATTTACAATGG + Intergenic
1159347581 18:67226835-67226857 AGGATATTTTCAACTTATGAGGG + Intergenic
1163292711 19:16390924-16390946 AAAATATTTTCAACTTACAATGG - Intronic
1163395739 19:17059869-17059891 ACAATATTTTCAACTTACAATGG + Intronic
1164567313 19:29336425-29336447 TGACTGTTTTCAAGTCACAACGG + Intergenic
1166988387 19:46676064-46676086 ATGATATTTTCAATTTACAATGG + Intronic
1168578834 19:57536232-57536254 ACGATATTCTCAACTTACAATGG - Intronic
926427496 2:12752674-12752696 ATGATATTTTCAACTTACAATGG + Intergenic
926653954 2:15378493-15378515 ATGATATTTTCAACTTGCAATGG - Intronic
926977533 2:18530419-18530441 AGGATGTTTTCAATTTATGATGG + Intergenic
927614901 2:24583353-24583375 AGGATTATTTCACCTCAGAATGG + Intronic
928334051 2:30380849-30380871 ATGATATTTTCAACTTACAATGG + Intergenic
928615108 2:33030219-33030241 AGGATGTTCTTAACTCAGACGGG + Intronic
928995319 2:37283439-37283461 AGGATTTTCTTGACTCACAAGGG - Intronic
929421182 2:41791368-41791390 AGAATATTTTCACCTTACAATGG - Intergenic
929456567 2:42070406-42070428 ACAATATTTTCAACTTACAATGG + Intergenic
929586495 2:43118761-43118783 ATGATATTTTCAACTTACGATGG + Intergenic
930773048 2:55147000-55147022 ACGATATTTTCAACTTGCAATGG + Intergenic
930950888 2:57143609-57143631 ACAATATTTTCAACTAACAATGG - Intergenic
932621572 2:73267669-73267691 ATGATATTTTCAACTTACAATGG - Intronic
933271432 2:80237396-80237418 AGAATATTTTCAACTTACGATGG + Intronic
933406217 2:81863175-81863197 ACCATATTTTCAACTTACAATGG - Intergenic
934048231 2:88189384-88189406 AGGATATTTTCAACTTACGAAGG + Intergenic
934755504 2:96821656-96821678 AAGGTATTTTCAACTTACAATGG - Intronic
934848661 2:97681336-97681358 AGTATCTTTTCAGATCACAATGG + Intergenic
935709208 2:105882267-105882289 AAGATGTTTTTAGCTCACAGAGG + Intronic
936645899 2:114370417-114370439 TTGATGTTTTCAACTTACAGTGG - Intergenic
937018756 2:118631728-118631750 ACCATGTTTTCAACTTACAATGG + Intergenic
938153589 2:128908139-128908161 ATGATATTTTCATCTTACAATGG + Intergenic
938297491 2:130187494-130187516 AGGCTGTTTTCAACATTCAATGG + Intronic
938420612 2:131143203-131143225 ATGATGTTTTCAACTTATGATGG + Intronic
938705580 2:133921859-133921881 AGGATATTTTCAATTTACAATGG + Intergenic
939014648 2:136887757-136887779 AGTATGTTTTCATTTCTCAAAGG - Intronic
939080240 2:137651897-137651919 AGTATGTTTTCTGATCACAAGGG - Intronic
939524300 2:143273393-143273415 AAGATATTTTCAACTTACAAAGG - Intronic
939684253 2:145178064-145178086 ACCATATTTTCAACTCACAATGG - Intergenic
939703631 2:145424521-145424543 AGTATCTTTTCAAACCACAATGG + Intergenic
940118941 2:150240975-150240997 ACAATATTTTCAACTTACAATGG - Intergenic
940839133 2:158559106-158559128 AGGATCCTTACAACTCACACTGG - Intronic
941228382 2:162877757-162877779 ACAATGTTGTCCACTCACAATGG - Intergenic
941449928 2:165647903-165647925 ACAATATTTTCAACTTACAATGG + Intronic
942125933 2:172825116-172825138 ATGGTATTTTCAACTTACAATGG - Intronic
942585863 2:177476507-177476529 AGTATGTTCTCAAGCCACAATGG - Intronic
942594699 2:177581705-177581727 ACGATATTTTCAACTTACAATGG - Intergenic
943102301 2:183502613-183502635 AGTATCTTTTCTGCTCACAAGGG - Intergenic
943445083 2:187974744-187974766 ATGATATTTTCAACTTACAATGG + Intergenic
943591110 2:189797938-189797960 ACAATATTTTCAACTTACAAAGG - Intronic
943875275 2:193059749-193059771 AGAATGTCTTCAAACCACAAAGG - Intergenic
943887394 2:193238787-193238809 ACAATATTTTCAACTTACAATGG - Intergenic
943930428 2:193844104-193844126 AGAATGTTTTCAAGTTACTATGG - Intergenic
944032858 2:195258367-195258389 ATAATATTTTCAACTTACAATGG + Intergenic
944872010 2:203921650-203921672 GGGATATTTTCAACTTACAATGG + Intergenic
944974511 2:205033060-205033082 AGGCTGTTCTCAACTCACTGGGG + Intronic
945124377 2:206492152-206492174 AGGATGTTTTTATCCCACATAGG + Intronic
945172371 2:207010174-207010196 AGGATTTTTTCAACTTGCAGAGG + Intergenic
945898266 2:215509536-215509558 AGGATTTTTTCAACTTCCGATGG + Intergenic
945918961 2:215735794-215735816 ATGATGTTTTCAACTTATGATGG + Intergenic
945965742 2:216184835-216184857 AGTGTGTTATGAACTCACAAGGG - Intronic
946056397 2:216906058-216906080 AGGATTTTATCAACTCAGCAAGG - Intergenic
946340885 2:219067553-219067575 AGGATATTGTCAACTTACAGTGG - Intergenic
947735303 2:232451517-232451539 AACAGGTTTTCAACTCACCAGGG + Intergenic
948013614 2:234670178-234670200 AGGATTTTATCATCTTACAAGGG - Intergenic
948014972 2:234680920-234680942 ATGATATTCTCAACTTACAATGG - Intergenic
948018659 2:234712014-234712036 AGGATATTTTCAGCTTACGATGG - Intergenic
1168823719 20:794485-794507 AGGATGTTCTGAACTAAGAAAGG + Intergenic
1168837393 20:886538-886560 AGGACATTTTCAACTTACGATGG - Intronic
1169025881 20:2370909-2370931 AGAATGTTTCAAACTCTCAAGGG - Intergenic
1169625553 20:7564435-7564457 AGTTTGCTTTCAGCTCACAATGG - Intergenic
1169698517 20:8419688-8419710 ATAATATTTTCAACTTACAATGG + Intronic
1170025590 20:11885942-11885964 ATTATGTTTTCAACTTACGATGG - Intergenic
1170444768 20:16415036-16415058 AGGATATTTTCAGTTTACAATGG + Intronic
1170702833 20:18719080-18719102 TGTATGTTTTCAACTTACAATGG + Intronic
1170753760 20:19177681-19177703 AGCATGTTCTCAAACCACAAAGG + Intergenic
1171238543 20:23547081-23547103 TGGCTGCTTTCAACTTACAAAGG + Intergenic
1171445560 20:25201156-25201178 AGCATCTTTTCCAGTCACAATGG - Intronic
1172120335 20:32594716-32594738 ATGATATTTTCAACTTACAATGG - Intronic
1172859923 20:38040643-38040665 AGGAAGTTGTCAATTTACAAAGG - Intronic
1172910385 20:38404775-38404797 AAGATGTGTTCAACTCAATATGG - Intergenic
1173550408 20:43929304-43929326 TGGATGTTATCTACTCACCAGGG - Intronic
1173739458 20:45387443-45387465 AGTATGTTCTCAAACCACAATGG + Intronic
1173910883 20:46669876-46669898 AGGATATTTTCAACTTACAATGG + Intronic
1173938749 20:46892132-46892154 AGGATATTTTCAATTTACAATGG - Intergenic
1173974312 20:47175542-47175564 AGGATGTTGTGAATTCACACAGG + Intronic
1174318813 20:49724449-49724471 ACGGTATTTTCAGCTCACAATGG + Intergenic
1175359566 20:58398033-58398055 ATAATATTTTCAACTGACAATGG - Intronic
1175442918 20:59003514-59003536 ATGGTGTTTTCAACTTACGAGGG + Intronic
1175646118 20:60673266-60673288 AAGATATTTTCCATTCACAAAGG + Intergenic
1176228034 20:64014331-64014353 ATGATATTTTCAACTTACAATGG - Intronic
1177254413 21:18642128-18642150 ATGATATTTTCAACTCACCATGG - Intergenic
1177285904 21:19049461-19049483 AGAATTTTTTCAAATCATAAGGG - Intergenic
1177731167 21:25028187-25028209 AGAATATTTTCAATTTACAATGG + Intergenic
1178279849 21:31272017-31272039 AGGATATTTTCACCTTACAATGG - Intronic
1179159506 21:38881595-38881617 AGGACGTTTTATACTGACAAAGG - Intergenic
1179592639 21:42419691-42419713 AGAAGGTTTCCAACTTACAATGG + Intronic
1180015660 21:45081565-45081587 AGGATGTCTTCAACTTGCGATGG + Intronic
1180441337 22:15368810-15368832 AGAATGTTTTTCCCTCACAAAGG - Intergenic
1180443123 22:15386621-15386643 AGAATGTTTTTCCCTCACAAAGG - Intergenic
1180450896 22:15461876-15461898 TGAATGTTTTTACCTCACAAAGG + Intergenic
1180526932 22:16275944-16275966 TGGATGCATTCAACTCACAGAGG + Intergenic
1181915340 22:26275420-26275442 AAGATGTTTTCAATTTACAGTGG + Intronic
1182788431 22:32928006-32928028 AGGATATTTTCAGTTTACAATGG - Intronic
1182887976 22:33792243-33792265 AGGACGTAATCAAATCACAAGGG + Intronic
1183696427 22:39426164-39426186 ATGATATTTTCAACTTACAGTGG + Intronic
1185149936 22:49158646-49158668 ATGACATTTTCCACTCACAAGGG + Intergenic
949195226 3:1297598-1297620 GGGATGTTTTCAGCTAACACTGG - Intronic
949973507 3:9432803-9432825 AGTTTATTTTCTACTCACAAAGG + Intronic
950145650 3:10647913-10647935 AGGATGAATTCCACACACAATGG + Intronic
950316541 3:12005787-12005809 AGCATGTTTCCAACTTAGAATGG + Intronic
950732308 3:14971438-14971460 ATGACATTTTCAACTTACAATGG + Intronic
950878263 3:16298514-16298536 AGGCTGTTTGCAACTCCCACTGG - Intronic
951538646 3:23762018-23762040 TGCCTGTTTCCAACTCACAAGGG + Intergenic
951673052 3:25206067-25206089 ATGATATTTTCAACTTACAATGG + Intronic
952704006 3:36358512-36358534 AGGATGTTTTCAACACTGCAAGG + Intergenic
952850773 3:37726941-37726963 ATGATATTTTCAACTAACTATGG - Intronic
954406636 3:50348892-50348914 AGGATTTCTTCAACTCACAGTGG - Exonic
954493329 3:50929060-50929082 ATGATATTTTCAACTTACAGTGG + Intronic
954805287 3:53216004-53216026 AGTATGTTTTCTAACCACAATGG + Intergenic
956314015 3:67914200-67914222 AGAATAGTTTCAACTTACAATGG - Intergenic
956662016 3:71608441-71608463 AGGATGTTTTCAAATGAAAAAGG - Intergenic
956700426 3:71954104-71954126 CAGATGTTTGCAACTCATAATGG - Intergenic
957709137 3:83831506-83831528 TGCTTATTTTCAACTCACAATGG - Intergenic
957900703 3:86485179-86485201 AGGATGTTTTAAAATATCAATGG + Intergenic
957915376 3:86682153-86682175 TGGATGTTTTCAACTGGCCAAGG + Intergenic
958215341 3:90560221-90560243 TGTCTGTATTCAACTCACAAAGG - Intergenic
958403567 3:93723100-93723122 TGTCTGTATTCAACTCACAATGG - Intergenic
959146370 3:102550620-102550642 AGGATGTTTACAACAGACATGGG - Intergenic
959643341 3:108666689-108666711 AGCATGTTCTCAGGTCACAATGG + Intronic
960476359 3:118133851-118133873 AGGATATTTTTAACTTACAGTGG - Intergenic
961189646 3:124947634-124947656 ATGATGTTTTCAACTTATAATGG - Intronic
961316974 3:126044933-126044955 AGTATATTTTCCAATCACAAGGG + Intronic
962213538 3:133500192-133500214 AGGATGTTTGAGACTCTCAAAGG + Intergenic
962903168 3:139778292-139778314 AAGATATTTTCAACTTACAGTGG + Intergenic
963776739 3:149447552-149447574 TGTATGTTTTCAACACACAGTGG - Intergenic
964838332 3:160965614-160965636 AGGATATTTTCAATTTACAGTGG + Intronic
964966397 3:162498807-162498829 AGGATATTTTGAACTTACCATGG + Intergenic
965091197 3:164164117-164164139 ACTATATTTTCAACTTACAATGG + Intergenic
966518091 3:180842406-180842428 AGTATGTTTTCTAGGCACAATGG - Intronic
966805753 3:183806152-183806174 AGGATATTTTCAACTTACGATGG - Intronic
966805755 3:183806184-183806206 ATGATATTTTCAACTTACGATGG + Intronic
967698067 3:192556844-192556866 AGTATCTTTTCCAATCACAATGG + Intronic
967706804 3:192660629-192660651 AGAAAATTTTCAACTTACAAGGG + Intronic
967767271 3:193294740-193294762 AAAATGTTTTCAATTTACAATGG - Intronic
968110198 3:196039491-196039513 AGCATTTTTTCCAATCACAATGG - Intronic
968430052 4:551535-551557 AGGATATTTTCAACTGACAATGG - Intergenic
969201465 4:5609736-5609758 AGAATGTTTTCACCAAACAATGG - Intronic
970083094 4:12312175-12312197 AGTATGTTTTCTAATAACAATGG - Intergenic
970265685 4:14281976-14281998 AGGATATTTTTGACTAACAATGG + Intergenic
970268046 4:14311649-14311671 AGTATGTCTTCATCTCACACAGG - Intergenic
970363226 4:15331425-15331447 ATGATTCTTTCAATTCACAAAGG - Intergenic
970633115 4:17976000-17976022 ATGATGATATCAATTCACAAAGG - Intronic
970778484 4:19706434-19706456 ATGATATTATCAACTTACAATGG - Intergenic
972125172 4:35756286-35756308 AGGATGTTCTCTAACCACAATGG - Intergenic
972238820 4:37166318-37166340 ATGATATTTTCAACTTACAATGG + Intergenic
972716781 4:41654479-41654501 ACGATGTTTTCAATTTACAATGG + Intronic
973066574 4:45802084-45802106 ACTATGTTTTCAACTTACAATGG - Intergenic
973125571 4:46579917-46579939 GTGATGTTTTCACATCACAAGGG - Intergenic
973706146 4:53582620-53582642 AGCATGTTTCAAACACACAAGGG + Intronic
973764372 4:54149775-54149797 AGCATGTTGTCACCTCTCAATGG + Intronic
973882054 4:55282716-55282738 AGCATATTTTCTAATCACAATGG - Intergenic
973922219 4:55699302-55699324 AGGATGTCATGAACACACAATGG + Intergenic
973953934 4:56044260-56044282 GGGATATTTTCAACTTACAATGG - Intergenic
974221593 4:58980413-58980435 AGGATGTTTTCAAATATAAATGG + Intergenic
974295221 4:59989294-59989316 AAGATGTTTTCAAATTACAAGGG + Intergenic
974866128 4:67582977-67582999 ACGATATTTTCAACTTACAGTGG + Intronic
974894540 4:67923356-67923378 AGGGTGTTTGCAAGTCACAGAGG + Intronic
975608742 4:76182810-76182832 ACGATGTTTTCAACTTATGATGG - Intronic
975898637 4:79123383-79123405 AGGAGGTTTTTAAGTCATAAGGG + Intergenic
975926328 4:79458791-79458813 AGGATATTTTCAACTTACAATGG + Intergenic
976331753 4:83840011-83840033 ATGATATTTTCAACTTACAATGG + Intergenic
976662338 4:87552709-87552731 AGGATATTTTCAGCCTACAATGG + Intergenic
976684089 4:87791384-87791406 ATAATATTTTCAACTTACAATGG - Intergenic
977816585 4:101420282-101420304 AAGATATTTTCAACATACAATGG - Intronic
977962550 4:103102393-103102415 ACAATGTTTTCAATTTACAATGG - Intergenic
978521964 4:109625598-109625620 ATGATATTTTCAACTTACAGTGG + Intronic
978713330 4:111811612-111811634 AGGATATTTTTAAGACACAAGGG - Intergenic
979064661 4:116114427-116114449 AGTATGTTCTCCAATCACAATGG + Intergenic
979164492 4:117510357-117510379 ACAATATTTTCAACTTACAATGG - Intergenic
979279517 4:118849678-118849700 ATGATATTTTCAACTTACAATGG - Intergenic
980023146 4:127732653-127732675 AGAATGATATCAACTTACAAGGG - Intronic
980228788 4:130021258-130021280 AAGATATTTTCAACTTACAATGG + Intergenic
981101737 4:140836504-140836526 ATGATATTTTCAACTTACGATGG - Intergenic
981887297 4:149691676-149691698 AGGAGGTTTTCAAGTCAGATAGG + Intergenic
982215338 4:153078537-153078559 ATGATATTTTCAACTTACAACGG + Intergenic
982463976 4:155707277-155707299 AGGGTGTTTTCAAGTTACGATGG - Intronic
982754803 4:159205426-159205448 AGGATGTTTTCAACATATAGTGG - Intronic
983030017 4:162788375-162788397 AGGATGTTTTCAAAAAACACCGG + Intergenic
983790288 4:171788566-171788588 AGTATGTTCTGAACACACAATGG + Intergenic
984346558 4:178535458-178535480 ACAATATTTTCAACTTACAATGG - Intergenic
985360470 4:189170584-189170606 AGGATGTTCTCAAGTTAAAAAGG + Intergenic
986138224 5:5003507-5003529 AGGATGTTAAGAACACACAATGG + Intergenic
986805671 5:11306498-11306520 AGTATCTTTTCAACTGAAAATGG - Intronic
987940866 5:24534386-24534408 AGGATGGTATCAAGTCTCAATGG - Intronic
988633269 5:32953903-32953925 AGGAAACCTTCAACTCACAATGG - Intergenic
988650936 5:33150023-33150045 AAAATATTTTCAACTAACAATGG + Intergenic
988890328 5:35609643-35609665 AGTATGATTTAAACTCAGAAGGG - Intergenic
989677299 5:43986557-43986579 ATGGTGCTTTCAACTTACAATGG - Intergenic
990355984 5:54966587-54966609 ATGATATTTTCAACTTACAATGG - Intergenic
990643393 5:57814895-57814917 AGGAAGTTTTCATCTGCCAAGGG - Intergenic
991526337 5:67562654-67562676 ATGATATTTTCAACTTACAATGG + Intergenic
991687631 5:69196309-69196331 ACCATATTTTCAACTTACAATGG - Intronic
992441928 5:76804470-76804492 AGGATGTGTTCACCACACAGGGG - Intergenic
992476354 5:77105517-77105539 ATGATATTTTCAACTTACGATGG + Intergenic
992513042 5:77459892-77459914 AGGATATTTTCCACTTAGAATGG - Intronic
992523191 5:77577815-77577837 ATGATAGTTTCAACTTACAATGG - Intronic
992570583 5:78052665-78052687 AGGATATATTCAATTTACAATGG + Intronic
992598463 5:78370279-78370301 AAGATGTTTTTAAATCACAAGGG + Intronic
992962981 5:81973535-81973557 AAGATTTATTAAACTCACAATGG - Intronic
993247738 5:85472573-85472595 AGTATATTTTCAAAACACAATGG + Intergenic
993527750 5:88987455-88987477 AGGATATTTTCAACTTACCATGG - Intergenic
993527816 5:88988339-88988361 AGGATATTTTCAACTTAGCATGG + Intergenic
993764173 5:91834766-91834788 AGGATGTAATCAACTCCCAGAGG - Intergenic
993862976 5:93158779-93158801 TGGATCTTTTCCACTCACATGGG - Intergenic
994902205 5:105788711-105788733 ATGATATTCTCAACTTACAATGG + Intergenic
995068662 5:107891924-107891946 ACGATATTTTCAACTTACGATGG - Intronic
995252413 5:110008800-110008822 ATGATATTTTCAACTTGCAATGG + Intergenic
995689736 5:114811809-114811831 AGGAAGTTTTCAAAGCAGAAGGG + Intergenic
995741119 5:115356776-115356798 ATGATATTTTCAACTTACAATGG + Intergenic
995805632 5:116049016-116049038 ATGATATTTTCAATTTACAATGG + Intronic
996643244 5:125783909-125783931 AGTATGTTCTCAGATCACAATGG - Intergenic
996667913 5:126081973-126081995 AGAATATTATCAAATCACAAAGG + Intergenic
996681660 5:126234138-126234160 AAGTTGTTTTCTACTCATAAGGG - Intergenic
996681761 5:126235483-126235505 AAGTCGTTTTCTACTCACAATGG - Intergenic
996966784 5:129315944-129315966 AGCATGTCTTTACCTCACAAAGG + Intergenic
997109017 5:131053944-131053966 ATGATATTTTCAACTTACAATGG + Intergenic
997400798 5:133600346-133600368 ATGATATTTTCAACTTACAGTGG + Intronic
997436488 5:133879460-133879482 AGGATGATTTCATCTCAAGATGG + Intergenic
998356691 5:141543722-141543744 ACAATATTTTCGACTCACAATGG + Intronic
998575640 5:143312615-143312637 AAGATATTTTCAATTCACAATGG + Intronic
998588774 5:143455369-143455391 AGAATGTTTTCAATTTACCATGG - Intergenic
998942375 5:147298455-147298477 AGAATGATTCCAACTGACAATGG - Intronic
999054454 5:148558932-148558954 ACAATGTGTTCAACTTACAATGG - Intronic
1001416389 5:171547379-171547401 ATCATGTTTACAACTCACAGTGG - Intergenic
1002681093 5:180965145-180965167 AAGATGTATACAACACACAATGG + Intergenic
1002826966 6:782885-782907 ATGATATTTTCAACTTACAATGG + Intergenic
1002910259 6:1485652-1485674 ATGATATGTTCAACTTACAATGG + Intergenic
1003350245 6:5310119-5310141 AGTAGGTTTTCAAATCACTAGGG + Intronic
1003695134 6:8398120-8398142 AGGATATTTTCAACTTATGATGG - Intergenic
1003843369 6:10146454-10146476 ATGATATTTTCAACTTACGATGG + Intronic
1004033145 6:11892822-11892844 ACAATATTTTCAACTTACAATGG + Intergenic
1004437288 6:15608617-15608639 AGGATGTGCTCCACACACAAGGG - Intronic
1004827357 6:19437460-19437482 AGGATATTTTCAACTTAGTATGG - Intergenic
1004970653 6:20906494-20906516 TAGATATTTTCAACTTACAATGG - Intronic
1006569124 6:34985957-34985979 ATGAGATTTTCAACTTACAATGG - Intronic
1007516078 6:42412451-42412473 AGGAGGTTTGCAGCTCACACAGG + Intronic
1007983385 6:46182554-46182576 ATGATATTTTCAACTTATAACGG - Intergenic
1009970672 6:70622484-70622506 ATGATATTTTCAACCTACAATGG - Intergenic
1010114521 6:72286764-72286786 GGGAAGTTATCAACTCTCAAAGG - Intronic
1010607033 6:77903500-77903522 ACAATATTTTCAACTTACAATGG + Intronic
1010690803 6:78909247-78909269 AGGATATTTTCAACTTATAATGG - Intronic
1011096347 6:83668891-83668913 ATAATATTTTCAACTCACAGTGG - Intronic
1011563042 6:88643032-88643054 ATGATATTTTCAACTTACAGTGG - Intronic
1011833045 6:91396564-91396586 ACAGTATTTTCAACTCACAATGG + Intergenic
1012354815 6:98300794-98300816 AGGAAGTTCTCAACTCAAATTGG - Intergenic
1012755110 6:103220279-103220301 AGTATGTTCTCAGCCCACAATGG + Intergenic
1013631114 6:111986956-111986978 ATGATATTTTTAACTTACAATGG - Intergenic
1013758720 6:113491026-113491048 ATGATATTTGCAACTTACAATGG - Intergenic
1014473045 6:121839335-121839357 ATGATATTTTCAATTTACAATGG - Intergenic
1015179097 6:130343311-130343333 AGGATGCTTTCTAGTCACATAGG + Intronic
1016408280 6:143754971-143754993 AGGATGATTTTAAGTTACAATGG - Intronic
1016697254 6:147011248-147011270 AGTATGGTTTCTAATCACAATGG + Intergenic
1017019467 6:150128619-150128641 AGAACGTTTTCCACTCAAAAAGG + Intergenic
1018234039 6:161705197-161705219 ATGATATTTTCAAGTTACAATGG - Intronic
1018537914 6:164842175-164842197 ACAATATTTTCAACTTACAATGG - Intergenic
1019129948 6:169866110-169866132 AGGGTGTCTTCAATTCAAAATGG + Intergenic
1020064809 7:5179639-5179661 ATGATATTTTCAACTTAAAATGG - Intergenic
1020827689 7:13051861-13051883 ATGATATTTTCAATTTACAATGG - Intergenic
1021147916 7:17111799-17111821 AGGAGGCTTCCAAGTCACAATGG - Intergenic
1021198174 7:17695682-17695704 AGGATATTTTCAACTTATGATGG + Intergenic
1021310195 7:19085442-19085464 AGTATGTTCTCTAATCACAATGG + Intronic
1022170161 7:27819662-27819684 AGGATATTTTCAGCTTACAGTGG + Intronic
1023116492 7:36867850-36867872 AGTATGTTCTCAAATCACAATGG - Intronic
1023241939 7:38157936-38157958 AGGATCTTTTCAGAACACAAAGG + Intergenic
1023537302 7:41226879-41226901 AGGATATTTTCAACTTATGATGG + Intergenic
1023910378 7:44551334-44551356 AGTATATTTTCCAGTCACAATGG + Intergenic
1024191633 7:47017544-47017566 AGTATGTTTTCACCTCACCAAGG - Intergenic
1024753089 7:52492495-52492517 AGGATATTTTCAACTTACAATGG + Intergenic
1025245208 7:57311936-57311958 ATGATATTTTCAACTTACAGTGG + Intergenic
1025501549 7:61307187-61307209 TGTATGTTTTCATCTCACACAGG - Intergenic
1025516412 7:61653410-61653432 TGTATGTTTTCATCTCACAGAGG - Intergenic
1025540747 7:62082236-62082258 TGTATGTTTTCATCTCACAGAGG - Intergenic
1026402328 7:70027152-70027174 TTGATATTTTCAACTAACAATGG + Intronic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1028734983 7:94198698-94198720 ATGACATTTTCAACTCACATGGG + Intergenic
1029140429 7:98405910-98405932 ATGATGTTTTCAACTTACAATGG + Intergenic
1029155933 7:98518170-98518192 AGAATGTTCTCAGCTCACACGGG - Intergenic
1030225977 7:107151563-107151585 ATGATATTTTCAACTCACAATGG - Intronic
1031073402 7:117188274-117188296 AGGCTGTTTTCAACTTAGAAAGG - Intronic
1031616226 7:123884232-123884254 AGTATGTTCTCCAGTCACAATGG + Intergenic
1032072971 7:128820926-128820948 AGGATGGTTTCAAGTAAAAATGG - Intronic
1032139919 7:129319006-129319028 AAAATATTTGCAACTCACAAAGG + Intronic
1033489751 7:141831180-141831202 ATGATATTTTCAACTCACAATGG - Intergenic
1035012840 7:155735034-155735056 ACGATGTTTGCAACTTACAGCGG - Intronic
1035194352 7:157203844-157203866 ATGATATTTTCAACTTACAATGG - Intronic
1035440524 7:158893360-158893382 ACGATACTTTCAACTCACTATGG - Intronic
1035882684 8:3259144-3259166 AGAATGTTTTCAGCTCAATATGG - Intronic
1036464707 8:8985732-8985754 ATGATATTTTCAACTTACGATGG - Intergenic
1036554795 8:9849029-9849051 TCGACGTTTTCAACTTACAATGG - Intergenic
1037079923 8:14772264-14772286 AGTATATTTTCAACTCATAATGG + Intronic
1037233367 8:16687364-16687386 ATGATATTTTCAACTTACCATGG + Intergenic
1037406741 8:18550503-18550525 ACGATATTTTCAACTTAGAATGG - Intronic
1038222024 8:25618629-25618651 AGTATATTTTCCAATCACAATGG + Intergenic
1038279040 8:26146892-26146914 ATCATATTTTCAACTTACAATGG + Intergenic
1038641164 8:29329906-29329928 ACGATATTTTCAATTTACAATGG - Intergenic
1039705828 8:40006435-40006457 ATGATATTTTCAACTTACATTGG + Intronic
1040272638 8:45971701-45971723 AGCATGCATTCAACTCACAGAGG + Intergenic
1040821761 8:51567121-51567143 AGTATGTTCTCAAACCACAATGG - Intronic
1040829024 8:51657012-51657034 ACAATGTTTTCAACTTACAGTGG - Intronic
1041049703 8:53921846-53921868 AGTATGTTTTCCAAACACAATGG - Intronic
1041188803 8:55331297-55331319 AGCATCTTTTCTAATCACAATGG - Intronic
1041694315 8:60719741-60719763 CGGATTTTCTCATCTCACAATGG - Intronic
1042062258 8:64833779-64833801 AGTGTGTTTTCAAACCACAATGG - Intergenic
1042088190 8:65131554-65131576 AGGATGTCTTGAACTAAGAAAGG - Intergenic
1042207926 8:66347611-66347633 AGAGTGATTTCAACTTACAATGG - Intergenic
1043557719 8:81452326-81452348 AGAATATTTTCTACTTACAAGGG + Intergenic
1043711207 8:83421203-83421225 ACAATATTTTCAACTTACAATGG + Intergenic
1043725767 8:83609132-83609154 AGGATGTTTTGAACCCAAAATGG - Intergenic
1043726053 8:83611644-83611666 AGCATGTTGTCACCTCTCAAAGG + Intergenic
1043727751 8:83631574-83631596 ACTATATTTTCAAATCACAATGG - Intergenic
1044574609 8:93754629-93754651 ATGATATTTTCAACTTACGATGG + Intergenic
1047523284 8:125612128-125612150 TGGATGTTTTCAACACAAGATGG + Intergenic
1047730870 8:127727033-127727055 GGGATGGTTTAAACTCTCAAGGG + Intergenic
1047883616 8:129223515-129223537 ACGGTGTTTTCAACTGACACTGG - Intergenic
1048640173 8:136348614-136348636 AGGATATTTTCAATTTTCAATGG + Intergenic
1048670846 8:136717936-136717958 TGGTTGTTTTAAATTCACAAAGG - Intergenic
1048820267 8:138373894-138373916 AAGATGTTATCAAATGACAATGG + Intronic
1049517505 8:143069054-143069076 GGGCTGTTTTCAACTCACCAAGG + Intergenic
1050440618 9:5659390-5659412 ATGGTATTTTCAACTTACAATGG - Intronic
1051706354 9:19884906-19884928 AGGATTTTTTCAACTTACGATGG + Intergenic
1052256165 9:26459316-26459338 AAGATGTTTGCATCTGACAATGG - Intergenic
1052478042 9:28986658-28986680 ATGATATTTTCAATTAACAATGG - Intergenic
1052704518 9:31979130-31979152 AGAAAATTTTCAAATCACAAAGG - Intergenic
1053211084 9:36229003-36229025 AGAATGTTTTATACTCACCAAGG + Exonic
1055307641 9:74946379-74946401 ATGATATTTTCAACTTACGATGG - Intergenic
1055396610 9:75882696-75882718 ATGGTATTTTCAACTTACAATGG + Intergenic
1056033285 9:82576666-82576688 AGTATCTTTTCCAATCACAATGG + Intergenic
1056243720 9:84672983-84673005 AAGAGGTTTTCAAATCAAAAGGG - Intronic
1056660926 9:88542683-88542705 ATCATGTTCTCAAGTCACAAAGG - Intronic
1056753795 9:89369834-89369856 AGGATCGTTTCAACTCACAGTGG - Intronic
1057348511 9:94274568-94274590 ACAATATTTTCAACTTACAATGG - Intronic
1057369840 9:94461170-94461192 ATGATATTTTCAACTTACAATGG - Intergenic
1057535077 9:95894002-95894024 ATAATATTTTCAACTTACAATGG - Intronic
1057540400 9:95962818-95962840 ATGGTGTTTTCAACTTACAATGG + Intronic
1057815517 9:98291086-98291108 ACGATATTTTCAACTTACAATGG - Intronic
1058794029 9:108479951-108479973 AGGATATTTTCAACTTATGATGG - Intergenic
1058990869 9:110254975-110254997 AGGATCTTTTCAACACATGAGGG + Intronic
1059561218 9:115336315-115336337 AGGATGTTTTCTGCTCTCACGGG + Intronic
1059725505 9:117004577-117004599 AGGATTTCTTCACCTCTCAATGG - Intronic
1203494344 Un_GL000224v1:136714-136736 TGAATGTTTTTAACTCACATAGG + Intergenic
1203342085 Un_KI270429v1:844-866 TGCATGTATTCAACTCACAGAGG + Intergenic
1203506963 Un_KI270741v1:78589-78611 TGAATGTTTTTAACTCACATAGG + Intergenic
1185653267 X:1664592-1664614 AGGATCTTTTCAACTTACAATGG + Intergenic
1185875209 X:3696350-3696372 ACCATATTTTCAACTTACAAAGG - Intronic
1186044358 X:5518965-5518987 TGGATATTTTCAACTTACAATGG - Intergenic
1187001177 X:15180156-15180178 ATAATATTTTCAACTTACAATGG - Intergenic
1187039605 X:15579881-15579903 TGGCTGTTTTCATGTCACAAAGG + Intronic
1187504588 X:19868635-19868657 AGGATATTTTCAACTCACGATGG - Intronic
1187504591 X:19868682-19868704 AGGATATTTTCAACTCACGATGG + Intronic
1187546402 X:20256963-20256985 TGGATGTTCTCAACTCAAACAGG + Intronic
1187948143 X:24446490-24446512 AGGATGTTTTCAATTCAACAAGG + Intergenic
1188563768 X:31500856-31500878 AGGATTTTCTCATCTAACAAAGG - Intronic
1188587344 X:31793481-31793503 ATGATGTTTTCAACTTATGATGG - Intronic
1188625581 X:32280564-32280586 AGGATGCTGACAACTCACGAAGG - Intronic
1188964913 X:36539026-36539048 ATGATATTTTCAATTTACAATGG - Intergenic
1190120177 X:47652608-47652630 AGGATGTGTTCCACACACAAGGG + Intronic
1191102328 X:56744958-56744980 AGGAAGTTTTCAACTTAATAAGG - Intergenic
1192731029 X:73802848-73802870 AGGATGTTTTAGGCTCATAAGGG + Intergenic
1193103939 X:77647074-77647096 AGTATCTTTTCCAGTCACAAGGG + Intronic
1193198810 X:78664092-78664114 ATGATATTTTCAACTTACAATGG - Intergenic
1193339320 X:80328162-80328184 AGGATATTTTTAACTTACAGTGG - Intergenic
1194016820 X:88632233-88632255 AAGATGTTATCAGCTGACAATGG + Intergenic
1194362602 X:92972466-92972488 ATTATCTTTTCAAATCACAATGG - Intergenic
1194464689 X:94218990-94219012 AGGATGGTTTCCACTGATAAAGG + Intergenic
1195026720 X:100884800-100884822 AAGGTGTCTGCAACTCACAAGGG + Intergenic
1195383333 X:104291148-104291170 AGGATGTTGTCCATTCACCATGG - Intergenic
1195526951 X:105902245-105902267 AGGAGATTTGGAACTCACAAAGG + Intronic
1195786060 X:108524835-108524857 AGCATGTTTTCCAACCACAATGG - Intronic
1196014371 X:110921882-110921904 AAGATATTTTCAATTTACAATGG - Intergenic
1196087593 X:111702012-111702034 AGCATCTTTTCAGATCACAATGG - Intronic
1196226559 X:113174917-113174939 AGGACATTTTCAACTTACAATGG + Intergenic
1197012624 X:121585361-121585383 ACGATATTTTCTACTTACAATGG + Intergenic
1197574050 X:128186266-128186288 AGTATGTTTTCTGATCACAATGG - Intergenic
1197928688 X:131673395-131673417 CTGATATTTTCAACTTACAATGG - Intergenic
1197960355 X:131998274-131998296 ATGATATTTTCAACTTACAATGG + Intergenic
1198473300 X:136970670-136970692 ACGATATTTTCAACTTACAGTGG + Intergenic
1199249432 X:145642936-145642958 AGTATATTTTCAAATCAGAAAGG - Intergenic
1200359677 X:155591469-155591491 AGCATGTTCTCTAATCACAATGG + Intronic
1200670856 Y:6088686-6088708 ATTATCTTTTCAAATCACAATGG - Intergenic
1202225422 Y:22598381-22598403 AGGTTTTTTTTAACTCAGAAAGG + Intergenic
1202317691 Y:23597280-23597302 AGGTTTTTTTTAACTCAGAAAGG - Intergenic
1202553075 Y:26072778-26072800 AGGTTTTTTTTAACTCAGAAAGG + Intergenic