ID: 1079322126

View in Genome Browser
Species Human (GRCh38)
Location 11:19459872-19459894
Sequence CTTAGGATGATTAATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079322123_1079322126 23 Left 1079322123 11:19459826-19459848 CCACAGAATGTTTTTGAGCAAGA 0: 1
1: 0
2: 3
3: 42
4: 389
Right 1079322126 11:19459872-19459894 CTTAGGATGATTAATACTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079322126 Original CRISPR CTTAGGATGATTAATACTGC AGG Intronic
907207632 1:52787900-52787922 TTGAGAATGATTAATTCTGCTGG + Intronic
911293501 1:96085408-96085430 ATTAGGATGATTAAGAGTGGTGG - Intergenic
915725624 1:158014974-158014996 CTTGGGAAGATTAAGCCTGCTGG - Intronic
915952203 1:160197017-160197039 CTGAGGTTGAATAATCCTGCCGG + Intronic
919197821 1:194311588-194311610 TTTAGGATGATTCATCCGGCAGG - Intergenic
920237818 1:204520486-204520508 TTCAGGATGATTATTATTGCAGG + Intronic
921016087 1:211192161-211192183 CTGAGCATGATTAAGACTTCCGG - Intergenic
924818826 1:247467871-247467893 CTTGTTATAATTAATACTGCAGG - Intergenic
1067679482 10:48420882-48420904 CTTAGGTTGATTGATACAACTGG - Intronic
1068562425 10:58530306-58530328 CTGAGGATGACTACTACTTCTGG + Intronic
1068958328 10:62841586-62841608 CTTAGGCAGATTAATTCAGCTGG - Intronic
1070239068 10:74659959-74659981 CTTGTGATGGTTAATACTGAGGG - Intronic
1071257519 10:83885228-83885250 TTTAGCATGATAAATACTGCAGG + Intergenic
1078884161 11:15483315-15483337 ACTAGTATGATTAATACTGTGGG + Intergenic
1079322126 11:19459872-19459894 CTTAGGATGATTAATACTGCAGG + Intronic
1081589899 11:44414858-44414880 TTTGTGATGATTAATACTGAGGG + Intergenic
1084744854 11:71163147-71163169 CTTAAAATGTTTAATACTGATGG + Intronic
1085961558 11:81468415-81468437 CTTAGGATTTTGAATATTGCTGG + Intergenic
1086533687 11:87816493-87816515 ATTAGGATTATTAATAGAGCTGG + Intergenic
1088166142 11:106939893-106939915 CTGGGGATGATTAAGGCTGCAGG - Exonic
1089285973 11:117408437-117408459 CTTAGGTGGAGTAACACTGCAGG + Intronic
1092551886 12:9511435-9511457 CTCAGGATGATTAATTCTATGGG + Intergenic
1094688285 12:32742658-32742680 ATAAGGATGATTTATACAGCTGG - Exonic
1098312531 12:69161965-69161987 GTTATGATGATTTATACTCCAGG - Intergenic
1100716913 12:97315661-97315683 CTTATGATAGTTAATACTGATGG - Intergenic
1104267422 12:127247696-127247718 ATTAGGTTAAATAATACTGCAGG + Intergenic
1106662806 13:31819412-31819434 CCTAGGTTTATTAATTCTGCTGG - Intergenic
1108893136 13:55287985-55288007 CTTATCAAGTTTAATACTGCTGG - Intergenic
1109390886 13:61691232-61691254 CTCAGTATGATTAATACTCAGGG + Intergenic
1110744198 13:79033440-79033462 CTCAGGATGATTAAACCTGATGG - Intergenic
1111363316 13:87206651-87206673 CTTGTGATGGTTAATACTGAGGG - Intergenic
1113155875 13:107321191-107321213 ATTAGGATGTTTAATATTGATGG - Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1114783025 14:25560842-25560864 CTTGGAAAGATTAATACTCCTGG - Intergenic
1116033252 14:39598061-39598083 CTCAGGATGATTAATAATTGAGG - Intergenic
1120242870 14:81970409-81970431 CTCAGCATGATTAACACTGGGGG - Intergenic
1202836611 14_GL000009v2_random:82098-82120 CTTATGATGCTTAATTTTGCTGG - Intergenic
1123496471 15:20832147-20832169 CTTATGATGCTTAATTTTGCTGG + Intergenic
1123553707 15:21405737-21405759 CTTATGATGCTTAATTTTGCTGG + Intergenic
1123589951 15:21843102-21843124 CTTATGATGCTTAATTTTGCTGG + Intergenic
1202962052 15_KI270727v1_random:132933-132955 CTTATGATGCTTAATTTTGCTGG + Intergenic
1134188386 16:12101687-12101709 CATAAGATGATTAAAACTGGGGG - Intronic
1138718574 16:59052438-59052460 CTTAGGCTGATTAATAGTTATGG + Intergenic
1154454386 18:14507830-14507852 CTTATGATGCTTAATTTTGCTGG + Intronic
1161641286 19:5425008-5425030 TTCAGGATGATTAAAGCTGCAGG - Intergenic
1165961246 19:39536435-39536457 CTTAGGATTCAAAATACTGCAGG + Intergenic
1202636025 1_KI270706v1_random:45264-45286 CTTATGATGCTTAATTTTGCTGG + Intergenic
926671250 2:15578844-15578866 CATTGGATGATTAATACATCAGG + Intergenic
931123730 2:59250308-59250330 CTTGGGATGGTTTATGCTGCAGG - Intergenic
933167518 2:79092693-79092715 TTTAGGATGATTTAAAATGCTGG - Intergenic
933719845 2:85390923-85390945 CTTCGGATGAGTGAGACTGCAGG - Exonic
936341937 2:111641400-111641422 CTTAAGATGATTAATTTTGTTGG - Intergenic
938282037 2:130071286-130071308 CTTATGATGCTTAATTTTGCTGG + Intergenic
938332662 2:130459858-130459880 CTTATGATGCTTAATTTTGCTGG + Exonic
938357146 2:130660813-130660835 CTTATGATGCTTAATTTTGCTGG - Intergenic
938433580 2:131267619-131267641 CTTATGATGCTTAATTTTGCTGG - Intronic
941719972 2:168802260-168802282 AAAAGCATGATTAATACTGCAGG + Intronic
949047999 2:241881000-241881022 TTTAGGGTGAATTATACTGCTGG - Intergenic
1169565903 20:6853269-6853291 TTTAGGATGATTAATCACGCAGG + Intergenic
1171882174 20:30626325-30626347 CTTATGATGCTTAATTTTGCTGG + Intergenic
1174998142 20:55595663-55595685 CTTAGGATTTTAAATACTGACGG - Intergenic
1176819783 21:13645469-13645491 CTTATGATGCTTAATTTTGCTGG - Intergenic
1180364691 22:11927971-11927993 CTTATGATGCTTAATTTTGCTGG - Intergenic
1183401892 22:37609495-37609517 CTTGGAATTATTAATACTTCTGG - Intronic
954900599 3:54016096-54016118 GCTGGGATTATTAATACTGCAGG + Intergenic
956612426 3:71137645-71137667 CTTAGGCTGATTTTCACTGCTGG - Intronic
957132798 3:76243575-76243597 CTGAGGACGATAAAAACTGCAGG + Intronic
958118242 3:89250460-89250482 ATTAGGAAGATTAATTTTGCAGG - Intronic
967626088 3:191685771-191685793 ATTATGATGATTAATTCTTCTGG - Intergenic
967791945 3:193559456-193559478 ATTAGGATAATTAATACTAAAGG - Intronic
971391056 4:26185558-26185580 CTCTGGATAATTAATATTGCAGG - Intronic
973365846 4:49208783-49208805 CTTATGATGCTTAATTTTGCTGG + Intergenic
973394752 4:49583668-49583690 CTTATGATGCTTAATTTTGCTGG - Intergenic
975650172 4:76585139-76585161 TTTGGAATGATTACTACTGCTGG + Intronic
975768238 4:77692383-77692405 ATTAGGAGGATGAAAACTGCAGG - Intergenic
978341273 4:107723194-107723216 CTTGTGATGGTTAATACTGAGGG - Intergenic
1202763340 4_GL000008v2_random:131131-131153 CTTATGATGCTTAATTTTGCTGG + Intergenic
991514455 5:67418919-67418941 CTGAGGATGAGAAATACTGGAGG - Intergenic
1003969559 6:11285592-11285614 ACTTGGAGGATTAATACTGCCGG + Intronic
1006601399 6:35228892-35228914 CTTAGGATGAAAAATCCTGCTGG + Intronic
1006704477 6:36006857-36006879 CTTTAGATGATTAATATGGCAGG - Intronic
1008246568 6:49182002-49182024 CTTATGATGATTCTTACAGCTGG + Intergenic
1012480966 6:99666555-99666577 ATTAGGATGATTTATGCTACAGG - Intergenic
1014678505 6:124398606-124398628 ATTATGATGATTAAAACTACAGG + Intronic
1020612992 7:10424214-10424236 CTTATGGTGAATAATACTGGTGG + Intergenic
1020781618 7:12523272-12523294 CTTAGGATGATTCCTTATGCTGG - Intergenic
1021662716 7:22936293-22936315 CTTAGGATGGTCACTGCTGCTGG + Intergenic
1023797769 7:43808107-43808129 CTTAGGAGCATTAGTACAGCGGG - Intergenic
1029927596 7:104333942-104333964 CATAGGAAGATTAATTCTCCAGG - Intronic
1035078990 7:156200648-156200670 CTTAGGAAGATTAATACATGAGG - Intergenic
1035613608 8:986210-986232 CTTAGGATGTTTAGCACAGCAGG + Intergenic
1045483767 8:102614027-102614049 CTTAGTATGATTACTAGTCCAGG - Intergenic
1046229779 8:111338648-111338670 TTTAAGATGCTTAATACTGGAGG - Intergenic
1048529142 8:135231835-135231857 GTTTGGATGAATAATAGTGCAGG + Intergenic
1050308103 9:4326582-4326604 TTTAGGATGATGAAAAATGCTGG + Intronic
1057977450 9:99621169-99621191 CACAGGAAGATAAATACTGCAGG + Intergenic
1062202251 9:135309763-135309785 CTGAGGATGATTGACAATGCTGG + Intergenic
1203544101 Un_KI270743v1:116004-116026 CTTATGATGCTTAATTTTGCTGG + Intergenic
1185785326 X:2886011-2886033 CTTAGGATGATGGATAGAGCAGG - Intergenic
1186256146 X:7722290-7722312 CTTGGGATGATTAATAGTATTGG + Intergenic
1198851844 X:140973236-140973258 CTTAGGATGGTTGATTCTGATGG + Intergenic
1201148487 Y:11080843-11080865 CTTAAAATGTTTAATACTGACGG + Intergenic
1201288547 Y:12400127-12400149 CTTAGGATGATGGATAGAGCAGG + Intergenic