ID: 1079327587

View in Genome Browser
Species Human (GRCh38)
Location 11:19507471-19507493
Sequence ATTTGGTATAGAAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079327580_1079327587 30 Left 1079327580 11:19507418-19507440 CCTCATTTGTTGTAATTAACAGG 0: 1
1: 0
2: 1
3: 11
4: 337
Right 1079327587 11:19507471-19507493 ATTTGGTATAGAAATGTGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079327587 Original CRISPR ATTTGGTATAGAAATGTGGA GGG Intronic
901116970 1:6854346-6854368 ATATGGCTTAGGAATGTGGAAGG + Intronic
901893089 1:12284893-12284915 TTTTGGTTTAGCAAGGTGGATGG + Intronic
904647848 1:31981744-31981766 ATGTGCTTTAGTAATGTGGAAGG + Intergenic
905373443 1:37500778-37500800 ATTTGGTTTACAAATCTGTAGGG - Intronic
908081267 1:60581288-60581310 ATTTGTTATAGAAATGAGAGTGG + Intergenic
908724184 1:67157302-67157324 ATTTTGTAGAGGAATGGGGAAGG - Intronic
908880517 1:68726592-68726614 ATTTTGTAGAGAAAAGGGGAAGG - Intergenic
909459456 1:75893422-75893444 AGTTGGAATAGGAATGTGTAGGG + Intronic
909772694 1:79443444-79443466 ATTTGGGATAAAAAGGTAGATGG + Intergenic
910005516 1:82391349-82391371 ATGGGGTAGAGAAGTGTGGAGGG + Intergenic
910545845 1:88417193-88417215 ATTTGGTATGTAAATGTTTATGG - Intergenic
911233580 1:95385638-95385660 TTTTGTTCCAGAAATGTGGAGGG - Intergenic
912116527 1:106414057-106414079 ATTTGGTGAAGAAAAGAGGACGG - Intergenic
913426182 1:118732848-118732870 ATTTGATTTAGAAACCTGGAGGG - Intergenic
916487897 1:165275609-165275631 ATTTGCTATAGAAATAAGGAAGG - Intronic
916910825 1:169343898-169343920 ATTTGATATGGAAATGTGAAGGG - Intronic
917074612 1:171191338-171191360 ATTTGGCTTAAAAATGTGGTTGG - Intronic
917806809 1:178621168-178621190 ATTTGGTTTAGAAACCTGAAGGG + Intergenic
917946740 1:179981110-179981132 ATTTGGTATATAAAAGTTCATGG - Intronic
918103437 1:181396402-181396424 ATTGGGTTTAGCAATGTGGAGGG + Intergenic
918735966 1:188064141-188064163 CTGTGGTACAGAAATGTGGTTGG + Intergenic
918772860 1:188586028-188586050 ATATTCTACAGAAATGTGGAAGG - Intergenic
919057998 1:192594880-192594902 ATTTGGGTTGGAAATGTGAAAGG + Intergenic
919256154 1:195127991-195128013 AATTGGTTTTGAAATGTGAAAGG - Intergenic
919274882 1:195400819-195400841 ATTTATTAAAGAAATGTTGAAGG - Intergenic
920053775 1:203178670-203178692 ATTTAATTTAGAAATCTGGATGG + Intergenic
920699802 1:208209299-208209321 ATGTTGTTTGGAAATGTGGAAGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921541222 1:216418196-216418218 ATTTTGTTTAAAAATGTGTAAGG - Intronic
922431272 1:225556813-225556835 ATTGGGGATAGAAATATGAAAGG - Intronic
922597322 1:226824049-226824071 AATTGTGACAGAAATGTGGAAGG + Intergenic
922820852 1:228484437-228484459 GTTTTGTTTAGAAATGTGGCTGG - Intergenic
924937163 1:248781839-248781861 GTTTAGTATAGAGATGGGGATGG - Intergenic
1063306314 10:4904358-4904380 TTTGGGTATAGAAATGGTGATGG - Intergenic
1066128740 10:32369028-32369050 GTCTGCAATAGAAATGTGGATGG + Intronic
1066662437 10:37749552-37749574 ACTTTGCATACAAATGTGGAAGG - Intergenic
1067495799 10:46758989-46759011 ATTTGGTAAAGAACTGAGGAGGG - Intergenic
1067598855 10:47581401-47581423 ATTTGGTAAAGAACTGAGGAGGG + Intergenic
1068182673 10:53542652-53542674 ATTTGGAAAAGAAGTGTGAACGG - Intergenic
1068669270 10:59708259-59708281 ATTTGGTCCAGGAAAGTGGAAGG + Intronic
1069063111 10:63914633-63914655 ATTTGGTATGTTAATTTGGAAGG - Intergenic
1069112401 10:64464026-64464048 AATTGGTTTTGAAATGTGAAAGG - Intergenic
1070386044 10:75925535-75925557 ATTTGGTTTAGTAGTTTGGAGGG + Intronic
1070883836 10:79872976-79872998 ATTTGGTAAAGAACTGAGGAGGG + Intergenic
1071650392 10:87389278-87389300 ATTTGGTAAAGAACTGAGGAGGG + Intergenic
1071964024 10:90834176-90834198 ATGTGCTCTGGAAATGTGGATGG - Intronic
1075785638 10:125048310-125048332 AGTTGGGATAGAAATGAGGATGG - Intronic
1077483739 11:2829001-2829023 ACTAGGTATAGAATTCTGGATGG - Intronic
1078167016 11:8895955-8895977 AATTGGAAAAAAAATGTGGAGGG + Intronic
1079273042 11:19006403-19006425 AATTGGTTTTGAAATGTGAAAGG + Intergenic
1079327587 11:19507471-19507493 ATTTGGTATAGAAATGTGGAGGG + Intronic
1079807828 11:24956775-24956797 ATTTGGTAGAGAAATCTTAATGG + Intronic
1079813094 11:25020726-25020748 ATTTGTTAAAGAAATGTAAAAGG - Intronic
1079959314 11:26903398-26903420 AATAGGTATTGAGATGTGGAAGG + Intergenic
1080425689 11:32152041-32152063 TTTTGGAATAGAAGTGTAGAAGG - Intergenic
1082084965 11:48042602-48042624 TTTTGGTTTAGAAGAGTGGAGGG - Intronic
1082963827 11:58945297-58945319 ATTTAGAAAAGAAATGTTGATGG + Intronic
1084166501 11:67377231-67377253 CTTTGGGGTAGAAATGTGGATGG + Intronic
1084318205 11:68358024-68358046 ATTTGCTATAGAAATATTCAAGG - Intronic
1085214361 11:74815174-74815196 ATTGGGAATAGAAATGTAGAGGG + Intronic
1086577129 11:88351275-88351297 ATTTGTTATTGAAATTTAGAGGG - Intergenic
1087574710 11:99975835-99975857 GATTGGTTTTGAAATGTGGAAGG - Intronic
1089164288 11:116462601-116462623 ATTTGTTTTAGAGATGAGGAGGG - Intergenic
1089657562 11:119962256-119962278 AGTTGGGATGGAAATGTGGTAGG - Intergenic
1089753536 11:120669030-120669052 ATTTGGTGGAGAAATGAGGAAGG - Intronic
1090134677 11:124185057-124185079 ATTTGCTACAGAAATGTAGTTGG + Intergenic
1090540961 11:127704008-127704030 ATTTTGAATAGAATTGGGGATGG + Intergenic
1090771863 11:129927859-129927881 ATTTCTTCTAGAAATGTGTACGG - Intronic
1092254719 12:6920280-6920302 ATTTGGATTAGCAATGAGGAAGG + Intronic
1092991209 12:13901853-13901875 ATTTGAGATATAAATGTGAAAGG - Intronic
1093226261 12:16487517-16487539 AAGTGGTAAAGAAATATGGAGGG + Intronic
1093905518 12:24687283-24687305 ATTAGGTAGAGAAGTCTGGAAGG - Intergenic
1094435125 12:30412902-30412924 ATGTGGTAAAGAACTGTGGGCGG - Intergenic
1096904423 12:54921175-54921197 ATTTTATTTAGAAATCTGGAAGG - Intergenic
1098231129 12:68372919-68372941 ATTTGGTAGAGAAAAGGGGAAGG + Intergenic
1099598708 12:84703031-84703053 TTATGGTATGGAAATGTGGAAGG + Intergenic
1099848780 12:88064478-88064500 CTTTAATATATAAATGTGGAGGG - Intronic
1100172808 12:91995270-91995292 ATGTGGTATAGATACGTGGATGG - Intronic
1101074213 12:101111565-101111587 ATTTGGTATGGAATTCTTGAAGG + Exonic
1101835339 12:108291153-108291175 ATTTGGCAAAGAAATGAGAAAGG - Exonic
1102404514 12:112661579-112661601 ATTTGGTCTATACATATGGAAGG + Intronic
1103014172 12:117481101-117481123 AAATGGGATAGAGATGTGGAAGG - Intronic
1103794866 12:123496344-123496366 ATCTGGGATACAAATGAGGAAGG - Intronic
1104777165 12:131397094-131397116 AATTGGTTTTGAAATGTGAAAGG - Intergenic
1106492635 13:30241418-30241440 ATTTTGAATATTAATGTGGAAGG + Intronic
1106717471 13:32406237-32406259 ATTGGGTCTAGAAAGGAGGAAGG - Intronic
1106793367 13:33179536-33179558 ATTTGGTATGCAGAAGTGGAAGG + Intronic
1106832906 13:33604181-33604203 AAATGGTGAAGAAATGTGGAGGG + Intergenic
1107379658 13:39842516-39842538 ATTTTGGATACAAATGTGAAAGG + Intergenic
1107543914 13:41419081-41419103 TTTAGGTATAAAAATATGGATGG + Intergenic
1108017495 13:46091184-46091206 TTTTGGTATAGATATTTGGGGGG + Intronic
1108103348 13:46982191-46982213 ATTTGGTACAGATAGGTGGGAGG - Intergenic
1109257910 13:60106070-60106092 TTTTGGTATAGAGGTGGGGAGGG - Intronic
1109481832 13:62965068-62965090 AATTGGTTTTGAAATGTGAAAGG + Intergenic
1109825113 13:67708961-67708983 ATATGGCAGAGAAAGGTGGAAGG + Intergenic
1110700305 13:78539667-78539689 ATTTTGTAAATAAATGTGAAAGG + Intergenic
1111189653 13:84790922-84790944 TTTTGGTTTAGAAATGTGAAAGG + Intergenic
1112628271 13:101131371-101131393 ATTTTGTATAAAAATGAGTAAGG - Intronic
1112807181 13:103175763-103175785 ATGTGGTCTAGAAATGTTGCTGG - Intergenic
1113355866 13:109579482-109579504 ATTTTGTATAGAGATGGTGAAGG - Intergenic
1114897080 14:27004567-27004589 GTTTGGTATAGACATGTGGAAGG - Intergenic
1115470041 14:33759104-33759126 ATGTGGTGTAGAAAAGTGGGAGG - Intronic
1116501084 14:45622773-45622795 ATTTGGTAAAGAACTGGGGGTGG + Intergenic
1117240063 14:53822190-53822212 ATTGGGTATAACAATTTGGATGG + Intergenic
1117571059 14:57049693-57049715 ATTTGGAAAAGAAATCTAGACGG - Intergenic
1118449895 14:65890943-65890965 ATCAGGTAAAGAGATGTGGATGG - Intergenic
1119231080 14:72980339-72980361 ATTTGGTAGTGAAGAGTGGAAGG + Intronic
1120026560 14:79592008-79592030 CTTTGTTATAGGGATGTGGATGG - Intronic
1120425607 14:84343469-84343491 GTCTGGTATAAAATTGTGGAAGG - Intergenic
1124269399 15:28266943-28266965 ATTTGTTAAATGAATGTGGATGG + Intronic
1125965100 15:43868230-43868252 AATTGGTATAGAAATGAAAAAGG - Exonic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126356689 15:47803534-47803556 ATTTGGAATAGAAGGGAGGAAGG + Intergenic
1126501287 15:49348261-49348283 ATTTGGAATAGCTTTGTGGAGGG - Intronic
1126892944 15:53225554-53225576 ATTTGGAATATAAAGGTGGAAGG - Intergenic
1127566936 15:60198789-60198811 ATTAGGGATAGACATCTGGAAGG - Intergenic
1127579925 15:60328943-60328965 ATATGACATAGAAATGTGTAAGG + Intergenic
1128546359 15:68571090-68571112 ATTTGGGATAGTGATCTGGATGG + Intergenic
1129594890 15:76955094-76955116 ATTTGGGATTGTAAAGTGGAAGG - Intergenic
1130202527 15:81845489-81845511 ATTTGGTTTAGGAATGTGGTGGG - Intergenic
1130230083 15:82090427-82090449 ATTTGGTATCTGAATATGGAGGG - Intergenic
1133618121 16:7498702-7498724 ATTGGGTGTTGAAATGTGGCTGG - Intronic
1135053979 16:19215218-19215240 ATTTGATGTAGAAGTGGGGAGGG + Intronic
1135936960 16:26789223-26789245 ATTTGGTCCAGAAATTTGTAAGG + Intergenic
1136242692 16:28954125-28954147 ATTGGTTATCAAAATGTGGAGGG - Intronic
1137387418 16:48054589-48054611 AGCTGGGTTAGAAATGTGGAGGG - Intergenic
1149171190 17:53813462-53813484 TTTTGGTATGTAAATGTGGGTGG - Intergenic
1151933123 17:77245264-77245286 CTTTGGGAAGGAAATGTGGAGGG + Intergenic
1152326568 17:79644910-79644932 AATTTTTATGGAAATGTGGAAGG + Intergenic
1154125212 18:11686778-11686800 ATTTGATATACAAATGTGAGGGG + Intergenic
1155103004 18:22632316-22632338 ATTTGCTAGGGAAAGGTGGAAGG - Intergenic
1155328441 18:24690092-24690114 ATTTGCTGTAGAAATGTGCCAGG + Intergenic
1155793666 18:30006178-30006200 ATATGGTAGAGGAATCTGGAGGG + Intergenic
1156108256 18:33691812-33691834 ATCAGGTAAAGAAATGTGGAGGG + Intronic
1158146259 18:54316599-54316621 AGTTGGTACATAAAAGTGGAGGG + Intronic
1162215348 19:9129385-9129407 AACTGGTATAAAAATGTGCATGG + Intergenic
1162792408 19:13069914-13069936 ATTTGGGACAGAAAGGAGGAAGG - Intronic
1164232234 19:23300275-23300297 ACTTGTTATAGAAATCTGGTTGG + Intergenic
1165209762 19:34224765-34224787 ATTTGGTAAATGAATGGGGATGG - Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1168556133 19:57341854-57341876 ATTTGCTACAGATATTTGGATGG + Intergenic
1168559828 19:57373458-57373480 GATTGGTGTTGAAATGTGGAAGG - Intronic
925021882 2:576245-576267 ATTCAGGATAGAAATGAGGACGG - Intergenic
926261416 2:11267096-11267118 ATTTGGAGTTGAAATTTGGAAGG - Intronic
929384783 2:41393486-41393508 ATTAGGTTTGGAAATGTGAAAGG + Intergenic
931634567 2:64329869-64329891 ATTTGGTGGAGAATGGTGGAGGG + Intergenic
932005015 2:67919038-67919060 ATATGGTATAGAAATGTACTGGG + Intergenic
932767062 2:74477466-74477488 ATTTGGCATCAAATTGTGGAGGG - Intronic
933241555 2:79927062-79927084 ATTTGTTATAGGAATGTGTATGG + Intronic
933691725 2:85184180-85184202 ATGTGGGTTAGAAATCTGGAAGG + Intronic
934601494 2:95661989-95662011 ATTTGGTAAAGAAGTGAGGGTGG + Intergenic
935153216 2:100458360-100458382 ATTTGGTATAAAAATTTTGCAGG + Intergenic
935887345 2:107636548-107636570 ATTTAGAATACATATGTGGAGGG - Intergenic
937314994 2:120926428-120926450 ATATTTTAAAGAAATGTGGATGG - Intronic
937548012 2:123048547-123048569 ATTGTGTAGAGAAATGTGTATGG - Intergenic
938649347 2:133365950-133365972 ATTTTCTATAGAAATATTGATGG - Intronic
939610527 2:144304147-144304169 ATTTGGAATAGAAGAGTAGACGG + Intronic
939694292 2:145305031-145305053 ATGTGATAAAGTAATGTGGAGGG - Intergenic
940001768 2:148973675-148973697 ATGTGGAATAGAAATGTTAAAGG + Intronic
941349376 2:164413642-164413664 AATTGGTTTTGAAATGTGAAAGG - Intergenic
941653386 2:168117731-168117753 ATTTGGTAAAGATGTGTTGAAGG + Intronic
945197875 2:207254216-207254238 AATTGGTATGGAGACGTGGATGG - Intergenic
946332260 2:219017122-219017144 CTTCAGGATAGAAATGTGGATGG - Intronic
946599757 2:221346775-221346797 ATTTGGTATATAAAAGAGCAAGG - Intergenic
946965890 2:225037519-225037541 ATTTTGAATAGAAAACTGGAGGG - Intronic
947557270 2:231105835-231105857 AATTGATATAGAATTGTGAATGG - Intronic
947954845 2:234179795-234179817 AAGTGGTATTGAAATATGGATGG - Intergenic
1169691276 20:8334970-8334992 ATTTGGTACAGAAATAGGTATGG - Intronic
1170054076 20:12179762-12179784 ATTTGGGAGAGAGAGGTGGAAGG - Intergenic
1172212937 20:33213696-33213718 CTTGAGTATAAAAATGTGGAAGG - Intergenic
1173836174 20:46127694-46127716 TTTTGGTATAGAAGAGTGGAGGG - Intronic
1174772052 20:53309339-53309361 CTTTGGTATAGAAGTGGGGTGGG - Intronic
1176880380 21:14185186-14185208 CTTTGTTATAGAAATATGAAGGG + Intronic
949655998 3:6220498-6220520 CTTTGGCTTAGAAATGAGGAAGG + Intergenic
950577441 3:13840921-13840943 ATTTGGTAGAGGAGTGTGTAGGG - Intronic
951232717 3:20198513-20198535 ATTTGGTATAAGAGTGAGGAAGG + Intergenic
951774015 3:26288439-26288461 ATTGGATTTAGCAATGTGGAAGG + Intergenic
951987824 3:28640534-28640556 ATTAGGTATAGCACTTTGGAAGG - Intergenic
952875647 3:37942100-37942122 ATTAGATATAGACATGGGGAAGG - Intronic
955494132 3:59513379-59513401 ATTTGTTATAGAAAAATGAAAGG - Intergenic
955676877 3:61458145-61458167 ATTTGGGAAAAAAATATGGATGG - Intergenic
957297676 3:78353840-78353862 ATTTTATATAAAAAGGTGGAAGG - Intergenic
957550947 3:81703733-81703755 ATTTGGAAAAGAAAAGTGGATGG + Intronic
959540771 3:107535454-107535476 ATCTAGTATAGAAATGTCTATGG + Intronic
963621744 3:147617214-147617236 ATTTGCTATCCAAATGTAGAGGG - Intergenic
965191726 3:165538968-165538990 ATGTGGTATAAAAATGGGCATGG + Intergenic
966149836 3:176855507-176855529 ATTTAGTATAGTAAATTGGATGG - Intergenic
966632956 3:182098760-182098782 ATTTGCTATAGCAATCTGGATGG + Intergenic
967006578 3:185389215-185389237 ATTGTGTACAGAAATTTGGAAGG - Intronic
967746563 3:193062409-193062431 ATTTGGTCTACAATTCTGGACGG + Intergenic
969834117 4:9825292-9825314 GTTTGGAATAGATATGTTGAGGG - Intronic
972487670 4:39557691-39557713 ATTTTGTATATAATTGTGGAAGG + Intronic
975592425 4:76013323-76013345 AATTGGTCTAGAAATGTGGCAGG + Intronic
975604796 4:76143763-76143785 AATTGGTAGGGAAATGTGGTAGG + Intronic
975716060 4:77206712-77206734 TTTGGGTAGAGGAATGTGGATGG - Intronic
977165149 4:93685712-93685734 ACTTGGTAGAGAAAAGTTGATGG - Intronic
977422216 4:96816278-96816300 ATTTGGTAGAGAAACGGAGAAGG - Intergenic
978407740 4:108397850-108397872 ATGTGGTACATAAATGTGAATGG - Intergenic
978665916 4:111182288-111182310 AATTGGTTTTGAAATGTGAAAGG - Intergenic
979840918 4:125439166-125439188 CTCTGGAATAGATATGTGGAAGG - Intronic
981481662 4:145244680-145244702 ATTGATTACAGAAATGTGGAAGG + Intergenic
981603686 4:146520937-146520959 TTTTGGCAAGGAAATGTGGATGG - Intronic
983250701 4:165342953-165342975 ATTTGATATACAAAAATGGAAGG - Exonic
985017352 4:185650659-185650681 ATTTGCTGTGGAAATGTGCATGG - Intronic
985197352 4:187446010-187446032 TTCTGGTAGAAAAATGTGGAAGG - Intergenic
986637541 5:9837688-9837710 ATTTGTTAAAGAAATGAAGAAGG - Intergenic
988011842 5:25498595-25498617 TTTTTGTAGAGACATGTGGAGGG - Intergenic
989256255 5:39368795-39368817 ATTTGATATAAATATGTTGAGGG + Intronic
991339874 5:65596875-65596897 CTATGGGATTGAAATGTGGATGG - Intronic
993352174 5:86863919-86863941 GTATGGCATGGAAATGTGGATGG - Intergenic
993568241 5:89502487-89502509 ATATGGCTTAGAAATTTGGATGG + Intergenic
996431424 5:123382766-123382788 ACTTGAGCTAGAAATGTGGAAGG - Exonic
996705791 5:126497162-126497184 ATGTGGTAATGAAAAGTGGAAGG + Intergenic
997922921 5:137999662-137999684 TTTTGTTATAGTAATGTGAATGG - Intronic
998068596 5:139178994-139179016 ATTTGGGAGAGAAAGGGGGAAGG - Intronic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
999948884 5:156627208-156627230 ATTTGTCATGAAAATGTGGAAGG + Intronic
1000666048 5:163997720-163997742 ATTTAGAATAGAAATATGCATGG - Intergenic
1000729555 5:164815401-164815423 ACTTGGTCTACAAATCTGGATGG + Intergenic
1001272946 5:170329384-170329406 ATTTGGGATAGAAATGAGGAAGG - Intergenic
1001706709 5:173746375-173746397 GTTTGGTCCAGAAAGGTGGAGGG - Intergenic
1001966048 5:175910623-175910645 ACTGGGGATAGAAAGGTGGATGG - Intergenic
1002250898 5:177928577-177928599 ACTGGGGATAGAAAGGTGGATGG + Intergenic
1005085086 6:21997871-21997893 AGATTGGATAGAAATGTGGAAGG - Intergenic
1005130893 6:22506675-22506697 ATTTTGGAAAGAAACGTGGAGGG - Intergenic
1005139920 6:22618557-22618579 ATTTGGTAAATAAATGTTTAGGG - Intergenic
1005681336 6:28211769-28211791 ATTTGGTGCAGAATTTTGGAGGG - Intergenic
1007169778 6:39854334-39854356 ATTGGCTATAGAAATGGGGATGG + Intronic
1007755577 6:44097226-44097248 AGTGGGTAAATAAATGTGGAAGG - Intergenic
1009488418 6:64255064-64255086 AATTGCTATAGAAAGATGGAAGG + Intronic
1009710325 6:67309309-67309331 AATTGGTTTTGAAATGTGAAAGG + Intergenic
1011239723 6:85258064-85258086 ATTTTCTATGGTAATGTGGATGG + Intergenic
1012113870 6:95268656-95268678 ATATCATATAGAAATGTGTAGGG - Intergenic
1012370953 6:98506739-98506761 ATTCAATAGAGAAATGTGGAAGG - Intergenic
1013597074 6:111669937-111669959 ATTTGGTCTGGACATGGGGAAGG + Intronic
1013846106 6:114453500-114453522 ATTTATTATGGAAATGTAGAAGG + Intergenic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1015148671 6:130015946-130015968 ATTTGGTATTTACATGTGGCAGG + Intronic
1016708806 6:147145227-147145249 ATATGGGATAAACATGTGGATGG + Intergenic
1017559169 6:155608078-155608100 TTTTGGTATAGGCATGGGGAAGG - Intergenic
1018870151 6:167776597-167776619 ATTGGGAAGAGAAATGTGTATGG - Intergenic
1019809363 7:3153158-3153180 ACTTGATATAGAAATGCAGAAGG - Intronic
1024396756 7:48878013-48878035 AATAGATATAGAGATGTGGATGG + Intergenic
1026097906 7:67361336-67361358 ATATGGTCTAGAAAGGGGGAGGG + Intergenic
1026433821 7:70375703-70375725 ATTTGGAATACAAGTGTGTAAGG + Intronic
1028572847 7:92310806-92310828 ATTTGGAAAACAAATATGGATGG - Intronic
1028709841 7:93894247-93894269 GTTTGGCATAGAAAAGTAGAAGG - Intronic
1028865893 7:95711043-95711065 ATGTGGTAGTGAAGTGTGGAAGG - Intergenic
1030808056 7:113940314-113940336 TTTGGGTATACACATGTGGAGGG - Intronic
1031093885 7:117395580-117395602 ATTTGATTTAAAAATGTGAAAGG - Intronic
1031792548 7:126126276-126126298 ATTTTGAATAGAAATGGTGAAGG - Intergenic
1033045838 7:137961630-137961652 GTCTGGCATAGAAATGGGGAGGG - Intronic
1033886681 7:145957031-145957053 ATTTTGTATATAAATGTTCAAGG + Intergenic
1035858616 8:3004123-3004145 ATTTGGTTTTGAAGTGTGCAGGG - Intronic
1036164761 8:6422360-6422382 AAGTCGTATAGAAATGTGGAGGG + Intronic
1036380628 8:8234191-8234213 ACTTGGTAGGGAAACGTGGATGG - Intergenic
1037542881 8:19889261-19889283 ATGTGGAGTAGAAATGTGTAAGG + Intergenic
1038956438 8:32473541-32473563 ATTTGGTCTAGAAACCAGGATGG - Intronic
1039159657 8:34603142-34603164 ATTGGGCATATAAATTTGGAGGG + Intergenic
1039749017 8:40459471-40459493 ATTTAGGATAGGAATCTGGATGG + Intergenic
1039820389 8:41129408-41129430 AATTGGTATAGAAATTCTGAAGG + Intergenic
1041421775 8:57674898-57674920 AACTGGTATAGAAAAGTGAACGG + Intergenic
1041516282 8:58702228-58702250 TTTTGGTACAGAAATGAAGAAGG + Intergenic
1041989191 8:63965429-63965451 ATCATGTATAAAAATGTGGAGGG - Intergenic
1042007307 8:64195343-64195365 AAGTGCAATAGAAATGTGGAAGG + Intergenic
1043091526 8:75910766-75910788 ATTTGCAATAGAACTGTGAAAGG + Intergenic
1043925377 8:86030699-86030721 ATGGGGGATAGAATTGTGGAGGG + Intronic
1044935326 8:97288402-97288424 ATTTACTATAGAAATATGCAGGG - Intergenic
1045796812 8:106056006-106056028 TTTTGGTAGAGAAATGCTGAGGG - Intergenic
1045857431 8:106780628-106780650 ATTAGATTTAGCAATGTGGAAGG - Intergenic
1046883571 8:119337747-119337769 AATAGATATAGAAATGTGTATGG + Intergenic
1048755978 8:137738685-137738707 AGTTGGTATGGGAATGGGGATGG - Intergenic
1050084237 9:1947864-1947886 ATGGGGGATAGAAATGTGCATGG - Intergenic
1050471833 9:6001178-6001200 AGTAGGAATAGAAAGGTGGATGG - Intronic
1052411731 9:28129735-28129757 ATTTGGTATAGACATATTGCTGG + Intronic
1055225394 9:73989284-73989306 AATTGGTTTTGAAATGTGAAAGG - Intergenic
1055583811 9:77734971-77734993 ACTTGGTATAAAAATTTAGAGGG - Intronic
1055655376 9:78445656-78445678 CTTTGGTAATGAAATGTGGATGG + Intergenic
1055733523 9:79303889-79303911 ATCTGGTAGTGATATGTGGAAGG - Intergenic
1056150710 9:83785085-83785107 ATTTGGTCTTGAAAGGTAGAAGG - Intronic
1056889641 9:90478816-90478838 GCTTGGTATAGAAGTGTGAAAGG + Intergenic
1057244410 9:93442358-93442380 ACTGGGTATAGAATTTTGGATGG - Intergenic
1058057535 9:100464179-100464201 ACTTGGCATATAAAGGTGGAAGG - Intronic
1059648449 9:116291138-116291160 ATTTAGTATAGTAATTTGAATGG - Intronic
1060169074 9:121445974-121445996 CCTTGGTAAAGAGATGTGGATGG - Intergenic
1060235853 9:121862185-121862207 TTTTGGTCTGGAAATGTGGAGGG + Intronic
1060398273 9:123331685-123331707 TTTTGGTCAAGAAATGTGGCAGG - Intergenic
1186988190 X:15038898-15038920 ATTTGCTATAGCAATCTGAATGG + Intergenic
1187067163 X:15852643-15852665 AATTGGCATAGAAATATTGATGG - Intronic
1187470874 X:19568764-19568786 ATTTTGTGTAAAAAGGTGGATGG - Intronic
1188527818 X:31105274-31105296 ATTAGGTAAAGAAACGTGCATGG - Intronic
1188644500 X:32548507-32548529 TTATGGTATATGAATGTGGATGG + Intronic
1188758922 X:34000849-34000871 ATTTTGGATAGAAATGTAAATGG - Intergenic
1189314208 X:40042252-40042274 CTTTGGTTTAGATAAGTGGAAGG - Intergenic
1191095624 X:56670541-56670563 ATTTGGGGAAGAAATGTAGATGG - Intergenic
1193431854 X:81416995-81417017 GTTTGTTTCAGAAATGTGGAAGG - Intergenic
1194378124 X:93161168-93161190 ATGTGATGTAGAAATATGGATGG + Intergenic
1196257504 X:113538988-113539010 CTTTGATACAGAAAGGTGGAGGG + Intergenic
1196761744 X:119207070-119207092 ATGGGGTAAAGGAATGTGGATGG + Intergenic
1197529510 X:127605858-127605880 ACTTGGAATGGAAATGTGGGAGG + Intergenic
1197694805 X:129539692-129539714 ATTGGATATAGAGATGAGGAGGG + Intergenic
1199112927 X:143955984-143956006 AATTGGTTTTGAAATGTGTAAGG + Intergenic
1199217108 X:145272677-145272699 ATTCCCTATAGAAATATGGAAGG - Intergenic
1200872907 Y:8122514-8122536 TTTTAGTCTACAAATGTGGATGG - Intergenic