ID: 1079328008

View in Genome Browser
Species Human (GRCh38)
Location 11:19511176-19511198
Sequence GAGAACAGTCGGGAGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079328004_1079328008 16 Left 1079328004 11:19511137-19511159 CCAAGTCAGTAGGTTTTGTCAGT 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1079328008 11:19511176-19511198 GAGAACAGTCGGGAGACACATGG 0: 1
1: 0
2: 1
3: 11
4: 169
1079328003_1079328008 23 Left 1079328003 11:19511130-19511152 CCTGACTCCAAGTCAGTAGGTTT 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1079328008 11:19511176-19511198 GAGAACAGTCGGGAGACACATGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079328008 Original CRISPR GAGAACAGTCGGGAGACACA TGG Intronic
900869674 1:5293097-5293119 GAGACCGGTGGGGAGACCCATGG - Intergenic
902509535 1:16958673-16958695 GAGAGCAGGCGGGAGACCCTGGG + Exonic
902833094 1:19030157-19030179 GGGAAAAGTCTGGAGACAGAAGG + Intergenic
903433840 1:23331360-23331382 GAGACCAGTTGGGCAACACAGGG + Intronic
911055146 1:93702377-93702399 GGGAACAGTCAGGAGACAGTTGG - Intronic
911788055 1:101975803-101975825 AAGAATATTCAGGAGACACAGGG + Intronic
914665531 1:149829420-149829442 GAGAACAGGAGGCAGTCACAAGG + Intergenic
914670234 1:149864374-149864396 GAGAACAGGAGGCAGTCACAAGG - Intronic
917932644 1:179833863-179833885 CAAAAAAGTCGGGAGACAAAAGG + Intergenic
919637456 1:200016771-200016793 GAGGACAATCAGTAGACACAGGG - Intergenic
921254653 1:213328629-213328651 GAGAAAAGTGGGGAGAGAGAAGG + Intergenic
923500336 1:234559239-234559261 GAGGGCAGTGGGGAGACCCAAGG + Intergenic
1063464859 10:6236523-6236545 GAGAACAGGCGGCAGAGACTTGG + Intergenic
1065311009 10:24415932-24415954 GGGAACAGCAGGGAGACCCAGGG + Intronic
1065700873 10:28424126-28424148 GAAAACAGCCTGAAGACACAGGG - Intergenic
1065875068 10:29990534-29990556 GCGTGCAGTCGGGTGACACAAGG - Intergenic
1066456535 10:35577162-35577184 GAGGGGAGTCGGCAGACACAGGG + Intergenic
1067172808 10:43922042-43922064 GAGCCCAGCCTGGAGACACAAGG + Intergenic
1068414201 10:56696803-56696825 GATAACAGGCGTGAGACACCGGG - Intergenic
1075414232 10:122250479-122250501 GAGGCCACTCGGGAGGCACATGG - Intronic
1075473821 10:122715764-122715786 AAGCACAGTCGGGAGCCGCAGGG + Intergenic
1075549147 10:123379380-123379402 GAGAAGAGTCAGGAGGCACAGGG - Intergenic
1075776129 10:124990008-124990030 GAGTACAGGCGAGAGACACCAGG + Intronic
1076678120 10:132158529-132158551 AAGACCAGTGGGGAGGCACATGG + Intronic
1078023332 11:7673021-7673043 GAGAACAGTAGTGACACAGAAGG + Intronic
1079063509 11:17270303-17270325 TAGAACAGTTGGAATACACAAGG + Intronic
1079328008 11:19511176-19511198 GAGAACAGTCGGGAGACACATGG + Intronic
1080000542 11:27343615-27343637 GAGGACAGTCATGAGTCACATGG - Intronic
1080407929 11:31996501-31996523 TAGAGCATTCAGGAGACACAGGG - Intronic
1080868213 11:36213799-36213821 GAGAACAGTTGGGATTCACAGGG - Intronic
1083369515 11:62167081-62167103 GAGAACAGCAGGGGTACACAGGG + Intergenic
1083969648 11:66066945-66066967 CAGAACAGAGGGGAGACTCATGG - Intronic
1088633904 11:111800611-111800633 GTGAGCAGTGGGGAGACACCTGG - Intronic
1091220789 11:133928858-133928880 GAAAACAATCGAGAAACACATGG + Intronic
1092732012 12:11543980-11544002 GAGCACAGAGAGGAGACACAGGG + Intergenic
1098389958 12:69959298-69959320 GGGAACAGTCAGGAGGCAGAGGG - Intergenic
1098872418 12:75832007-75832029 GAGAAAACTTGGGAGTCACATGG - Intergenic
1101795110 12:107965889-107965911 GAGAACAGTGGGCAGCCACTAGG - Intergenic
1102527951 12:113525281-113525303 GAGAACAGAGAGGAGACACCTGG - Intergenic
1102687769 12:114737434-114737456 GAGGACAGTGGAGACACACAGGG + Intergenic
1106168349 13:27268868-27268890 GAGAGCAGTAGGGATACAGAGGG + Intergenic
1106571081 13:30928577-30928599 GACAGCAGGCTGGAGACACAGGG - Intergenic
1107360426 13:39611491-39611513 GTGAACAACAGGGAGACACAGGG - Intergenic
1109637763 13:65145367-65145389 GAGATAAGTTGAGAGACACAGGG + Intergenic
1113158554 13:107353066-107353088 GTGAACAGTCAGGAGGCAGAAGG - Intronic
1113878586 13:113609606-113609628 GGTAACAGTCAGGGGACACAGGG - Intronic
1117317912 14:54591919-54591941 GAGAAGAGTGGTGAGACATATGG - Intronic
1117496625 14:56312209-56312231 GAGCACAGTCAAGAGACAAAGGG - Intergenic
1119478776 14:74947025-74947047 GGGAACAGTGGGTAGAGACATGG + Intronic
1120178880 14:81323329-81323351 GAGAATGGTCGGGAGGCAAATGG - Intronic
1121875000 14:97442950-97442972 GATAACTGTGGGAAGACACAAGG - Intergenic
1123882832 15:24691341-24691363 GAGAAAAGTGTGAAGACACAAGG - Intergenic
1123947662 15:25246616-25246638 TTGAACAATCAGGAGACACATGG - Intergenic
1128272532 15:66323691-66323713 GAGGTCAGAGGGGAGACACAGGG - Intronic
1135009370 16:18861027-18861049 GAAAACAGGAAGGAGACACAGGG - Intronic
1135316410 16:21449952-21449974 GAAAACAGGAAGGAGACACAGGG - Intergenic
1135442481 16:22488930-22488952 GAAAACAGGAAGGAGACACAGGG + Intronic
1136326524 16:29530434-29530456 GAAAACAGGAAGGAGACACAGGG - Intergenic
1136441214 16:30270419-30270441 GAAAACAGGAAGGAGACACAGGG - Intergenic
1138431749 16:56973281-56973303 GAGCCCAGTAGGGACACACAGGG + Intronic
1138722204 16:59095415-59095437 GAGAATAGTCATGTGACACAGGG + Intergenic
1139887713 16:70222735-70222757 GAAAACAGGAAGGAGACACAGGG - Intergenic
1141350544 16:83290839-83290861 GAGAACAGTCAGGAAAAGCAAGG - Intronic
1141696176 16:85620734-85620756 GAGAACAGTGCAGAGACCCAAGG - Intronic
1143457252 17:7076251-7076273 GAGAGCAGGCTGGAGAAACAGGG - Intronic
1143521949 17:7449373-7449395 GATTACAGTCGTGAGCCACAGGG + Intronic
1144925182 17:18800928-18800950 CAGAGCTGTCTGGAGACACAGGG + Intronic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1152475799 17:80517239-80517261 GAGAAGAGAGGGGAGGCACAAGG - Intergenic
1153316462 18:3727438-3727460 GAGAACAGTCGGGAAGGAAAGGG - Intronic
1156997127 18:43482149-43482171 TAGAACAGTCGAGAGACAGCAGG - Intergenic
1157500718 18:48188728-48188750 GAGAGCAGACAGGGGACACAGGG - Intronic
1160095522 18:75868543-75868565 GACACAAGTCTGGAGACACAGGG + Intergenic
1160161654 18:76477488-76477510 GACAGCAGTCTTGAGACACATGG + Intronic
1160511136 18:79454182-79454204 CAGGACAGTCGAGAGACGCAGGG - Intronic
1163755881 19:19105948-19105970 GAGAAACGTCTGGAGACAAACGG - Intronic
1164493934 19:28740422-28740444 GAGAACAGTTGTGGGTCACATGG + Intergenic
1168101673 19:54144706-54144728 GAGCACAGTGGGTAGAGACAAGG + Intronic
926105368 2:10146471-10146493 GGGGACAGAGGGGAGACACAGGG - Intronic
926470932 2:13257083-13257105 GAGAGCAGATGGGAGATACAAGG - Intergenic
931012675 2:57935531-57935553 GAGAAGAGGAGTGAGACACATGG + Intronic
931697014 2:64878880-64878902 GAGAACAGTGGGGAGCTATAAGG + Intergenic
932321372 2:70824301-70824323 GAGAACAGTTAGGAGACGAACGG - Intergenic
932440412 2:71731263-71731285 GAGAGTAGCCGGGAGACAGAGGG - Intergenic
934886468 2:98029723-98029745 GAGAAAAGGCGGAAGACAGAAGG + Intergenic
935061724 2:99614464-99614486 AAGAACAGTGTTGAGACACAAGG + Intronic
936277671 2:111114556-111114578 GAGAACAGGGGTGAGACATATGG + Intronic
938078526 2:128355290-128355312 GAGAACAGGAGCGAGACAGAGGG - Intergenic
938762893 2:134441624-134441646 GGGAAGAGTTGGGAGCCACATGG - Intronic
939248760 2:139660177-139660199 GGGAATAGTTGGAAGACACATGG - Intergenic
940019853 2:149145444-149145466 GAAAACAGAAGTGAGACACAGGG + Intronic
941805837 2:169711697-169711719 AAGAACACTCGAGAGACACCAGG + Intronic
942128326 2:172849890-172849912 GAGACCAGTAGAGAGGCACATGG - Intronic
942765063 2:179445152-179445174 GAGAACAGGAGGGGGACAGAGGG - Intronic
942997811 2:182285749-182285771 GAGGACAGTGAGGAAACACATGG + Intronic
944660717 2:201919373-201919395 GAGAACAGTCTGAACACAGAAGG - Intergenic
948030644 2:234814705-234814727 GAGAACAGTGGGGTGGGACAGGG + Intergenic
948378561 2:237538063-237538085 GGGAAGAGTCGGGAGACACAGGG + Intronic
1173251238 20:41365261-41365283 GAGAACAGACAGAAGAGACATGG - Intronic
1173668994 20:44784571-44784593 CAGAACAGTCTGGAGAGAGACGG - Intronic
1175890904 20:62315498-62315520 GGGAACAGTCCGCAGCCACAGGG + Intronic
1176075652 20:63247195-63247217 GGGAACAGGCGGGACACGCATGG + Intronic
1176093797 20:63330381-63330403 GAGCACAGGCAGGAGACCCAGGG + Intronic
1177113751 21:17060577-17060599 AAGGACAGTTTGGAGACACAAGG + Intergenic
1178632363 21:34273680-34273702 GACAACTGTCAGGAGATACAAGG - Intergenic
1179170419 21:38968804-38968826 GAGAACATTCGAGAGGCACTGGG + Intergenic
1179875983 21:44267729-44267751 GAGAGCAGTCTGGGGACCCATGG - Intergenic
1179983431 21:44908101-44908123 GAGGACAGACGGGAGCCACCCGG + Intronic
1180203831 21:46244665-46244687 GAGCACAGCATGGAGACACACGG + Intronic
1181179222 22:21055437-21055459 GAGAAGATGAGGGAGACACAAGG - Intronic
1181904348 22:26181935-26181957 GAGCTCAGTCGTGAGACGCATGG + Intronic
1182439158 22:30351983-30352005 AAGTACAGTGGGGAGAGACAGGG + Intronic
1184106703 22:42371591-42371613 GAGAACAGTGGGCAGCGACAGGG - Intergenic
949408504 3:3739487-3739509 GTGAACGGTCGGAAGGCACAGGG + Intronic
952471916 3:33663981-33664003 GAAAACAGTCGTGTGAAACAGGG - Intronic
954130133 3:48556578-48556600 GAGAAGGGGCGGGAGACAGATGG - Intronic
955227572 3:57073729-57073751 TAGAAAAGTCAGGAGACACCTGG + Exonic
956226765 3:66968956-66968978 GAGAAAAGTTGGGAGACTTAAGG + Intergenic
956613155 3:71144768-71144790 CAGCACAGTCGGGATACAGAAGG + Intronic
956688519 3:71854889-71854911 GAGAAGAGGCTGGAGTCACAGGG + Intergenic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
960057186 3:113284102-113284124 GAGAAGGGTGGGGAGATACAGGG - Intronic
961565110 3:127758069-127758091 ATGAACAGTCGGGAGACAGGAGG - Intronic
966170659 3:177076346-177076368 GAGAACAGTGTGAAGACACAGGG - Intronic
969175662 4:5396898-5396920 GAGACCCGTAGGGAGCCACATGG - Intronic
969656162 4:8499711-8499733 GAGAACAGTGGGCAGAAAGAGGG + Intergenic
969881716 4:10179830-10179852 GAGAATAGTCAGAAAACACAAGG - Intergenic
973379681 4:49311533-49311555 GAGAGAAGCTGGGAGACACAGGG - Intergenic
974536060 4:63177280-63177302 GACAACAGGCTGGAGACACAGGG + Intergenic
975758868 4:77598322-77598344 GAGAGCAGTGGGGAGTAACAGGG + Intronic
979846829 4:125523999-125524021 GAAAACAGTCGTGGGACAAAAGG - Intergenic
980494494 4:133574328-133574350 GCCAACAGACTGGAGACACAAGG + Intergenic
981788226 4:148504830-148504852 GAGAACATTTGGGAGACCCCTGG - Intergenic
981869170 4:149465856-149465878 GAGAACTGTCAGGTGGCACAGGG + Intergenic
984983358 4:185303730-185303752 GAGAAGAGTACAGAGACACATGG - Intronic
985053277 4:186014117-186014139 GAAAACAGTAGGGAAACACAAGG - Intergenic
985683788 5:1271209-1271231 GAAAGCAGACGGGAGACACATGG + Intronic
990403622 5:55465850-55465872 GGGAACAGTTTGGAGACACAGGG - Intronic
991437003 5:66607095-66607117 GAGAATAGTAGGGAGATACTGGG + Intronic
992082591 5:73249101-73249123 GAGTACAGTGTGGAAACACAGGG - Intergenic
992762686 5:79965017-79965039 GACAACAGTGGGAAGAGACAGGG - Intergenic
993069792 5:83145988-83146010 GAGAAAAGTCATGAGACATAAGG - Intronic
1003083874 6:3045450-3045472 GAGAACATCTGGAAGACACAGGG + Intergenic
1003321853 6:5058747-5058769 AAAAATAGTGGGGAGACACAGGG - Intergenic
1003537067 6:6984699-6984721 CAGTACAGTCGGGAAACAAAAGG + Intergenic
1007520812 6:42451068-42451090 GGGAAGAGTGGGGAGACAGAAGG - Intronic
1010645597 6:78384758-78384780 GATTACAGGCGGGAGCCACAGGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1015889204 6:137952427-137952449 GAGAACAGCTGGGAGATGCAGGG + Intergenic
1018502362 6:164424727-164424749 GAGCACAGTTGGGGGAAACAGGG - Intergenic
1020142823 7:5621930-5621952 GAGAACACCCGGGGCACACACGG + Intronic
1021873736 7:25029283-25029305 GAGACCAGTGGGGAGAGACATGG + Intergenic
1022176435 7:27875719-27875741 GAGACTAGTGGGGAGACAGATGG - Intronic
1023550992 7:41369762-41369784 GAGGAGAGTAGAGAGACACATGG - Intergenic
1026472353 7:70704674-70704696 GAGAACAGTTGAGTGACAAAGGG + Intronic
1028599898 7:92590229-92590251 GAAAACAGTGGGGCGACGCAGGG - Intronic
1034902331 7:154915236-154915258 GAGAACGCTGGGGAGACACGCGG + Intergenic
1035082183 7:156225702-156225724 GAAAACATTGGTGAGACACATGG + Intergenic
1038944871 8:32347683-32347705 GTTAAAAGTCTGGAGACACACGG - Intronic
1040830515 8:51671640-51671662 GGGAGCAGTCTGGAGAGACAGGG - Intronic
1041131867 8:54710102-54710124 CAGAACATGAGGGAGACACAAGG + Intergenic
1047690289 8:127345168-127345190 GAGAACTGGTGGTAGACACATGG - Intergenic
1049033779 8:140058656-140058678 AAGAACAGCCGGGAGAACCAGGG + Intronic
1050204889 9:3186123-3186145 AAGAACACTCGAGAGACACCAGG + Intergenic
1052059885 9:23946709-23946731 GAGAACAGGGTGGAGACACCAGG - Intergenic
1053305532 9:36981990-36982012 GATTACAGTGGGGAGCCACAGGG - Intronic
1053563014 9:39215651-39215673 GAGACCAGTCGGCAAACACATGG + Intronic
1053828806 9:42053578-42053600 GAGACCAGTTGGCAAACACATGG + Intronic
1054134133 9:61403404-61403426 GAGACCAGTCGGCAAACACATGG - Intergenic
1054601753 9:67133876-67133898 GAGACCAGTTGGCAAACACATGG - Intergenic
1056551643 9:87657954-87657976 GATGACATTCCGGAGACACAAGG - Intronic
1058068630 9:100578299-100578321 GAGAATAGAAGAGAGACACAGGG + Exonic
1060054637 9:120402972-120402994 GTGACCAGGCGGGACACACACGG + Exonic
1060540836 9:124429082-124429104 GACAGCAGTCGGGAGACAGGTGG + Intergenic
1185586757 X:1246752-1246774 GAGCACAGTCCTGAGACACCTGG + Intergenic
1187719201 X:22133947-22133969 CAGAGCAGTGGGGAGTCACAGGG + Intronic
1189290095 X:39878680-39878702 GAGACCAGGAGGGAGAGACAGGG + Intergenic
1191030346 X:55962721-55962743 GAGAAAAGTTGGGAGATAAAAGG - Intergenic
1192434143 X:71132351-71132373 GAGAACAGACAGAGGACACAGGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1197986208 X:132268977-132268999 GAGGAAAGTGGGGAGACCCAAGG - Intergenic