ID: 1079328251

View in Genome Browser
Species Human (GRCh38)
Location 11:19512523-19512545
Sequence GTGGTTTTAGCCTACCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079328251_1079328255 12 Left 1079328251 11:19512523-19512545 CCCTGCTGGTAGGCTAAAACCAC 0: 1
1: 0
2: 0
3: 11
4: 221
Right 1079328255 11:19512558-19512580 CTGCATTCACATTTTATTTTAGG 0: 1
1: 0
2: 0
3: 44
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079328251 Original CRISPR GTGGTTTTAGCCTACCAGCA GGG (reversed) Intronic
900007646 1:73923-73945 GTGGGTTCAGCGCACCAGCATGG - Intergenic
901079565 1:6576297-6576319 GTGGTTTCAGCCCATCAGGAAGG - Intronic
905758859 1:40536591-40536613 GTGGGTGTAGCGCACCAGCATGG - Intronic
906527709 1:46505663-46505685 GTGGGTGTAGCACACCAGCATGG + Intergenic
907986814 1:59540079-59540101 TTGATTTTAGCCAACCTGCAGGG - Intronic
909170582 1:72288244-72288266 GTGGGTGCAGCGTACCAGCATGG + Intergenic
913455509 1:119026542-119026564 GTGGGTGCAGCCCACCAGCATGG + Intergenic
914982937 1:152431289-152431311 GTGGGTTCAGCGCACCAGCATGG - Intergenic
915152426 1:153844825-153844847 GTGGGTGCAGCCCACCAGCATGG + Intronic
917706482 1:177639851-177639873 GTGGGTGCAGCGTACCAGCATGG + Intergenic
918456656 1:184726933-184726955 GTGTTGTTAGCCTGCCAGCAAGG - Intronic
918898887 1:190386143-190386165 GTGGTTGCAGCGCACCAGCATGG + Intronic
920637787 1:207721270-207721292 GTGGTTGCAGCACACCAGCATGG - Intronic
920639335 1:207736395-207736417 GTGGTTGCAGCGCACCAGCATGG + Intronic
920934708 1:210420567-210420589 ATGGGTTCAGCCCACCAGCATGG + Intronic
920936703 1:210441928-210441950 GTGGGTTCAGCACACCAGCATGG - Intronic
922235249 1:223717719-223717741 GTGCTGTTAGCCTACCAGCCAGG - Intronic
923208510 1:231781072-231781094 GTGGGTTCAGCGCACCAGCATGG + Intronic
1064824468 10:19380987-19381009 GTGGGTGCAGCCCACCAGCATGG - Intronic
1065386289 10:25136749-25136771 GTGGTTTAAGTCTATCAGCCAGG + Intergenic
1065403163 10:25330092-25330114 GTGGGTGTAGCGCACCAGCATGG - Intronic
1068310827 10:55272572-55272594 GTGGTTTTACCATACCGGCCAGG + Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071786133 10:88902357-88902379 ATGGTCCTAGCCTACCAGGATGG + Intronic
1073826770 10:107333014-107333036 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1078032739 11:7769591-7769613 GTGGGTGCAGCATACCAGCATGG + Intergenic
1079328251 11:19512523-19512545 GTGGTTTTAGCCTACCAGCAGGG - Intronic
1079364480 11:19797290-19797312 GTGGTTTTAGGCTCTCAGTATGG + Intronic
1080234295 11:30051285-30051307 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1080786136 11:35476799-35476821 GTGGGTTTAGGCAGCCAGCAAGG - Intronic
1080968312 11:37240783-37240805 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1082942942 11:58727211-58727233 GTGTTTTTATCCTACAAGCTTGG - Intronic
1086025313 11:82283392-82283414 ATGGTTGTAGCACACCAGCATGG + Intergenic
1086476135 11:87176726-87176748 GTGGTTTTAGCCTAATGGCTGGG + Intronic
1088521005 11:110700667-110700689 GTGGGTGCAGCATACCAGCATGG - Intronic
1088530510 11:110803426-110803448 GTGGGTGTAGCGCACCAGCATGG - Intergenic
1089712668 11:120327170-120327192 GTGATGTCAGCCTACCAGCTCGG + Exonic
1090755308 11:129785162-129785184 GTGGTTCTAGGAAACCAGCAGGG - Intergenic
1092554695 12:9544770-9544792 GTGGGTGCAGCGTACCAGCATGG + Intergenic
1097524421 12:60712426-60712448 CTGGTTTTATTCTGCCAGCATGG - Intergenic
1097546035 12:61002638-61002660 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1098191653 12:67955365-67955387 GTGGGTGCAGCGTACCAGCATGG + Intergenic
1098623444 12:72634579-72634601 GTGGTTGCAGCGTACCAGCATGG - Intronic
1100767217 12:97880386-97880408 GTGGGTGTAGCGCACCAGCATGG + Intergenic
1101202213 12:102448602-102448624 GTGGGTGCAGCGTACCAGCATGG + Intronic
1103280663 12:119755618-119755640 GGGCTTTTAGCCTAGCAGCAGGG - Intronic
1104251065 12:127094681-127094703 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1104650334 12:130526868-130526890 GTGGTTCTAGCCTAAAGGCATGG + Intronic
1104881909 12:132077628-132077650 GTGTCTTTAGCCTGACAGCAGGG - Exonic
1105740800 13:23321311-23321333 GTGGTTTTAGGCTTCCAGTAGGG - Intronic
1106396376 13:29384887-29384909 GTGTTTTTAGGCCACCAGCATGG - Intronic
1108657161 13:52545047-52545069 GTGGGTGTAGCGCACCAGCATGG + Intergenic
1110094929 13:71506214-71506236 GTGGGTTCAGCACACCAGCATGG - Intronic
1111569023 13:90054366-90054388 GTGGCTTTTGCCTTCTAGCAAGG - Intergenic
1114983506 14:28194371-28194393 GTGGGTGTAGCACACCAGCATGG + Intergenic
1130412944 15:83662483-83662505 GTGGGTTCAGCGCACCAGCATGG + Intronic
1131711217 15:95058900-95058922 CTGGGTTTAGCCACCCAGCAGGG + Intergenic
1132445906 15:101918187-101918209 GTGGGTTCAGCGCACCAGCATGG + Intergenic
1132834109 16:1943748-1943770 GTTATTTCAACCTACCAGCAGGG - Intergenic
1134857244 16:17530497-17530519 GTGCTTTTACCCTAGCTGCAAGG - Intergenic
1137343165 16:47630087-47630109 GTGGGTGTAGCGCACCAGCAAGG + Intronic
1138940908 16:61788001-61788023 GTGGGTGTAGCGCACCAGCATGG + Intronic
1149456761 17:56794514-56794536 CTGTTTTCAGCCCACCAGCAGGG - Intronic
1149952582 17:61005875-61005897 GTGGGTGCAGCCCACCAGCATGG - Intronic
1150827799 17:68492007-68492029 TTGGTTTTAACCTAACAGCTTGG - Intergenic
1151138511 17:71970302-71970324 GTGGATCTGGCCCACCAGCAAGG + Intergenic
1156551863 18:38027103-38027125 GAGGTTTGAGCCCAGCAGCAGGG - Intergenic
1159334243 18:67043499-67043521 GTGGCTGCAGCCTACCAGCCAGG + Intergenic
1160478166 18:79211777-79211799 GTGGTTTTAATCTACCAACATGG + Intronic
1160639401 19:115518-115540 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1161681276 19:5681023-5681045 CTGGTCTTCGCCTCCCAGCAGGG - Exonic
1162340350 19:10087926-10087948 GTGGATTTAGCCTGCCTGAAAGG + Intronic
1165060224 19:33201483-33201505 GTGGTTTTGTCCTAAGAGCATGG + Intronic
926307644 2:11650533-11650555 GTGGTTTTCATCTACCATCAGGG + Intergenic
930033709 2:47072964-47072986 GTTGTTTGAGCCAAACAGCAGGG + Intronic
930593218 2:53354997-53355019 GTGGGTGCAGCGTACCAGCATGG - Intergenic
930714325 2:54578594-54578616 GTGGTTTTAGGATACAAGTAAGG - Intronic
930923937 2:56792582-56792604 GTGGGTGCAGCATACCAGCATGG + Intergenic
931166141 2:59750843-59750865 GTGGTTATAGCCTTCCTTCATGG + Intergenic
932274441 2:70441592-70441614 GTGGGTGTAGCGCACCAGCATGG - Intergenic
938535472 2:132237188-132237210 GTGGGTGCAGCCAACCAGCATGG + Intronic
941091840 2:161185775-161185797 GTGGGTGTAGCGCACCAGCATGG + Intronic
943292388 2:186090837-186090859 GTGGGTGCAGCCCACCAGCATGG - Intergenic
943317120 2:186403063-186403085 GTGGGTTCAGCGCACCAGCATGG + Intergenic
943873458 2:193032588-193032610 GTGGTTGCAGCGCACCAGCATGG - Intergenic
944002735 2:194860408-194860430 GTGGGTGTAGCGCACCAGCATGG + Intergenic
946260716 2:218488348-218488370 GTGGTTTTTTCCTACGAGGAAGG + Exonic
946839208 2:223803439-223803461 TTGGTTTTTTCCTAACAGCATGG + Intronic
948821439 2:240550426-240550448 GTGGGTGCAGCATACCAGCATGG + Intronic
1169504391 20:6192982-6193004 GTGGGTTTAGCGCACCAGCATGG + Intergenic
1169713972 20:8595178-8595200 GTGGGTGCAGCGTACCAGCATGG - Intronic
1169726413 20:8738459-8738481 GTGGGTGCAGCGTACCAGCATGG + Intronic
1169874093 20:10277834-10277856 GTGGATGTAGCCTATCAGAAAGG + Intronic
1170690108 20:18606840-18606862 GTGGGTGTAGCGCACCAGCATGG + Intronic
1170761072 20:19252050-19252072 GTGGTTGCAGCCCAGCAGCATGG + Intronic
1170883077 20:20314614-20314636 GTGGGTGCAGCCCACCAGCATGG - Intronic
1173091848 20:39979482-39979504 GTGGGTGTAGCACACCAGCATGG + Intergenic
1175639447 20:60615801-60615823 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1176261432 20:64182936-64182958 GTGGTTTTAGCGTACGTGTAGGG + Intronic
1177877512 21:26651732-26651754 GTGGGTGCAGCGTACCAGCATGG + Intergenic
1180824895 22:18855399-18855421 GTGGTTTTAAGCCCCCAGCAAGG + Intronic
1181125314 22:20698550-20698572 GTGGTTTTAAGCCCCCAGCAAGG + Intergenic
1181187834 22:21119149-21119171 GTGGTTTTAAGCCCCCAGCAAGG - Intergenic
1181211364 22:21291344-21291366 GTGGTTTTAAGCCCCCAGCAAGG + Intergenic
1181651272 22:24260517-24260539 GTGGTTTTAAGCCCCCAGCAAGG + Intergenic
1181706109 22:24650222-24650244 GTGGTTTTAAGCCCCCAGCAAGG - Intergenic
1203215585 22_KI270731v1_random:4087-4109 GTGGTTTTAAGCCCCCAGCAAGG - Intergenic
1203275041 22_KI270734v1_random:81304-81326 GTGGTTTTAAGCCCCCAGCAAGG + Intergenic
949889370 3:8721997-8722019 GTGGGTGCAGCGTACCAGCATGG + Intronic
951390786 3:22100746-22100768 GTGGGTGTAGCGCACCAGCATGG + Intronic
951451912 3:22849665-22849687 GTGGGTGTAGCGCACCAGCATGG + Intergenic
951453750 3:22867841-22867863 GTGGTCTTAGACCAGCAGCATGG - Intergenic
952143038 3:30500792-30500814 GGGGTTTTACCCTATGAGCAAGG - Intergenic
952685819 3:36147086-36147108 GTGGGTGTAGCGCACCAGCATGG + Intergenic
958205155 3:90382529-90382551 GTGGGTGTAGCACACCAGCATGG - Intergenic
958496652 3:94851938-94851960 GTGGGTTCAGCGTGCCAGCATGG + Intergenic
959075572 3:101745833-101745855 GTGGGTGTAGCACACCAGCATGG - Intronic
959608061 3:108263600-108263622 GTGGGTGTAGCACACCAGCATGG + Intergenic
960965897 3:123104506-123104528 GTGGTTTTTGTCAACCCGCATGG + Intronic
963458696 3:145578682-145578704 TTGTTTTTACCCTACCAGCTTGG - Intergenic
963568335 3:146960543-146960565 GTGGGTGTAGCACACCAGCATGG - Intergenic
964210041 3:154216612-154216634 GTGGGTGCAGCGTACCAGCATGG - Intronic
964921975 3:161908005-161908027 GTGGGTGCAGCGTACCAGCATGG + Intergenic
965131706 3:164708538-164708560 GTGGGTGTAGCGCACCAGCATGG + Intergenic
967353800 3:188545167-188545189 GTGGGTGCAGCGTACCAGCATGG + Intronic
969972342 4:11060994-11061016 GTGGGTGCAGCCCACCAGCATGG - Intergenic
970241037 4:14009533-14009555 GTGGGTGCAGCCCACCAGCATGG - Intergenic
971668998 4:29530794-29530816 GTGGGTGCAGCCCACCAGCATGG + Intergenic
974116215 4:57582351-57582373 GTGGGTTCAGCGCACCAGCATGG - Intergenic
974204002 4:58675589-58675611 GTGGTTCTCTCCTCCCAGCATGG - Intergenic
974245168 4:59304904-59304926 GTGGGTTCAGCGCACCAGCATGG + Intergenic
974898367 4:67967491-67967513 GTGGGTGTAGCGCACCAGCATGG - Intergenic
975906871 4:79223558-79223580 GTGGGTTCAGCGCACCAGCATGG + Intergenic
978678084 4:111342848-111342870 GTGGGTGTAGCGCACCAGCATGG + Intergenic
981065902 4:140485464-140485486 GTGGGTGCAGCATACCAGCATGG + Intronic
981113064 4:140957956-140957978 GTGGGTGTAGCGCACCAGCATGG + Intronic
982559310 4:156910135-156910157 TTGGTTTTAGCCTCCCTGCTTGG + Intronic
983688351 4:170437339-170437361 GTGGGTGTAGCGCACCAGCATGG + Intergenic
985872647 5:2569616-2569638 GTCATTCTAGCCTACCAGCAGGG + Intergenic
986108603 5:4686887-4686909 ATGGTTTCAGCATACCAGCATGG + Intergenic
986617794 5:9638199-9638221 CTGGGTTTAGCCACCCAGCAAGG + Intronic
988232749 5:28502131-28502153 GTGGGTTCAGCGCACCAGCATGG - Intergenic
988254546 5:28804715-28804737 GTGGGTTCAGCGCACCAGCATGG + Intergenic
988257667 5:28843080-28843102 GTGGGTTCAGCGCACCAGCATGG - Intergenic
988260030 5:28874570-28874592 GTGGGTTCAGCGCACCAGCATGG - Intergenic
989618643 5:43363171-43363193 GAGATTTGAGTCTACCAGCATGG + Intergenic
990032541 5:51278974-51278996 GTAGTCTTAGTCTATCAGCACGG - Intergenic
990101288 5:52192547-52192569 GTGGGTGTAGCGCACCAGCATGG - Intergenic
992652418 5:78872728-78872750 GTGGGTGCAGCGTACCAGCATGG + Intronic
993052206 5:82938364-82938386 GTGGGTGTAGCGCACCAGCATGG + Intergenic
994270085 5:97766696-97766718 GTGGGTTCAGCGCACCAGCATGG - Intergenic
994445053 5:99861847-99861869 GTGGGTGCAGCGTACCAGCACGG + Intergenic
996147905 5:119997782-119997804 GTGGGTGCAGCCCACCAGCATGG - Intergenic
997134098 5:131307144-131307166 GTGGGTGCAGCATACCAGCATGG - Intronic
999059246 5:148615593-148615615 GTGGGTGTAGCACACCAGCATGG + Intronic
999743454 5:154574251-154574273 GTGGTTTAAGCCTTCCAGTCTGG - Intergenic
999810450 5:155122240-155122262 GTGGGTGTAGCACACCAGCATGG - Intergenic
1000127473 5:158260367-158260389 GTGGTTGCAGCGCACCAGCATGG + Intergenic
1001444222 5:171770739-171770761 GTGGGTGCAGCCCACCAGCATGG - Intergenic
1001693699 5:173653663-173653685 CTGGATCTAGCCAACCAGCAGGG + Intergenic
1002746752 6:63925-63947 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1003726384 6:8770574-8770596 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1004339164 6:14792951-14792973 ATGGTTTTAGCCTAAAATCATGG - Intergenic
1004921679 6:20381825-20381847 GTGGTTTTGGTCTGTCAGCAAGG + Intergenic
1007129840 6:39460437-39460459 GTGGGTGTAGCGCACCAGCATGG + Intronic
1007928518 6:45669451-45669473 GTGGGTGTAGCGCACCAGCATGG - Intergenic
1007986490 6:46212305-46212327 GTGGGTGTAGCGCACCAGCATGG - Intergenic
1008385740 6:50888026-50888048 GTGGTTGCAGCGCACCAGCATGG - Intergenic
1008800527 6:55363515-55363537 GTGGGTTCAGCGCACCAGCATGG - Intronic
1011371811 6:86645232-86645254 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1011959637 6:93071070-93071092 CTGATTTGAGCCTACCATCATGG + Intergenic
1012284858 6:97376616-97376638 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1013886124 6:114970465-114970487 GTGGGTTCAGCACACCAGCATGG - Intergenic
1013895845 6:115086634-115086656 GTGGGTGCAGCCCACCAGCATGG + Intergenic
1013988791 6:116229162-116229184 GTGGTTTTTGCTTACTAGCTTGG - Intronic
1015677382 6:135765544-135765566 GTGGGTGCAGCATACCAGCATGG - Intergenic
1020949233 7:14653568-14653590 GTGGGTTCAGCGCACCAGCATGG + Intronic
1025570326 7:62553942-62553964 GTGGTTGCAGCCCACCAGGATGG + Intergenic
1025734554 7:64135508-64135530 GTGGTTTCAGTCCCCCAGCAAGG - Intronic
1026160396 7:67863480-67863502 GTGGTTTCAGTCCCCCAGCAAGG - Intergenic
1030133206 7:106220552-106220574 GTTGTTTAAGCCGCCCAGCACGG - Intergenic
1032553609 7:132808813-132808835 GTGGGTGCAGCGTACCAGCATGG - Intronic
1032943356 7:136821889-136821911 GTGGGTGCAGCCCACCAGCATGG + Intergenic
1034093813 7:148388222-148388244 GTGGGTGCAGCGTACCAGCATGG - Intronic
1036022422 8:4860324-4860346 GTGGGTGCAGCGTACCAGCATGG + Intronic
1039136318 8:34327066-34327088 GTGGTTTTAGCCTCTGAGCAAGG + Intergenic
1040073717 8:43208524-43208546 GATGTGTTAGCCTACCTGCATGG - Intergenic
1043759509 8:84049976-84049998 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1044049576 8:87483978-87484000 GTGGGTGCAGCGTACCAGCATGG - Intronic
1044060630 8:87630741-87630763 GTGGTTGCAGCACACCAGCATGG + Intergenic
1044365522 8:91341065-91341087 GTGGGTGTAGCGCACCAGCATGG - Intronic
1046586611 8:116155844-116155866 TTGGTTTTAGTATCCCAGCAAGG + Intergenic
1048626388 8:136190280-136190302 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1050659601 9:7868463-7868485 GTGGGTGTAGCGCACCAGCATGG + Intronic
1053577999 9:39372369-39372391 GTGGGTGCAGCATACCAGCATGG - Intergenic
1053742631 9:41155896-41155918 GTGGGTGTAGCGCACCAGCATGG + Intronic
1054099583 9:60931154-60931176 GTGGGTGCAGCATACCAGCATGG - Intergenic
1054120980 9:61206778-61206800 GTGGGTGCAGCATACCAGCATGG - Intergenic
1054347900 9:63985734-63985756 GTGGGTGCAGCCCACCAGCATGG + Intergenic
1054445627 9:65312078-65312100 GTGGGTGCAGCCCACCAGCATGG + Intergenic
1054484643 9:65709430-65709452 GTGGGTGCAGCCCACCAGCATGG - Intronic
1054685712 9:68275403-68275425 GTGGGTGTAGCACACCAGCATGG - Intronic
1054700679 9:68409788-68409810 GTGGGTGCAGCCCACCAGCATGG + Intronic
1055247149 9:74260216-74260238 GTGGGTGCAGCATACCAGCATGG + Intergenic
1056387934 9:86114692-86114714 GAGATTTTACCCTACCAGGAAGG - Intergenic
1056888525 9:90467966-90467988 GGGCTTTTAGCCAAGCAGCAGGG - Intergenic
1057174605 9:92986863-92986885 TTGTTTTTACCCTACCAGCTCGG - Intronic
1057588136 9:96347803-96347825 TGGGTTTTGGCCTATCAGCAAGG - Intronic
1058559608 9:106212122-106212144 GTGGGTGCAGCCCACCAGCATGG - Intergenic
1061626484 9:131843547-131843569 GTGGCTTCAGCCTGCCTGCAAGG - Intergenic
1061930453 9:133830069-133830091 GTGGTTTTAGGACACCAGCGAGG - Intronic
1190710942 X:53069475-53069497 GTGGTAGGAGCCTACCAGCTGGG + Intronic
1190910161 X:54764337-54764359 GTGGGTGCAGCCCACCAGCATGG - Intronic
1191727481 X:64296658-64296680 GTGGGTGTAGCGCACCAGCATGG - Intronic
1192334695 X:70207974-70207996 GTGGTTTTAGCATATTTGCAAGG - Intergenic
1192717768 X:73661951-73661973 GTGGGTTCAGCGCACCAGCATGG + Intronic
1193464709 X:81834030-81834052 GTGGGTGTAGCACACCAGCATGG + Intergenic
1193900160 X:87166915-87166937 GTGGGTTCAGCGCACCAGCATGG + Intergenic
1193924178 X:87464944-87464966 CTGGTTCTAGCCACCCAGCAGGG - Intergenic
1193950781 X:87795496-87795518 CTGGATTTAGCCACCCAGCAGGG - Intergenic
1194038463 X:88910445-88910467 GTGGTTGCAGCGCACCAGCATGG + Intergenic
1194170533 X:90575224-90575246 TTGCTTTTACCCTACCAGCTCGG - Intergenic
1195569451 X:106382313-106382335 GTGGGTGCAGCGTACCAGCATGG - Intergenic
1195619042 X:106934910-106934932 GTGGGTGTAGCGCACCAGCATGG + Intronic
1197369439 X:125609034-125609056 GTGGGTGTAGCGCACCAGCATGG - Intergenic
1197649604 X:129050298-129050320 GTGGGTGTAGCACACCAGCATGG + Intergenic
1198043446 X:132876719-132876741 CTGGTTCCAGCCCACCAGCAGGG + Intronic
1198267946 X:135027909-135027931 GTGGGTGCAGCCCACCAGCATGG + Intergenic
1199359731 X:146904673-146904695 GTGGGTGCAGCGTACCAGCATGG + Intergenic
1200516776 Y:4152984-4153006 TTGCTTTTACCCTACCAGCTCGG - Intergenic
1200900408 Y:8425718-8425740 GTGGTTGCAGCACACCAGCATGG + Intergenic
1201526934 Y:14946803-14946825 GTGGGTTCAGCGCACCAGCATGG - Intergenic
1202025241 Y:20515199-20515221 GTGGGTTCAGCGCACCAGCATGG + Intergenic