ID: 1079333594

View in Genome Browser
Species Human (GRCh38)
Location 11:19552540-19552562
Sequence GACCCAAATGGGATTCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079333594_1079333598 11 Left 1079333594 11:19552540-19552562 CCAGCCTGAATCCCATTTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1079333598 11:19552574-19552596 GAAAAACTCCATTTGTCACAAGG 0: 1
1: 0
2: 0
3: 21
4: 216
1079333594_1079333599 17 Left 1079333594 11:19552540-19552562 CCAGCCTGAATCCCATTTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1079333599 11:19552580-19552602 CTCCATTTGTCACAAGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079333594 Original CRISPR GACCCAAATGGGATTCAGGC TGG (reversed) Intronic
901319676 1:8332117-8332139 TGCCCAAATGTAATTCAGGCCGG + Intronic
902973687 1:20073491-20073513 GCCCCAAGTGGGTTTCAGCCAGG - Intronic
905180336 1:36161399-36161421 GTCCCCACTGGGATGCAGGCAGG + Intronic
905259575 1:36707977-36707999 GAGCCAAAGGGGACCCAGGCAGG - Intergenic
906395488 1:45460055-45460077 CCCCCAAATGGGAGACAGGCAGG + Intronic
907153097 1:52306937-52306959 GACAGACATGGGATCCAGGCTGG + Intronic
916836641 1:168552854-168552876 GACCCTAAAGGGAGACAGGCCGG + Intergenic
917734407 1:177907419-177907441 GACCCAAAAGGGACTGAGGGAGG + Intergenic
1063019094 10:2108226-2108248 GACAGCAATTGGATTCAGGCTGG - Intergenic
1064565761 10:16637320-16637342 GACCAAAATGGGGTTTACGCAGG + Intronic
1065137946 10:22691164-22691186 GACACAAATGCAATTCAGGATGG + Intronic
1066344291 10:34568107-34568129 GACTCAAATGTGGTTCAGGGTGG - Intronic
1068216543 10:53989565-53989587 GAGACAAATGGGAGTCAGGCTGG + Intronic
1071434737 10:85636982-85637004 GACCCAAATGGCAATCAAGAAGG + Intronic
1073391693 10:103182760-103182782 GACCAAAATAAGTTTCAGGCTGG - Intronic
1074911117 10:117910006-117910028 TACTCAAATGAGATTCAGGTAGG + Intergenic
1075722639 10:124596483-124596505 CACCTAAAAGGGATTCATGCAGG - Intronic
1075906167 10:126083694-126083716 GACCCTAATGAGCTGCAGGCAGG + Intronic
1076709289 10:132322744-132322766 ACCCCAAATGGGTGTCAGGCAGG - Intronic
1077560573 11:3257787-3257809 GACTCAGATGGGATGCAGGTGGG - Intergenic
1077566465 11:3303593-3303615 GACTCAGATGGGATGCAGGTAGG - Intergenic
1078421998 11:11220093-11220115 GAACGGAATGGGATTCTGGCAGG + Intergenic
1079333594 11:19552540-19552562 GACCCAAATGGGATTCAGGCTGG - Intronic
1080079618 11:28200878-28200900 GAAACAAAGGGGATTCAAGCAGG - Intronic
1084083509 11:66843973-66843995 CACCCTGATGGGCTTCAGGCTGG + Exonic
1084473556 11:69376589-69376611 GTCTCAAATGGGCCTCAGGCTGG + Intergenic
1085885839 11:80520795-80520817 GACACAAATGAAAGTCAGGCTGG - Intergenic
1086208005 11:84283657-84283679 GAAGCAAATAGGATTCAGGGAGG - Intronic
1091187099 11:133656734-133656756 GATCCAAATGCCATTCAGCCAGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1102918858 12:116776740-116776762 GAGACAGATGGGATTCAGTCTGG + Intronic
1105279367 13:18954314-18954336 GACCCATCTGGGACTCAGGAGGG - Intergenic
1107034402 13:35885204-35885226 TACCCAAAGTGGATTCAGGTTGG - Intronic
1109144601 13:58763357-58763379 GACCCAAATGGAATTCTCCCTGG + Intergenic
1112184152 13:97112162-97112184 GACCCACATGGGAGGCATGCAGG + Intergenic
1116759049 14:48988040-48988062 GACCAAAATCAGTTTCAGGCTGG + Intergenic
1119207242 14:72803553-72803575 GACCTCTATGGGATCCAGGCTGG - Intronic
1119484137 14:74977418-74977440 GACCCAGAGGGGAGTCTGGCAGG + Intergenic
1119962171 14:78871469-78871491 AACCCAAAGGGGATTCTAGCTGG - Intronic
1129050261 15:72775418-72775440 GAGCCAAACAGGATTCATGCTGG + Intronic
1132630351 16:914316-914338 GACCCAAATGGGGAGAAGGCTGG + Intronic
1136673761 16:31880546-31880568 AACCCAATAGTGATTCAGGCAGG - Intronic
1139352904 16:66348408-66348430 AACCCAGATGGGAGACAGGCAGG + Intergenic
1145144305 17:20467722-20467744 GAACCAAATATGCTTCAGGCTGG - Intergenic
1146636804 17:34512490-34512512 CACCCTAAAGGGCTTCAGGCAGG + Intergenic
1149958651 17:61082009-61082031 AACCAAAATGGGAAACAGGCAGG + Intronic
1151563983 17:74886925-74886947 GTCCCAAATGTGAATCATGCAGG - Intronic
1155183326 18:23367021-23367043 AACCAAAAAGGGATTCAGGGAGG - Intronic
1155881678 18:31157029-31157051 CAGCGAAATGTGATTCAGGCTGG - Intronic
1156275237 18:35577791-35577813 AACGCAAATTGGATGCAGGCAGG - Intergenic
1163430133 19:17262519-17262541 GAGCCACATGGGACTCAGGATGG + Intronic
1166554161 19:43687090-43687112 GAGCCAAAGGGGAGACAGGCAGG - Intergenic
925477522 2:4234098-4234120 AACCTAACTGGGATTCTGGCAGG + Intergenic
930871962 2:56179926-56179948 GCCCCCAAAGGGATTTAGGCAGG + Intergenic
931442583 2:62301190-62301212 GACCCACAGGGGACTCAGACTGG - Intergenic
933369498 2:81397042-81397064 GACCCAAATGGGCTTCTTGGAGG - Intergenic
936062560 2:109305056-109305078 GACCCAAATAACATTCAGACGGG - Intronic
938337988 2:130516246-130516268 TCCCCAAATGGAATTTAGGCTGG + Intergenic
938351850 2:130604492-130604514 TCCCCAAATGGAATTTAGGCTGG - Intergenic
938627011 2:133121442-133121464 TACCCAGATGGGATTCTGGGTGG + Intronic
940011505 2:149059906-149059928 GACCTAAAGGTGGTTCAGGCAGG + Intronic
940808815 2:158219688-158219710 TACCCAACTTGGATGCAGGCAGG - Intronic
946545271 2:220734354-220734376 GAGAAAGATGGGATTCAGGCAGG + Intergenic
1170042723 20:12054961-12054983 AACCCAAGTTGGAATCAGGCTGG + Intergenic
1171011426 20:21511306-21511328 GACCCAGACGGGAAACAGGCCGG + Exonic
1172580605 20:36044392-36044414 GACCAAGATGGGCTTCAGGGAGG - Intergenic
1172802444 20:37585743-37585765 GAGAGAAATGGGATTAAGGCAGG - Intergenic
1174199433 20:48797258-48797280 AAGCCAAATGGGAATCAAGCTGG + Intronic
1181182906 22:21079696-21079718 GGCCCAAGTGGGGTACAGGCAGG + Intergenic
1182755263 22:32673991-32674013 GACTCAAAGGGGATAAAGGCGGG + Intronic
1185371625 22:50463519-50463541 GACCCAAATGCCTTTCAGGTGGG + Intronic
954660280 3:52223404-52223426 GAACCAACTGGCATTCAGCCAGG + Exonic
954990365 3:54835793-54835815 GTCCAAAATGAGATTAAGGCTGG - Intronic
964491453 3:157240861-157240883 GATCCAAGTGGGACTCAGGTGGG - Intergenic
966927347 3:184653633-184653655 GATTTAAATGGCATTCAGGCTGG + Intronic
972809881 4:42571842-42571864 GCCCCAAATTGGATTCATGATGG - Intronic
974014610 4:56637504-56637526 AACCCAGATGGGGTTTAGGCAGG + Intergenic
975510392 4:75188498-75188520 GTCCCAGATGGGATTTAGTCTGG + Intergenic
976474504 4:85468316-85468338 GACTCAACTGGGGCTCAGGCTGG - Intergenic
981972429 4:150680410-150680432 GACACAAATTGCATTCAGGCAGG + Intronic
983885279 4:172974694-172974716 GACAGGCATGGGATTCAGGCTGG - Intronic
986972350 5:13351913-13351935 GATCCAAATGAGATTCAGTTGGG + Intergenic
989332676 5:40278227-40278249 GACCCAGATTGCATTCTGGCTGG - Intergenic
992823586 5:80524262-80524284 TACCCAAATGGAATATAGGCTGG - Intronic
1004199300 6:13532991-13533013 GAACCAAAAGGGATCCAGGTGGG + Intergenic
1006338293 6:33432153-33432175 GACCCAAGTGGTATTCTGGAGGG - Exonic
1007226042 6:40315361-40315383 GGCCCAAATAGGATTGAGGAAGG - Intergenic
1008447589 6:51610768-51610790 GCCCCAAATGGGATTCTATCTGG - Intergenic
1013597779 6:111675495-111675517 GAATTAAAAGGGATTCAGGCCGG + Intronic
1019218335 6:170457691-170457713 GACCCAAAGGGGATAGGGGCAGG + Intergenic
1019605011 7:1905719-1905741 GACACAGATGGGGGTCAGGCCGG - Intronic
1024077152 7:45827319-45827341 GAAAGAAATGGGATTCGGGCTGG + Intergenic
1024682537 7:51707922-51707944 GGCAAAAATGGCATTCAGGCCGG - Intergenic
1026330592 7:69348993-69349015 GATCCAAATTGGATAAAGGCTGG + Intergenic
1026977441 7:74507122-74507144 GACCCAGCTGGGCTTCAGGTTGG + Intronic
1026990739 7:74583959-74583981 GACCCAGCTGGGAGTCAGGGAGG - Intronic
1028341150 7:89721018-89721040 GACCCAGATGGCATTCAGTCAGG - Intergenic
1032151824 7:129435181-129435203 GAGCGAGACGGGATTCAGGCAGG + Intronic
1034396446 7:150829244-150829266 GCCCCAAGAGGGATTCAGGGTGG + Intronic
1035458435 7:159024267-159024289 GCCCCAAATAGAATTCTGGCAGG + Intergenic
1037582902 8:20256206-20256228 GACCCACATGGGAAGCAGCCTGG + Intronic
1037784850 8:21896467-21896489 GCCCCTGATGTGATTCAGGCAGG - Intergenic
1038885275 8:31656240-31656262 GACCCAAAAAGGATTCAGGAGGG + Intronic
1041379209 8:57235409-57235431 GGCCCAAATGGAATACAGGATGG - Intergenic
1047657272 8:126991643-126991665 GAGTCAAATGGGAATGAGGCTGG + Intergenic
1048295677 8:133211884-133211906 GGCACAGATGGGATTCAGGGGGG + Intronic
1052790814 9:32874012-32874034 GACCTAAATGGGAAGCAGGCAGG - Intergenic
1057263552 9:93599421-93599443 GACCCCATTGGGATCCAGGCAGG + Intronic
1057273528 9:93664224-93664246 GACCCACCTGGGAGTCAGGAGGG + Intronic
1058985391 9:110205173-110205195 AGCCCAAATGAGATCCAGGCTGG + Intronic
1061664046 9:132149946-132149968 GACCCATCTGGGTTTCAGGAGGG + Intergenic
1062396209 9:136353858-136353880 GCCCCAACTGGCACTCAGGCTGG + Intronic
1186771504 X:12822487-12822509 GACCCATATGGGATCCTGGAAGG - Intronic
1189478419 X:41374900-41374922 ACCCCAAATGCGCTTCAGGCTGG - Intergenic
1191921397 X:66260538-66260560 GAGCCAAACCGGTTTCAGGCTGG - Intronic
1193333334 X:80259810-80259832 GATACAAATGGAATTCAGGGAGG - Intergenic