ID: 1079339429

View in Genome Browser
Species Human (GRCh38)
Location 11:19599777-19599799
Sequence TTTGAGAAACAGCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079339421_1079339429 26 Left 1079339421 11:19599728-19599750 CCAATCTTTTTGAAGTGTCAGGT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG 0: 1
1: 0
2: 2
3: 29
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079339429 Original CRISPR TTTGAGAAACAGCATGAGGG AGG Intronic
900140140 1:1136415-1136437 TTTGAGAAACACGGTGATGGGGG + Intergenic
900339500 1:2181291-2181313 TCTGAGAAATAGCCTGGGGGAGG - Intronic
901157996 1:7153644-7153666 TGTGAGAAAGAGCAGGTGGGAGG - Intronic
903577270 1:24346691-24346713 TTTGGGAAAGCCCATGAGGGAGG - Intronic
903740442 1:25555652-25555674 TTAGAGACAAAGCAAGAGGGTGG - Intronic
903930882 1:26861898-26861920 TCTGAGAAACAGGCTGGGGGAGG + Intergenic
904703034 1:32369695-32369717 TTTGAGCAATGGCATGAAGGAGG - Intronic
906575287 1:46884055-46884077 GTAGAGAAAGAGCATGAGGTAGG + Intergenic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
912164867 1:107031063-107031085 TTTAAGAATGAGGATGAGGGAGG - Intergenic
914417595 1:147498271-147498293 TTTGACAAACACCAGGAGTGAGG - Intergenic
915146644 1:153799636-153799658 TCTGAGAGACAGCAAGGGGGTGG - Intergenic
915387215 1:155506398-155506420 TTTAAGAAACAACATTAGGCTGG + Intronic
916402683 1:164466169-164466191 CTTGAGTAACAGGAGGAGGGAGG - Intergenic
916951641 1:169786095-169786117 TTTCAGAAACACAAAGAGGGAGG + Intronic
918188439 1:182148355-182148377 TGTGAGTAACAGCATGTGGGGGG + Intergenic
918901122 1:190419613-190419635 TATGAGAAACTGGATGAAGGAGG - Intronic
919185480 1:194142419-194142441 TTTGATGAACAGGATGAGTGAGG - Intergenic
920266068 1:204723801-204723823 TTTGCCAAACAGAATGAGTGAGG + Intergenic
921802049 1:219412400-219412422 TTGTAGAAATAGCATGATGGAGG - Intergenic
922703960 1:227779211-227779233 CATGAGAAACAGTATGAAGGCGG - Intronic
922754270 1:228086217-228086239 ATTTTGAAACAGCATGAGGCTGG + Intronic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924492116 1:244548590-244548612 TTTGTGAAATACCATGAGAGTGG - Intronic
924802119 1:247335286-247335308 TTTGAGAAGCAGCCCCAGGGAGG + Intergenic
1064961974 10:20975399-20975421 TTTGAGAAACAGCAATAAGTTGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068767310 10:60778310-60778332 CTAGAGAAAAAGCAGGAGGGCGG - Intronic
1069061748 10:63901996-63902018 TTTGGGAAATAGGATGAGCGAGG + Intergenic
1069625843 10:69867217-69867239 TTTGAGAAAGAGGCTGTGGGTGG + Intronic
1070090204 10:73277296-73277318 TTTGAGAAACACCATAATGAAGG + Exonic
1070339574 10:75484757-75484779 TGTGAGACACAGCAAGAAGGTGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1073573481 10:104600716-104600738 GTTGAGAGACAGCAGAAGGGTGG + Intergenic
1075566659 10:123509878-123509900 TTTGAGAAACACCAGCCGGGTGG - Intergenic
1076398567 10:130160950-130160972 TTTCATAAACAGCATGCAGGGGG - Exonic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1078846353 11:15122276-15122298 TTAGACAGACAGCATGAGGTGGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1080702609 11:34657138-34657160 TTTGAGAAACAGCTGCAGAGGGG - Intronic
1080740347 11:35058051-35058073 GATGAGAAACACTATGAGGGAGG + Intergenic
1081361939 11:42190638-42190660 TTTGACAAAGAGCATGATGCAGG + Intergenic
1083254404 11:61487276-61487298 TTTGAGAAACAGACTGAGACTGG + Intronic
1084162779 11:67359143-67359165 TTTGTGAAACAGCAGGTGAGAGG - Intronic
1086145064 11:83542659-83542681 TATGAGTGGCAGCATGAGGGAGG + Intronic
1087025557 11:93646021-93646043 TTTGGGAGAAAGCATGAAGGAGG - Intergenic
1087311037 11:96543669-96543691 TTAGGGAAACAGTATTAGGGTGG + Intergenic
1090460417 11:126886803-126886825 TTTGAATAACAGCTGGAGGGAGG + Intronic
1090699817 11:129283372-129283394 TCTGAGAAACCTCAGGAGGGAGG - Intergenic
1091333970 11:134752987-134753009 TTTGAAAAACAGCATTACCGGGG - Intergenic
1095830341 12:46578982-46579004 TTTTACAAACAGAATGAGAGAGG - Intergenic
1097894858 12:64814728-64814750 TTTTAGAAACAGTATAAGCGTGG - Intronic
1098385776 12:69917017-69917039 TTTGAGGAACAGAGAGAGGGAGG - Intronic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1099479693 12:83150436-83150458 TCTGCAAAACAGAATGAGGGGGG - Intergenic
1100472200 12:94903639-94903661 TTTGAAAAATACCATGAGAGGGG + Intronic
1100743226 12:97618169-97618191 TTTGACAAACAGCAAGTGGCAGG + Intergenic
1102614394 12:114140352-114140374 TTTGAGAATGAGGATAAGGGAGG + Intergenic
1102633929 12:114305971-114305993 TCTGAGTTCCAGCATGAGGGAGG + Intergenic
1102719446 12:115003539-115003561 TTTTAGAAAGATCATGAGGCAGG - Intergenic
1102845459 12:116176786-116176808 ATTGAGAAAAAGCAAGGGGGAGG + Intronic
1104487105 12:129161158-129161180 TCTGAGGAACAGCAGGAAGGAGG + Intronic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1107405806 13:40112020-40112042 TTTGAGAAACATCTAGAGTGTGG - Intergenic
1107715570 13:43196181-43196203 CTTGGGAAATAGCTTGAGGGTGG - Intergenic
1108027958 13:46198567-46198589 TTTGAACAAAAACATGAGGGAGG + Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1109283300 13:60382076-60382098 GCTGAAAAACAGCATGTGGGAGG - Intergenic
1109315642 13:60745843-60745865 TTTGAAAAACTGAATGATGGTGG + Intergenic
1110426046 13:75368740-75368762 TTTGATAAAGAGAATGAGGCCGG + Intronic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1110692448 13:78446844-78446866 TTTGAGATACATCATGACGAGGG + Intergenic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1111426988 13:88098472-88098494 TTTGAGAAACATCAAGTGTGAGG + Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116636958 14:47408879-47408901 TTTGAGAAAAGACATGATGGAGG + Intronic
1117124222 14:52603833-52603855 TATGAAAAACAGTATGAGGCTGG - Intronic
1117413774 14:55475039-55475061 TTCCAGCAAGAGCATGAGGGGGG - Intergenic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1120823481 14:88934235-88934257 TTTGAGAAGCAGCAAGCGGTGGG - Intergenic
1121217415 14:92259345-92259367 TTTGGAAAACATCAAGAGGGAGG - Intergenic
1122951331 14:105046876-105046898 TGGAAGAGACAGCATGAGGGGGG - Intergenic
1124809336 15:32918919-32918941 TTTTAGACACAGCAGGAAGGAGG + Intronic
1125112611 15:36050955-36050977 TTTTAAAAACTGCTTGAGGGTGG + Intergenic
1126603424 15:50451835-50451857 TCTGAGAATGGGCATGAGGGAGG + Intronic
1126727900 15:51651601-51651623 CTTGAGATGCAGCATGAGTGAGG + Intergenic
1127706332 15:61550579-61550601 TTTAAGAAAAAGAATGAGGGAGG - Intergenic
1128775734 15:70318693-70318715 TTTGGGAAGCAACAAGAGGGAGG + Intergenic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1129591588 15:76919945-76919967 TTTCAGAAACAGCACGAGATGGG + Intergenic
1133004282 16:2869548-2869570 TTTGAGGAAGAGCAGGAGAGAGG + Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1134654480 16:15937720-15937742 TTTGAGAAAATGAATGAGAGAGG - Intergenic
1135791912 16:25404698-25404720 ATTGAGAAACATCATGTGGCAGG - Intergenic
1137323122 16:47406850-47406872 TTTGAGAAATAACTTGAGGGAGG + Intronic
1139185761 16:64804365-64804387 TTTTATAAACAGCATGGGGCAGG + Intergenic
1139267636 16:65655297-65655319 TTTGAGAGAGAGCAAGAGAGAGG + Intergenic
1140300020 16:73748534-73748556 CATGAGCAACAGCATAAGGGAGG - Intergenic
1140451802 16:75076866-75076888 TGTGAGACACAGCAAGATGGTGG + Intronic
1140624280 16:76772667-76772689 TTTCAGACACTGCATTAGGGTGG + Intergenic
1142687842 17:1587959-1587981 ATTGAGAAACAGAATTAAGGGGG - Intronic
1145952787 17:28832776-28832798 TTTGAATAACAGCAAGAAGGGGG + Intronic
1146567894 17:33929017-33929039 TTTGAGTAAAAGCATGCGAGTGG - Intronic
1147242733 17:39101264-39101286 TTTGAGAAAGGGAAGGAGGGAGG + Intronic
1147529026 17:41256036-41256058 CTTGTGAATCAGCTTGAGGGAGG + Exonic
1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG + Exonic
1147530521 17:41271981-41272003 CTTGTGAATCAGCTTGAGGGAGG + Intergenic
1147530937 17:41276371-41276393 TTTGTGAATCAGCTTGAGTGAGG + Exonic
1147616753 17:41833733-41833755 TTTGGGACACAGCATGTTGGTGG + Intronic
1148550381 17:48546769-48546791 TCTGAGTAGAAGCATGAGGGTGG + Intergenic
1150311437 17:64131883-64131905 TTTGAGAAAAAGCACCAGAGGGG - Intergenic
1150616132 17:66773648-66773670 TTTGAGAAAAAGCCAGAGGCCGG - Intronic
1150842413 17:68621152-68621174 TTTCACAAACAGCATGAGGTTGG - Intergenic
1152052342 17:77990463-77990485 TTTGAGAAACGGCAAGATGATGG - Intergenic
1152608689 17:81305298-81305320 TGTGGGAAACAGCAGGAGGCCGG + Intergenic
1153250370 18:3115857-3115879 TGTGAGAACCGGCCTGAGGGAGG + Intronic
1153674134 18:7440508-7440530 TTTGAGAAAAAGCATGTGTAGGG + Intergenic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1154018346 18:10639645-10639667 TTGGAGGAACAGCATAATGGTGG - Intergenic
1155595136 18:27477102-27477124 TATGAGCAAAAGCATGAAGGTGG + Intergenic
1156129522 18:33953504-33953526 TTTGGGAAACAGAATAAAGGAGG + Intronic
1156749463 18:40433499-40433521 ATTGAGAAATAGCATGAGATTGG - Intergenic
1158052142 18:53234982-53235004 TTTGAAAAACCTCATGAGGATGG + Intronic
1158973367 18:62688658-62688680 TTGGGGAAAGAGCATGGGGGTGG + Intergenic
1162553353 19:11370995-11371017 TTTGAGAAAAGGCCTGAGAGAGG - Intergenic
1163031360 19:14546146-14546168 TTTCAGAAAAATCATGGGGGCGG + Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1164458608 19:28429076-28429098 TATGGGAACCAGCGTGAGGGAGG + Intergenic
1164878854 19:31713983-31714005 ATTGAGAGACAACCTGAGGGTGG - Intergenic
1166290258 19:41858959-41858981 TTTTAGAAACAGTATGAGATAGG + Intergenic
1166612239 19:44209146-44209168 TTAGAGAAATACCATGTGGGTGG - Intronic
925400876 2:3571767-3571789 GTGGTGAAAAAGCATGAGGGAGG + Intergenic
925689914 2:6511295-6511317 TTTGACAAACAGTAAGAAGGTGG - Intergenic
926072775 2:9913566-9913588 TTTGAGAAAGGGGAAGAGGGAGG - Intronic
927493721 2:23538025-23538047 TTTGAGAATTAGAACGAGGGTGG + Intronic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
928461091 2:31473340-31473362 TTTGAGAAAGAGAATGAAGGAGG + Intergenic
928495044 2:31822918-31822940 TTTGGAGAACAGCCTGAGGGAGG - Intergenic
928756840 2:34536665-34536687 TTAGAGAAAAAACATGAAGGTGG - Intergenic
928824664 2:35405614-35405636 TTTGGGTTACATCATGAGGGTGG - Intergenic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
930006274 2:46899603-46899625 TTTAAGAAAAAGCATGGGGGAGG + Intergenic
930162199 2:48169796-48169818 TATGGGACACAGCAAGAGGGTGG + Intergenic
930868910 2:56150227-56150249 TCTGAGGAACTGCATGAAGGTGG - Intergenic
930920123 2:56743076-56743098 TATGAGAGACAGGATGGGGGAGG + Intergenic
932743097 2:74307039-74307061 CTTGGGAAACAGCCTGAGGGAGG - Intronic
932792298 2:74664956-74664978 TTTGATGAATCGCATGAGGGGGG + Intronic
932939431 2:76145072-76145094 CTTGAGAAACAGCACCAGTGTGG + Intergenic
933881907 2:86678115-86678137 TTTGAGGAAAAGCCTGAAGGAGG + Intronic
935959921 2:108414667-108414689 TTTGAGGAAAAGCAAGAAGGCGG + Intergenic
936786651 2:116101380-116101402 TTGGAGAAAAAGCTTGAGGTAGG - Intergenic
937226392 2:120372353-120372375 TTTGAGAGAAAGCAGGAGAGAGG + Intergenic
937621753 2:123996333-123996355 CTTGAGAAAAAGCAGGAAGGGGG - Intergenic
937907485 2:127059295-127059317 TGTGAGAGAGAGCAGGAGGGTGG + Intronic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
940034044 2:149294672-149294694 TTTGAGAAACATCATCAGATTGG + Intergenic
940038450 2:149333566-149333588 TTTTAAAAACTGCATGAGGTAGG - Intronic
940254435 2:151714111-151714133 ATTGAGAGACAGGATGGGGGTGG - Intronic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
941887885 2:170548146-170548168 TTTGAGTAAAGGCTTGAGGGTGG + Intronic
942725382 2:179001301-179001323 TTTGAGAAACAGCTTAATAGAGG + Intronic
943724553 2:191239447-191239469 CATGAGAAACTCCATGAGGGTGG - Intergenic
944301971 2:198133755-198133777 TTAGAGTAAAAGCATGAGTGAGG - Intronic
945501912 2:210586410-210586432 TTTGAAACACAGCATGATAGAGG + Intronic
945773465 2:214075439-214075461 ATTGAGAAAGGGCATGAAGGAGG + Intronic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
946653051 2:221914879-221914901 TTTCAGAAACAGCATGGGGGAGG - Intergenic
1168954229 20:1823639-1823661 TTAGAGAAACAGCAGGTGGTAGG - Intergenic
1169360031 20:4940356-4940378 TTTGAGAAATAGGAGGAGTGTGG + Intronic
1169363522 20:4971963-4971985 TTTGAGAAACAGAATGTGACCGG - Intronic
1170044933 20:12075017-12075039 TTTGAAACACAGCAGGAGAGAGG - Intergenic
1170611565 20:17917873-17917895 TGTAAGAAACCTCATGAGGGGGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172266744 20:33622174-33622196 TTTGGAAAACAGCATGAGGTAGG + Intronic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1173843827 20:46175656-46175678 TTTGAGAACCAGTATGATAGAGG - Intronic
1174498578 20:50967343-50967365 GATGGGAAAGAGCATGAGGGAGG - Intergenic
1175560449 20:59924053-59924075 TTTAGGAAACAGAATGAAGGTGG - Intronic
1175879575 20:62249467-62249489 TTTAAGAAAAAGCATTAGGAAGG - Intronic
1179142861 21:38742003-38742025 TATGAGAAGTAGCTTGAGGGTGG - Intergenic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1181787654 22:25238447-25238469 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181819390 22:25463485-25463507 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182085012 22:27555526-27555548 TTTGAAAAACAACATGAGCTGGG - Intergenic
1182699736 22:32226860-32226882 TTTGAGAACAAGCAGGAGTGAGG - Intronic
1183655137 22:39180094-39180116 CCTGAGAAACAGCATCGGGGAGG + Intergenic
1184096740 22:42320169-42320191 TTTGAGAAACAGCCAGAAGGCGG - Intronic
1184448396 22:44567914-44567936 TTTGGAGAACAGCGTGAGGGAGG + Intergenic
950008650 3:9706772-9706794 TTGGAGCAACAACCTGAGGGAGG + Intronic
950160488 3:10757094-10757116 GAAGAGAAACAGCATGAGTGTGG - Intergenic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950797254 3:15520313-15520335 TGTGAGAAACAGAAGGAGGTGGG - Intronic
950978330 3:17274644-17274666 TTTGAGGAACAGCACCAGGTGGG - Intronic
952138604 3:30453136-30453158 TTTTAGAAAGAGAATCAGGGTGG - Intergenic
952519913 3:34146213-34146235 TGTTAGAAACAACAGGAGGGAGG + Intergenic
953262115 3:41349687-41349709 TTTGACAAATGGAATGAGGGTGG - Intronic
953600771 3:44361954-44361976 TTTTAGAAGCAGCATAAGGTTGG - Intronic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
955038113 3:55288817-55288839 TATGGGAAACAGACTGAGGGGGG - Intergenic
955587684 3:60499262-60499284 TTTAAGAAAAAGCAGAAGGGTGG - Intronic
955618899 3:60839968-60839990 TCTGAGAGGCAGCATGAAGGTGG - Intronic
956446149 3:69328092-69328114 TTTGAGAGACAGAATGGTGGTGG + Intronic
956488930 3:69751142-69751164 GTTGAGAAACAGGGTGATGGTGG + Intronic
957315489 3:78570667-78570689 TTTGAAAAACAGCTTTAGGCAGG + Intergenic
957610383 3:82458461-82458483 TTAGGAAAACAGCATGAGGATGG - Intergenic
959945415 3:112120579-112120601 TTTTAAGACCAGCATGAGGGAGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961189314 3:124944442-124944464 TTTGTCAAAAATCATGAGGGAGG + Intronic
963277110 3:143343025-143343047 TTTGAGAAACAGTAAAAGTGTGG - Intronic
963727403 3:148937718-148937740 TTTGAGAAAGTGGATGGGGGAGG + Intergenic
964242449 3:154612570-154612592 TTTAAGGAACAGGATGATGGAGG + Intergenic
964464748 3:156978934-156978956 TTTGAAAATCAGCATGGTGGTGG + Intronic
964727211 3:159825892-159825914 GTTGAGAAACAGCTTGTGTGAGG + Intronic
965544662 3:169903279-169903301 CTTGAAGAACAGCCTGAGGGAGG - Intergenic
965582725 3:170286609-170286631 TTTGAGAAGCAGTTTGATGGGGG + Intronic
968332701 3:197885176-197885198 TCTGAGGAGCAGCAGGAGGGCGG - Intronic
968978227 4:3833002-3833024 TTTCAGAACCAGCCTGTGGGTGG + Intergenic
969465229 4:7352464-7352486 TTTGAGAGACAGCAAGATGCAGG - Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
970672214 4:18410068-18410090 TTTCAGACTCAGCATGAGAGGGG - Intergenic
971455382 4:26839510-26839532 TGTGGGAAGGAGCATGAGGGAGG + Intergenic
971666304 4:29490268-29490290 TTTCAGTATCATCATGAGGGAGG - Intergenic
972647250 4:40980805-40980827 TTTGAGAAAAAGCCTGAGTTGGG - Intronic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
974906660 4:68066528-68066550 TTTGTGAAACAGTGTGAGTGGGG - Intronic
975129904 4:70822719-70822741 TTTGGCAAACAGCATGATGTTGG + Intronic
975610432 4:76197282-76197304 TTTGACCAACAGGATGTGGGTGG + Intronic
977280875 4:95038224-95038246 TTTGAGGAACAGGATGAAGAAGG + Intronic
978203135 4:106046730-106046752 TCTGAGAAAAAACATGAGGTTGG - Intronic
978281467 4:107020881-107020903 TTTCAGAAACAGCATGGGTTTGG + Intronic
978773845 4:112486079-112486101 TTTGTTAAACAGAATGAGAGAGG + Intergenic
979119382 4:116876473-116876495 AGTGAGAAAGAGAATGAGGGGGG - Intergenic
979714778 4:123824089-123824111 TTTGAGAAAAAGATTGATGGAGG - Intergenic
981281402 4:142964054-142964076 TTTAAGACACAGTATGAGAGAGG + Intergenic
982042025 4:151406896-151406918 TTTGAGGAACGACTTGAGGGAGG - Intergenic
982256710 4:153458119-153458141 TATGGGAAACAGTGTGAGGGAGG + Intergenic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
983381013 4:166993487-166993509 AAAGAGAAATAGCATGAGGGTGG - Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987315704 5:16721212-16721234 TTTGTGAATCAGCAAGAGGAGGG - Intronic
988120885 5:26960336-26960358 TTTTAGAAGCAGCATATGGGAGG - Intronic
989335698 5:40314494-40314516 TTTGAATGACATCATGAGGGTGG + Intergenic
989594388 5:43142656-43142678 TCTGAGAGACAGAATGGGGGTGG - Intronic
990851309 5:60208293-60208315 TTTGAGTAACAGCTTAATGGAGG + Intronic
990935420 5:61142485-61142507 TTTGAAAAAATGCATGAGGAAGG + Intronic
991182076 5:63764126-63764148 TTTGAGAAAAAGTAGGGGGGTGG + Intergenic
992309510 5:75481265-75481287 TTTGAGAAGCAGTCTGAAGGTGG - Intronic
993355001 5:86895073-86895095 TTTGAGAAAAAAGATAAGGGAGG - Intergenic
994744444 5:103661600-103661622 TTTCAGGAAAAGAATGAGGGTGG + Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995641995 5:114267438-114267460 TTTGAGTATCAGTTTGAGGGTGG + Intergenic
995785362 5:115821955-115821977 TTTGAGTAACAGCATTTGGGTGG + Intergenic
996452108 5:123637069-123637091 TCTGAAGAACAGCCTGAGGGAGG + Intergenic
997044620 5:130299364-130299386 TTTGAGCAACAGAAGGATGGTGG + Intergenic
997093139 5:130879678-130879700 TTTGAGCAAAAGCCTGAAGGAGG + Intergenic
997868457 5:137485934-137485956 TTTGAGAAACTGCATCAAGTGGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998392672 5:141797422-141797444 TGTGAGAAGAAGCAGGAGGGAGG - Intergenic
999495414 5:152091671-152091693 TTTGGGAAGCAGCATGATGGAGG + Intergenic
999793495 5:154965767-154965789 TTTGATATACAGAATGGGGGAGG + Intronic
1000392732 5:160742302-160742324 TGTGAGTAACAGCATTAGGGGGG - Intronic
1001430191 5:171654756-171654778 TTAGAGAAGCAGCATGACTGTGG + Intergenic
1001857064 5:175022114-175022136 TTTGAGAAACAGAAAGAAGCGGG + Intergenic
1002858410 6:1058149-1058171 TTTGAAAAACAACAAGATGGAGG + Intergenic
1003202873 6:3978524-3978546 TTTCATAAACAGCATGCAGGGGG - Intergenic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1005697500 6:28364982-28365004 TTTGAGAAACAGCGACTGGGAGG - Intronic
1005737902 6:28765935-28765957 TTTGAGACTAAGCATGACGGTGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007636700 6:43304011-43304033 TCAGAGAAAGAGGATGAGGGAGG - Intronic
1007839982 6:44708195-44708217 GTACAGACACAGCATGAGGGTGG - Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008654929 6:53602169-53602191 ATTGAGAAACAGCATTTGGGAGG + Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009389951 6:63133917-63133939 TGTGTGAAATAGCATGATGGTGG + Intergenic
1009754882 6:67924280-67924302 TTTGAGAAACAACCTGAGGTGGG + Intergenic
1012632471 6:101489116-101489138 TTTGAAAAACAGCAGAATGGGGG - Intronic
1013679798 6:112512193-112512215 TCTGAGAATGAGCATGAAGGTGG - Intergenic
1014677555 6:124385762-124385784 TATGAGAAACAGCATTTGAGAGG - Intronic
1014791952 6:125682457-125682479 TTTGAGAAAAAAGATGAGAGAGG - Intergenic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1017937554 6:159019649-159019671 TTTGGGAAACATGATGAAGGTGG + Intergenic
1018071540 6:160168404-160168426 TGTGACAAACAGGATGAGGTGGG - Intergenic
1018255617 6:161915636-161915658 TTTGACACACAGCATGATGTAGG - Intronic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018584004 6:165335697-165335719 TTTGAGAAAGGGCATGTGTGTGG - Intronic
1020703630 7:11513987-11514009 TTTGAGAAATGGCAGGAGGCAGG - Intronic
1021106848 7:16646860-16646882 TATGAGAGACAGCCTGTGGGAGG + Intronic
1022778756 7:33556455-33556477 TTTGAGAAACAGTATAAAGAAGG - Intronic
1023686174 7:42737726-42737748 TTTGAAGAAAAGCATGTGGGTGG - Intergenic
1023983598 7:45082932-45082954 GTTGAGAACCAGCAGGAAGGAGG - Exonic
1024191402 7:47015015-47015037 TTTGGGAAATAGACTGAGGGAGG - Intergenic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1026115898 7:67495540-67495562 TTTCACAAACACCATGATGGAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1029343370 7:99961896-99961918 TATTAGAAACAACATGATGGGGG - Intergenic
1029813353 7:103070745-103070767 TAAGAGAAACAGCTAGAGGGAGG + Intronic
1030169599 7:106588241-106588263 TTTGAGAAAGAGGATGGGGCAGG - Intergenic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1033359318 7:140626854-140626876 TCTGAGAAAAAGCTTGAGAGAGG + Intronic
1034137481 7:148784243-148784265 TTTGAAAAACAGCCAGTGGGAGG - Intronic
1034659431 7:152756727-152756749 TTTGAGAAAGGGCATCAGGATGG + Intergenic
1036283873 8:7426244-7426266 TTTTAAAAGCAGCCTGAGGGCGG - Intergenic
1036337602 8:7885286-7885308 TTTTAAAAGCAGCCTGAGGGCGG + Intergenic
1036669788 8:10775350-10775372 TTTGAGAAGCAGCATGCTGGAGG - Intronic
1036810485 8:11865032-11865054 CCTGAGAAAGAGCATGTGGGAGG - Intronic
1037427202 8:18768719-18768741 TTTGTGAAACAGGAGAAGGGTGG - Intronic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1039397003 8:37234984-37235006 TTTGAGAAAGGGCATGATGATGG + Intergenic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1042505863 8:69559709-69559731 CTTGAGGAAAAGCATGAAGGTGG - Intronic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1044734490 8:95265629-95265651 ATTGTGAAATTGCATGAGGGAGG - Intronic
1045783526 8:105896246-105896268 TTTGAGAAACAGCAGCAGTCAGG - Intergenic
1045978985 8:108161840-108161862 CTTTAGAAACACTATGAGGGGGG - Intergenic
1046268732 8:111865118-111865140 TTGGAGAATTAGCATGAGAGGGG - Intergenic
1047350828 8:124071972-124071994 TTGGAGACACAGCTTTAGGGAGG - Intronic
1047600399 8:126420452-126420474 TTTAAGCAACAGCATGAAGGAGG - Intergenic
1047796974 8:128267651-128267673 TGTGAGTAACAGAATGAAGGAGG + Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047919102 8:129614937-129614959 TTTGTAAAACAGCATGATGTTGG + Intergenic
1048171857 8:132114778-132114800 TTTGAGTACCATAATGAGGGAGG - Intergenic
1048669333 8:136698934-136698956 TTTGAGTATCAGAATGATGGTGG + Intergenic
1049573503 8:143380243-143380265 GGTGGCAAACAGCATGAGGGTGG - Intronic
1050645671 9:7716965-7716987 TTTGAAAACCAGCACGAGGCAGG + Intergenic
1051616479 9:19011778-19011800 TTTGAGAAAGAAGAGGAGGGAGG - Intronic
1051749567 9:20327078-20327100 GTTGAGAAACAGGTTTAGGGAGG + Intergenic
1052669006 9:31531638-31531660 TTTGTTAAAGAGCATGAGGCTGG + Intergenic
1053152502 9:35751873-35751895 TTTGTAAAACAGCTTGAGGTTGG + Intronic
1055460905 9:76519391-76519413 TTCTAGAAACTGCATGAGGGAGG + Intergenic
1055693220 9:78856427-78856449 AGTGAGTAAGAGCATGAGGGTGG + Intergenic
1055708797 9:79036722-79036744 CTTGGGGAACAGCCTGAGGGAGG - Intergenic
1055956704 9:81780483-81780505 TATGAGAAATAGTATGAGGCCGG + Intergenic
1056233881 9:84572726-84572748 GGTGGGAAACAGCATGATGGTGG + Intergenic
1056294631 9:85180284-85180306 TTTGAGAAAGAACTAGAGGGAGG - Intergenic
1058416250 9:104791719-104791741 TTTAAGAAAAAGCATGGGGCTGG - Intronic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1059444021 9:114327175-114327197 TGTGAGAAACAGCACCTGGGAGG - Intergenic
1059445228 9:114333954-114333976 TGTGAGAAACAGCACCTGGGAGG - Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1185517573 X:711978-712000 TTTCTGACACAGCCTGAGGGAGG + Intergenic
1185810387 X:3103440-3103462 TTTGAGCAAAGGTATGAGGGAGG + Intronic
1185865194 X:3618031-3618053 TTTGAGACACAGCAAGGCGGAGG - Intronic
1186279671 X:7978273-7978295 TGTGTGAAACACCATGATGGTGG - Intergenic
1186435977 X:9543480-9543502 TTTGTGAGCCAGCAAGAGGGAGG - Intronic
1187021453 X:15386990-15387012 TTTGAGATACAGGACGTGGGAGG + Intronic
1187029096 X:15467310-15467332 TTTGTGAGGCAGCATGGGGGTGG - Intronic
1187410274 X:19045112-19045134 CTTGAGAAACAGGATGGGTGAGG + Intronic
1188693714 X:33161574-33161596 TTTCAGAAACAGCAAAAGGTGGG - Intronic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1190026415 X:46927708-46927730 TTTGAGAAACACATTGAGGTCGG + Intronic
1190255593 X:48760104-48760126 TTTGAAAAACAGGCTGAGGGTGG - Intergenic
1193964467 X:87968149-87968171 TTTGAGAAAGTGCAGGAGTGGGG - Intergenic
1194909554 X:99624163-99624185 TTAGAAAACCTGCATGAGGGTGG - Intergenic
1195823025 X:108968019-108968041 TTTGGGGTACAGCATGAGAGAGG - Intergenic
1196473429 X:116054950-116054972 TTTCAGAATCAGGATGATGGTGG + Intergenic
1196751452 X:119121239-119121261 TTTGAAAAACAGCCTGTGGAGGG - Intronic
1197621459 X:128754936-128754958 TTTAGGAAACATCATGAGGTAGG - Intergenic
1197740973 X:129893663-129893685 TTTAAAAAACAGCTTGAGGCTGG - Intergenic
1197877993 X:131132168-131132190 TGAGAGAAATAGCAGGAGGGAGG - Intergenic
1199024537 X:142920877-142920899 TATGGGAAATAGCATGATGGTGG - Intergenic
1199063102 X:143382500-143382522 TTTTAGTAACAGGATGAAGGTGG + Intergenic
1199571105 X:149268170-149268192 TACGAGAGACAGCATGAGTGAGG + Intergenic
1200448331 Y:3292612-3292634 TGTTTGAAACAGCATGAGAGTGG - Intergenic
1201462062 Y:14237205-14237227 TATGAGAAAGAGCATGAGAGTGG - Intergenic