ID: 1079347426

View in Genome Browser
Species Human (GRCh38)
Location 11:19665149-19665171
Sequence TGTTCTCTTGATTTGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079347426_1079347429 9 Left 1079347426 11:19665149-19665171 CCTGATGCCAAATCAAGAGAACA 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1079347429 11:19665181-19665203 ACTCAAATCCAAGAAGCAAGAGG 0: 1
1: 0
2: 3
3: 21
4: 238
1079347426_1079347431 30 Left 1079347426 11:19665149-19665171 CCTGATGCCAAATCAAGAGAACA 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1079347431 11:19665202-19665224 GGCATGTCTGCAACCTCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079347426 Original CRISPR TGTTCTCTTGATTTGGCATC AGG (reversed) Intronic
902030132 1:13416307-13416329 TTTTCTCTGGATTTGTCCTCTGG + Intronic
902617235 1:17630447-17630469 TGGTCTCTTGAGTTGGCGTTTGG + Intronic
906060124 1:42943041-42943063 TCTTCTCTTGCTTTGGAATCAGG - Intronic
907821337 1:57972655-57972677 TCTTCTCTTGAGATGGCCTCAGG + Intronic
908818482 1:68057946-68057968 TGGTCTCTTGCCTTGGCACCTGG - Intergenic
913369440 1:118082065-118082087 TTTTCTATTGATTTGGGCTCAGG + Intronic
914679459 1:149928855-149928877 TGATCTCATGATTTAACATCTGG + Exonic
915022243 1:152791595-152791617 AGTTTTCTGGCTTTGGCATCAGG - Intronic
915287125 1:154860220-154860242 TGTTCTCTTGACGACGCATCAGG + Intronic
916911467 1:169352086-169352108 TGTTGTCTGGTTTTGGTATCAGG - Intronic
917287277 1:173434466-173434488 TCTTCTTTTGATTTGGCACTTGG - Intergenic
917476913 1:175376681-175376703 GGTTCTCTTGCTGAGGCATCTGG - Intronic
919453258 1:197795721-197795743 TTCTCTCTGGTTTTGGCATCAGG + Intergenic
922039323 1:221880939-221880961 TTTTCTGTTCATTTGGCATGAGG - Intergenic
923902661 1:238344776-238344798 TTTTCTTTGGCTTTGGCATCTGG + Intergenic
924492714 1:244554796-244554818 TCTTCTCTGGTTTTGGTATCAGG - Intronic
924759615 1:246971820-246971842 TGGTCTCTTGCCTTGGCACCTGG + Intronic
924949517 1:248869449-248869471 TGTTTTCTTGATTTGTTTTCCGG - Intergenic
1064230614 10:13527507-13527529 TTTTCTCTAGCATTGGCATCAGG - Intronic
1064776032 10:18778312-18778334 CGTTCTCATGATATGGCAGCTGG - Intergenic
1065086843 10:22187253-22187275 TATTCTCTTGCTTTGATATCTGG + Intergenic
1065863670 10:29894381-29894403 CATTGTCTTGCTTTGGCATCAGG + Intergenic
1071001423 10:80835327-80835349 TCTTTTCTGGCTTTGGCATCAGG - Intergenic
1071116163 10:82222905-82222927 TGTTCTCTTCATTTTGCTTTTGG + Intronic
1072747503 10:97951211-97951233 TGTTGTCTTGATTTTGCCACTGG - Intronic
1073889807 10:108087296-108087318 TTTTCTCTAAAATTGGCATCTGG - Intergenic
1074059170 10:109949296-109949318 TTTGCTCTTGGTTTGGGATCTGG + Intronic
1075790823 10:125083288-125083310 GCCTCTCTTGATTTGGCTTCTGG + Intronic
1076075936 10:127533821-127533843 AGTTCTCTTGATTTCCCATTGGG - Intergenic
1076770901 10:132664129-132664151 TGTTCTGTTCATTTGGCCTCAGG + Intronic
1076896242 10:133313713-133313735 CGTTCTCTTGCCTTGGCACCTGG - Intronic
1077555546 11:3224335-3224357 TGTTCTGAAGCTTTGGCATCTGG - Intergenic
1077707416 11:4500345-4500367 TCTTGTCTGGATTTGGCATCAGG + Intergenic
1078488472 11:11746414-11746436 TTTTGTCTAGTTTTGGCATCAGG - Intergenic
1079347426 11:19665149-19665171 TGTTCTCTTGATTTGGCATCAGG - Intronic
1079732402 11:23951302-23951324 TGTTCACTTGTTCTGGAATCTGG + Intergenic
1080083957 11:28256172-28256194 CTTTCTCTTGTTTTGGTATCAGG + Intronic
1080250660 11:30229474-30229496 TGCTCTCTTTATTTGGCTTTTGG + Intergenic
1080717259 11:34816062-34816084 TGTCCTCTGGTTTTGGTATCAGG - Intergenic
1084689887 11:70718931-70718953 AGTTATCTTGATTTGTCAGCTGG + Intronic
1086216260 11:84385349-84385371 TGTTCTCATGCTTTGACCTCAGG + Intronic
1086635755 11:89081946-89081968 TGTTCTCTAGTTTTGGAACCTGG + Intergenic
1088288445 11:108210869-108210891 CTTTCTCTTGTTTTGGTATCAGG - Intronic
1088390777 11:109312495-109312517 TGTTCTCTTGAACTTGCTTCTGG + Intergenic
1089654407 11:119936204-119936226 GGTTCTCCTTTTTTGGCATCTGG + Intergenic
1090471671 11:126986233-126986255 TGTTCTCATCACTAGGCATCTGG - Intronic
1091076961 11:132628425-132628447 TATTCTGATGCTTTGGCATCTGG + Intronic
1091694352 12:2617928-2617950 TGTCCTTTAGATTTAGCATCTGG + Intronic
1092648276 12:10603566-10603588 TTTTCTCTTAAATTGCCATCGGG - Intergenic
1092828064 12:12415803-12415825 TTTTGTCTTGCTTTGGAATCAGG + Intronic
1093697399 12:22177177-22177199 CTTTCTCTGGCTTTGGCATCAGG - Intronic
1097948025 12:65394608-65394630 CGTTGTCTGGATTTGCCATCAGG - Intronic
1098924249 12:76331984-76332006 TGTTCTATTTATCTGGGATCTGG - Intergenic
1099173530 12:79394121-79394143 TGCTCTAATGCTTTGGCATCTGG + Intronic
1100621180 12:96275023-96275045 TTTTGTCTGGATTTGGTATCAGG - Intergenic
1105262979 13:18793550-18793572 TGTGCTCTGGATGTGGGATCTGG - Intergenic
1105295194 13:19082841-19082863 TTTTCTCTTTTTTTGGCATTTGG - Intergenic
1105427707 13:20308953-20308975 TGTTTTCTTGTTTTCCCATCTGG - Intergenic
1106199632 13:27525651-27525673 TGCTCTCTTGATTTTGTAACAGG + Intergenic
1107582609 13:41807354-41807376 TCTTCTCTGGTTTTGGTATCAGG - Intronic
1107643328 13:42467766-42467788 TTTTGTCTGGTTTTGGCATCAGG - Intergenic
1109258843 13:60119195-60119217 TGTTCTCATGATCTGGCAGCTGG - Intronic
1110560036 13:76901438-76901460 TCTTCTCTTGATTGAACATCTGG - Intergenic
1112217735 13:97451566-97451588 TGTTCTGTCGATGGGGCATCTGG + Intronic
1113024359 13:105923845-105923867 TGTTCTCTTGCTTTGGCCCCAGG + Intergenic
1113238763 13:108313470-108313492 TTTTCTTTTGACTTGGCTTCAGG - Intergenic
1113318474 13:109208640-109208662 TGTTCTGATGCTTTGGCATCTGG - Intergenic
1114783933 14:25572109-25572131 TGATTTCTTGATTTGGGATGAGG - Intergenic
1115145898 14:30225358-30225380 TGTTCTCTTGATGTGGACCCCGG - Intergenic
1115329243 14:32176834-32176856 TCTTGTCTGGCTTTGGCATCGGG + Intergenic
1116037800 14:39649387-39649409 TCCTCTCTTGATTTGCCTTCAGG + Intergenic
1118748566 14:68791017-68791039 TGTTCCCTTCCTTTGGCAACAGG + Intronic
1124889688 15:33721157-33721179 TGTTCTCATGATGTGGCAGCTGG - Intronic
1125014637 15:34920298-34920320 TGTTCTCTGAATTTTGCATGTGG - Intronic
1125432811 15:39613620-39613642 TCTTCTCTGGCTTTGGTATCTGG - Intronic
1125765037 15:42129337-42129359 TTTTCTCTTTTTTTGGCATGTGG + Intergenic
1126875310 15:53034907-53034929 TGTTCTCTTGCTGGGACATCTGG + Intergenic
1130406036 15:83602778-83602800 TGCTCTCTGGATTTTGGATCAGG + Intronic
1131393713 15:92070015-92070037 TATTCTGTTGCGTTGGCATCAGG + Intronic
1131708156 15:95021022-95021044 TGTACTCTTGTTTTGCCATCAGG + Intergenic
1134446454 16:14335003-14335025 TGTTTTCTTGATTTGGCTGTTGG + Intergenic
1134919536 16:18103036-18103058 CTTACCCTTGATTTGGCATCTGG - Intergenic
1138971932 16:62155422-62155444 TTTTGTCTGGATTTGGTATCAGG - Intergenic
1140260008 16:73370093-73370115 TGTTCTAGTTATTTGGCAGCAGG - Intergenic
1144674503 17:17153243-17153265 TGATCTCCTGTTTTGGCTTCTGG + Intronic
1150290226 17:63976930-63976952 TGTTCACTGGACTTGGCAGCAGG - Intergenic
1150304152 17:64070144-64070166 TGGACTCTTGATATGGCAGCGGG - Intronic
1150806025 17:68319740-68319762 TCTTGTCTTTATTTGCCATCAGG - Intronic
1152232030 17:79118507-79118529 TGTTTTCCTGATTTTGCCTCTGG - Intronic
1152514211 17:80812855-80812877 TGTGCACGTGATTTGGAATCTGG + Intronic
1154425328 18:14267648-14267670 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154428060 18:14287233-14287255 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154433023 18:14322887-14322909 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1158408519 18:57182906-57182928 TCTTCTCTGGTTTTGGTATCAGG + Intergenic
1160703838 19:519937-519959 TGGCCTCTTCATTTGACATCTGG - Intergenic
1164907537 19:31979537-31979559 TGTTCTCTTGCTGTGACTTCTGG - Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1167431425 19:49457204-49457226 TGTGCTTTGGATTTAGCATCAGG + Intronic
926671846 2:15583939-15583961 TGTTCTCATGATATTGCAGCTGG - Intergenic
926854802 2:17243255-17243277 TTTTTTCTTGATTTGTCTTCAGG + Intergenic
928767022 2:34659640-34659662 TGTACTCTTTTTTTTGCATCTGG + Intergenic
931417202 2:62092408-62092430 TGTTCTCTTGATTTGCAGGCAGG + Intronic
932566966 2:72916672-72916694 TGTTCTCTTGAGATGGGCTCGGG + Intronic
934492768 2:94773057-94773079 TGTGCTCTGGATGTGGGATCTGG - Intergenic
935478295 2:103553133-103553155 TTTTCTCTGGTTTTGGTATCAGG + Intergenic
937503476 2:122509661-122509683 TCTTGTCTTGATTTTGCTTCAGG + Intergenic
938067380 2:128288532-128288554 TGTTTTCCAGAGTTGGCATCAGG - Intronic
940792961 2:158047542-158047564 TGGTCTCTTGGTTTGGCCTTGGG - Intronic
941168077 2:162104758-162104780 TGTTCTTGTGATTTAGCAGCTGG - Intergenic
941672168 2:168306105-168306127 TCTTTTCTTGATATGGTATCAGG + Intergenic
941826832 2:169908134-169908156 TGGTCTCTTTCTTTGGCATATGG + Intronic
941928145 2:170915980-170916002 TGGTCTCTTGCCTCGGCATCTGG - Intergenic
943863777 2:192901616-192901638 TCTTCTCCTGATGTGGCATCTGG + Intergenic
944293928 2:198040630-198040652 GGTTCTCTTCATTTGGCCCCAGG + Intronic
945542256 2:211103230-211103252 TATTTTCTTCATTTGGCTTCTGG - Intergenic
945765790 2:213976050-213976072 GCTTCTCATGATATGGCATCTGG + Intronic
946352425 2:219164031-219164053 TCTTCTCTTGATTGGGCTTCTGG - Intronic
948517781 2:238515597-238515619 TCTTTTCTGGTTTTGGCATCAGG + Intergenic
948959944 2:241326695-241326717 TGTTCTCTTGACATGACAGCTGG - Intronic
1168930184 20:1616053-1616075 TGTTCTATTTATTTTTCATCAGG - Intronic
1169338136 20:4774165-4774187 AGTTCTCTTGATTAGGAATTGGG - Intergenic
1169738528 20:8864670-8864692 TGTTCCCATGATTTGGAATTAGG + Intronic
1169776886 20:9264957-9264979 TGTTGTCTTGGGATGGCATCTGG - Intronic
1170943584 20:20869656-20869678 TGTTCTCAAGATTTGGGAGCTGG + Intergenic
1171514959 20:25722674-25722696 TGTTTTCTTGATTTGGCCTTTGG + Intergenic
1171895445 20:30754941-30754963 CTTTGTCTTGATTTGGAATCAGG + Intergenic
1172062250 20:32194644-32194666 GGTTCACTTGGTTTGTCATCAGG - Exonic
1177010786 21:15729221-15729243 TGTTTGCTTAATTTGGCAACTGG + Intergenic
1179222471 21:39421021-39421043 TGTTCTCTAGAGCTGGGATCTGG - Intronic
1184302692 22:43571730-43571752 TGTCCTGTTTATTTGCCATCGGG - Intronic
1185350536 22:50334567-50334589 TGGTCTCTTGCCTTGGCACCTGG + Intergenic
950415695 3:12867844-12867866 TGGTCTCTTGCCTTGGCACCTGG - Intronic
953059713 3:39417251-39417273 TGGTCTCTTGCCTTGGCACCTGG - Intergenic
953466386 3:43124126-43124148 TTTTCTCTTCATGTGTCATCTGG - Intergenic
955640166 3:61073958-61073980 TTTATTCTTGATTTGGCATTGGG + Intronic
956312447 3:67896135-67896157 AGTTCTTTGCATTTGGCATCGGG + Intergenic
956825369 3:72993083-72993105 TGTTCTCATGACATGGCAGCTGG + Intronic
957707661 3:83811116-83811138 CTTTATCTTGATTTGGTATCAGG + Intergenic
957917614 3:86706798-86706820 TATTCTGTTGATTTGGGATGGGG + Intergenic
958520046 3:95172848-95172870 TTTTCTCTTGATTTCTCATACGG - Intergenic
959026219 3:101242687-101242709 TACTCTCTTGATGTGGAATCAGG - Exonic
960215674 3:115033766-115033788 TTTTGTCTGGTTTTGGCATCAGG - Intronic
960351728 3:116602201-116602223 CATTATATTGATTTGGCATCAGG - Intronic
961417421 3:126770119-126770141 TGTGCTCTTGATTTGGCTCTTGG + Intronic
961823198 3:129585822-129585844 TGTTCTCATTATTTGTCTTCAGG + Intronic
965473980 3:169131263-169131285 TATTTTCTTGGTTTGACATCTGG - Intronic
965748538 3:171951671-171951693 TGTTCTCTGAATTTTGCCTCTGG + Intergenic
969971348 4:11051660-11051682 TGTCCTCATGATATGGCAGCTGG - Intergenic
970319848 4:14864299-14864321 AGTTCTCTTCATTTCGTATCTGG + Intergenic
970705261 4:18793996-18794018 TGTTCCCTTCATTTCACATCTGG + Intergenic
971568798 4:28183479-28183501 TGTTCTCTAGTTTTGATATCAGG + Intergenic
972927043 4:44022502-44022524 TTTTCTATTGTTTTGACATCTGG + Intergenic
973079061 4:45966610-45966632 TTTTCTCTGGTTTTGGAATCAGG + Intergenic
973367495 4:49219553-49219575 TGTGCTCTGGATGTGGGATCTGG - Intergenic
974101698 4:57424130-57424152 TATTATCCTGGTTTGGCATCAGG - Intergenic
975996007 4:80316125-80316147 AGTTATCTGGATTTGTCATCTGG - Intronic
976367372 4:84246024-84246046 GGTTCACTTGGTTTGTCATCAGG + Intergenic
978227689 4:106357511-106357533 TGTTCTCTTGATTTGGAGCCTGG - Intergenic
978320527 4:107489337-107489359 CTTTGTCTTGTTTTGGCATCAGG - Intergenic
978830749 4:113081618-113081640 TGTTCTCCTACTTTGGAATCAGG + Intronic
980311753 4:131140347-131140369 TGTTCTCTTGATTTATCTGCTGG - Intergenic
980397137 4:132228266-132228288 TGGTCTCTTGCCTTGGCACCTGG + Intergenic
982467129 4:155745135-155745157 TGTCAACTTGACTTGGCATCAGG - Intergenic
982501869 4:156167753-156167775 TGTTCTCATAATATGGCAACTGG + Intergenic
982707096 4:158722669-158722691 TTTTCTCTTAATTTGCCATTGGG - Intronic
982848501 4:160280255-160280277 TGTTCTGTTGATTTGGGGTGGGG - Intergenic
982984648 4:162191274-162191296 TTTTGTCTAGCTTTGGCATCAGG + Intergenic
983049368 4:163027386-163027408 TGTTCTTTTGATTTTAAATCTGG + Intergenic
983196231 4:164809698-164809720 TGTTTTCTTGATTTCTCAACCGG - Intergenic
986108908 5:4691809-4691831 TGTTCTTTTGGTTTGCCATGTGG - Intergenic
986340885 5:6788381-6788403 TTTACTCTTGGTTTGGCCTCAGG + Intergenic
986403706 5:7404947-7404969 CTTTCTCTTGATATGGGATCTGG + Intronic
987481796 5:18468211-18468233 TGTTGTCTTGATTTTGAAACAGG - Intergenic
987628553 5:20435654-20435676 TCTTCTCATGATCTTGCATCAGG - Intronic
988621899 5:32831725-32831747 TTTTGTTTTGTTTTGGCATCTGG - Intergenic
989257114 5:39377746-39377768 TGATCTTTTCATTTGGCAACTGG + Intronic
989347309 5:40444139-40444161 TCTTATCTGGCTTTGGCATCAGG - Intergenic
989842629 5:46098979-46099001 TTTTTTCTTTATTTGGCATCTGG + Intergenic
990159373 5:52920494-52920516 TGTATTCTTGATTTGGAATAAGG - Intronic
990297197 5:54414553-54414575 TCTTCTCCTTATTTGGCATTTGG - Intergenic
990697219 5:58433616-58433638 TATACTCTCAATTTGGCATCTGG + Intergenic
990841854 5:60090196-60090218 TTTTATCTAGTTTTGGCATCAGG - Intronic
991199256 5:63972195-63972217 TATTCTGTTGTTTTGGCATGTGG - Intergenic
991310130 5:65229392-65229414 TGTTTTCTTGATTTTTCTTCTGG - Intronic
994137057 5:96300877-96300899 TGTTCTCTTGATTTTGTTTTTGG + Intergenic
994629550 5:102267101-102267123 TTTTCTCTGGTTTTGGCATCAGG + Intronic
995088215 5:108140474-108140496 TTTTCTCTTCCTTTGGCCTCAGG + Intronic
995641547 5:114263029-114263051 ATTTCTCTTGACTTGGAATCAGG + Intergenic
996145087 5:119964937-119964959 TGTTCTGTTGACTTCACATCTGG + Intergenic
996385612 5:122906951-122906973 TGTTCTCTGGGTTTGGCTACAGG + Intronic
997067780 5:130582276-130582298 TATTCTGTTGATTTGGGATGGGG - Intergenic
1000205433 5:159053548-159053570 TATTCTGTTGATCTGGCATTGGG + Intronic
1000457198 5:161465174-161465196 TGTTCTTTTGACTTGGAAACAGG - Intronic
1000954389 5:167525100-167525122 TATGCACTTGATTTGGCAACTGG - Intronic
1002205717 5:177561154-177561176 TGGTCTCTTGCCTTGGCACCTGG - Intergenic
1003753345 6:9087489-9087511 TGGTTTCTTCATTTGGCATTCGG - Intergenic
1004673077 6:17815794-17815816 TGGTCTCTTGCCTTGGCACCTGG + Intronic
1004843992 6:19618603-19618625 CCTTCTCTGGTTTTGGCATCAGG - Intergenic
1005519131 6:26583258-26583280 TATTTTCTTCATTTGGCTTCTGG + Intergenic
1007190125 6:40007925-40007947 ATTTCACTAGATTTGGCATCAGG + Intergenic
1008118138 6:47577604-47577626 TTTTCTCTTTATTTTGCATTAGG - Intronic
1008432888 6:51440833-51440855 TGTTTTCTTGATTTGTTTTCTGG + Intergenic
1008702391 6:54116759-54116781 TGTTGTCTGGTTTTGGCATCAGG - Intronic
1009741728 6:67755915-67755937 GATTCTCTTTAATTGGCATCTGG - Intergenic
1010407936 6:75526796-75526818 TCTTCTTTTAATTTGGCATTTGG - Intergenic
1010492004 6:76487959-76487981 TGTTCTCTTGATTTTGATGCAGG + Intergenic
1011553331 6:88549456-88549478 TGCTCTCCTGTTTTGGCCTCCGG + Intergenic
1013525020 6:110966087-110966109 TGTCCTCCTGATATGGCAGCTGG + Intronic
1014404182 6:121027816-121027838 CCTTCTCTGGTTTTGGCATCAGG - Intergenic
1014458547 6:121667113-121667135 TGTTCTTTTTGTTTGTCATCGGG - Intergenic
1014628222 6:123756325-123756347 CTTTGTCTGGATTTGGCATCAGG + Intergenic
1016718423 6:147263142-147263164 TGTTCTCTTAGTTTGCCATTGGG + Intronic
1020206494 7:6121469-6121491 TTTTTTCTTGTTTTGGCATTAGG + Intronic
1020258463 7:6516220-6516242 CGGTCTCTTGCCTTGGCATCTGG - Intronic
1020595343 7:10201244-10201266 TTTTCTTTGGTTTTGGCATCAGG + Intergenic
1020632416 7:10655271-10655293 TGTTCACATGATTTGGAATGAGG - Intergenic
1020760161 7:12259046-12259068 TGTTTTCTTGCTTTTGCTTCTGG - Intergenic
1023222685 7:37935644-37935666 AGTTTTCTTAATTTGGCATAAGG - Intronic
1023337483 7:39185544-39185566 TCTTCTCTTGATGGGGCAACTGG + Intronic
1025571218 7:62571732-62571754 TTTTCTTTTTATTTGGCATTTGG - Intergenic
1025872439 7:65447570-65447592 TGGTCTCTTGCCTTGGCACCTGG + Intergenic
1027501191 7:78953228-78953250 TGATCTACTTATTTGGCATCTGG + Intronic
1030721164 7:112872141-112872163 TCTTTGCTAGATTTGGCATCAGG - Intronic
1031164949 7:118216648-118216670 TGGTTTCTTAATTTGGTATCTGG + Intronic
1031487286 7:122343139-122343161 AATTCTATTGATTTGTCATCAGG - Intronic
1033872273 7:145769488-145769510 TTTTGTCTTGTTTTGGTATCAGG + Intergenic
1035173812 7:157036483-157036505 TGCTCTCTTTATTTGGGATCCGG + Intergenic
1037468350 8:19183082-19183104 TGTCCTCATAATTTGGCATTGGG - Intergenic
1038737537 8:30185869-30185891 TGTTCTCTTGACATGGCAGTTGG + Intergenic
1038737799 8:30188145-30188167 TGTTCTCTTGACATGGCAGTTGG - Intergenic
1038909040 8:31941066-31941088 TGTCCTCTGGCTTTGGCATTAGG - Intronic
1039162817 8:34641355-34641377 TGTTTTCTTGTTTTGGAATCAGG + Intergenic
1040132428 8:43812930-43812952 TTTTCTCTTGATTTAGCAGTTGG + Intergenic
1040819891 8:51544551-51544573 TGTTCTCTTTATGTTGCATTAGG - Intronic
1041024783 8:53672824-53672846 TGTTCTGATGCTTTGGCATTTGG - Intergenic
1041149961 8:54921641-54921663 TTTTCTGGTGATTTGGCATGAGG + Intergenic
1041504064 8:58574661-58574683 TCTTCTCTTGATGTTCCATCTGG + Intronic
1041514023 8:58680317-58680339 TGTTTTCTTAATTTTGCTTCTGG - Intergenic
1043361333 8:79475890-79475912 TATTTTGTTGATGTGGCATCAGG - Intergenic
1043483475 8:80676090-80676112 TGTTCCTTGGATTTGGCATATGG + Intronic
1043777626 8:84289985-84290007 TGTTTTCTTATTTTGGCTTCAGG + Intronic
1044559915 8:93602868-93602890 TGTGCTCTGGATTTGGCATTAGG + Intergenic
1044962872 8:97548143-97548165 TGTCCTCATGATGTGGCAGCTGG + Intergenic
1046369165 8:113278019-113278041 TCCTCTATTCATTTGGCATCAGG + Intronic
1046565739 8:115898492-115898514 TTTTTTCTTCATTTGGCATGAGG + Intergenic
1047536882 8:125728054-125728076 TGTTCTCTTGATTTTCTATCTGG - Intergenic
1047542307 8:125781283-125781305 TATTCTTTTTCTTTGGCATCTGG - Intergenic
1048087750 8:131202519-131202541 TGTTCTCTTGATTCTGCCACAGG + Intergenic
1048400381 8:134061529-134061551 TCTTCTCTGGTTTTGGTATCAGG - Intergenic
1048694860 8:137014493-137014515 TTTTTTCTGGTTTTGGCATCAGG + Intergenic
1048994358 8:139783668-139783690 TCCTGTCTTGGTTTGGCATCAGG - Intronic
1050227485 9:3476290-3476312 TGGTCTCTTGCCTCGGCATCTGG + Intronic
1050886316 9:10770689-10770711 TTTTGTCTGGATTTGGTATCAGG - Intergenic
1051412302 9:16802800-16802822 TGTTCTCTGGATTTGGAAATAGG + Intronic
1051852250 9:21522887-21522909 TGTGCTCTTGATTTGGCTCTTGG + Intergenic
1051908889 9:22129686-22129708 TGTTCTTTCAATTTGGCATGGGG + Intergenic
1052203702 9:25812637-25812659 TGTTTTCTTAATATGGCAGCTGG - Intergenic
1055008375 9:71535660-71535682 TTGTCTCTTTGTTTGGCATCTGG + Intergenic
1055165631 9:73188740-73188762 TCTTGTCTGGTTTTGGCATCAGG - Intergenic
1057407425 9:94785738-94785760 TGTTCTCTTTGTTTTGCAGCTGG + Intronic
1057493845 9:95544262-95544284 TGGTCTCTGGATTGGGCAACTGG - Intergenic
1058392290 9:104509464-104509486 TGCACTCTTGATTTGGCTTTTGG + Intergenic
1058493842 9:105532984-105533006 TGTATTCTTGCTTTGCCATCAGG + Intronic
1058773203 9:108258855-108258877 TGTTCTCTTGGTATGGGAACCGG - Intergenic
1061914213 9:133740831-133740853 TGTTATCTGGCTTTGGTATCAGG + Intergenic
1062484208 9:136766316-136766338 CGGTCTCTTGCTTCGGCATCTGG - Intergenic
1062588541 9:137262645-137262667 TGGTCTCTTGCCTTGGCACCTGG + Intronic
1187568171 X:20473819-20473841 TGTCCTCATGATATGGCAACTGG + Intergenic
1188161526 X:26810360-26810382 TTTTGTCTTGCTTTGGTATCAGG + Intergenic
1192717043 X:73654506-73654528 TCTTCTCTGGCTTTGGTATCAGG + Intronic
1193365930 X:80633224-80633246 TTTTGTCTTGTTTTGGTATCAGG + Intergenic
1193509279 X:82379376-82379398 TCTTGTCTTGTTTTGGTATCAGG + Intergenic
1194244164 X:91491173-91491195 TCTTCTCCTGATTAGGCATAGGG + Intergenic
1194581236 X:95674336-95674358 TGATTGCTTGATTTGGCATGGGG - Intergenic
1194837981 X:98705076-98705098 TCTTCTCTTGTTTTGGTATCAGG + Intergenic
1195955487 X:110324972-110324994 TTTTGTCTAGTTTTGGCATCAGG + Intronic
1196960956 X:121000969-121000991 ATGTCTCTTGATATGGCATCAGG + Intergenic
1197355415 X:125433074-125433096 TCTCCTCTTGATTTGCCATTAGG + Intergenic
1197513151 X:127396061-127396083 TGTTCCCTTCTTTTGGCACCTGG + Intergenic
1198620083 X:138498387-138498409 TATTCTATTCATTTGGCATAAGG + Intergenic
1198998735 X:142607151-142607173 TGGTCTCTTGCCTCGGCATCTGG + Intergenic
1200563146 Y:4732491-4732513 TCTTCTCCTGATTAGGCATAGGG + Intergenic
1201564456 Y:15351609-15351631 TGTTTTCTTGAGATGGAATCTGG - Intergenic
1201974427 Y:19832778-19832800 TGGTCTCTTGCCTTGGCACCTGG + Intergenic