ID: 1079347450

View in Genome Browser
Species Human (GRCh38)
Location 11:19665364-19665386
Sequence GCTGAGAAGCAGATGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079347444_1079347450 28 Left 1079347444 11:19665313-19665335 CCAGTGCTCCTTTCAGGTCTGTG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG 0: 1
1: 0
2: 4
3: 29
4: 369
1079347446_1079347450 20 Left 1079347446 11:19665321-19665343 CCTTTCAGGTCTGTGGAGCCGAT 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG 0: 1
1: 0
2: 4
3: 29
4: 369
1079347448_1079347450 2 Left 1079347448 11:19665339-19665361 CCGATGCTGTTTCTGAGGCAGCT 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG 0: 1
1: 0
2: 4
3: 29
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079347450 Original CRISPR GCTGAGAAGCAGATGGTGCA TGG Intronic
900285039 1:1894951-1894973 GCTGAGAAGCAGGTGGGGGTGGG - Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
903258490 1:22118398-22118420 TCTGAGAAGCAGATGGGTCAAGG + Exonic
905307874 1:37031982-37032004 GCTGAGAATCAAATGGGGCAGGG + Intronic
905910963 1:41654036-41654058 GCTGGGAAGGAGTAGGTGCAAGG - Intronic
909460971 1:75913932-75913954 GCTGGGAAGTAGAGGTTGCAGGG - Intergenic
910390283 1:86735901-86735923 GCAGAAAAGCAGAAGGTGCCTGG + Intronic
910490480 1:87764188-87764210 GGTGAGGAGCAGATGGTGTTAGG + Intergenic
910688166 1:89939484-89939506 CCTGAGAGGCAGATGGTTCCTGG - Intergenic
911618902 1:100044589-100044611 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
912493897 1:110078960-110078982 GTTGAAAAGCACATGGGGCAGGG + Intergenic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
913252507 1:116923705-116923727 GATGACAAGCAGATGATCCATGG - Intronic
913292769 1:117290165-117290187 GGTGAGGAGGTGATGGTGCAGGG - Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
915444631 1:155967675-155967697 GCGGAGAAGCAGATGGAGTGTGG - Intronic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
919593754 1:199536986-199537008 GCTGAGAAGGAAAAGCTGCAGGG + Intergenic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
920557391 1:206914144-206914166 GCTGGGAAGTAGATGGGGCTGGG - Intronic
921176766 1:212602187-212602209 GCTGAAAAGGGGATGGTGTAGGG - Intronic
921777642 1:219120780-219120802 AATCAGAAACAGATGGTGCAAGG - Intergenic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922744336 1:228035825-228035847 GCGGAGAAGGAGAGGGTCCAGGG - Intronic
922775659 1:228213255-228213277 GCTGGAAAGGAGAGGGTGCAGGG - Intronic
922921716 1:229310872-229310894 GCTGAGAAGTAGACGGTGACGGG - Intergenic
923146581 1:231202791-231202813 GCTGAGAAGCAGGAGGAGCCTGG + Intronic
923641938 1:235772147-235772169 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
923644631 1:235805402-235805424 GCTGATGCGCAGATGGTGAATGG + Intronic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1063634394 10:7767781-7767803 CCTGGGAGGTAGATGGTGCAGGG + Intronic
1063660026 10:8028931-8028953 CCTGAGAGGCAGAGGTTGCAAGG - Intergenic
1064368898 10:14733802-14733824 GCTGAGAAGAAGATGGGGTCTGG - Intronic
1065833920 10:29640150-29640172 GCTGGGAAGCACATGGGGCTGGG - Intronic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1066386736 10:34947675-34947697 GCTGAGACACAGGTAGTGCATGG + Intergenic
1068077230 10:52271443-52271465 TCAGAGAAGCAGATCATGCAGGG + Exonic
1068939180 10:62664177-62664199 GTTAAGAAGCAGACTGTGCAGGG + Intronic
1069374358 10:67779048-67779070 GCTGAGAAGGAGCTGTTGCTGGG - Intergenic
1069689453 10:70340333-70340355 GCTGTGAAGCAGATTGAACAAGG - Intronic
1070566831 10:77610050-77610072 GCAGAGGAGCAGCTGGTGCAGGG - Intronic
1071598007 10:86942159-86942181 CCTGAGAAGCAGGTGGGCCAAGG + Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1073705029 10:105973451-105973473 GCTCAGAACCAGATTGTGAATGG - Intergenic
1074684716 10:115949907-115949929 GCTGAAAAGGAGAGTGTGCAAGG - Intergenic
1075296819 10:121284605-121284627 CCTGAGAGGGAAATGGTGCAAGG - Intergenic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1077136638 11:1002850-1002872 CCTAAGAAGCAAATGCTGCACGG - Intronic
1077195616 11:1278609-1278631 GCCGAGAAGCAGAGGAGGCAGGG - Intronic
1077433160 11:2526074-2526096 GCTGGGCAGCAGCAGGTGCACGG + Intronic
1078713326 11:13816101-13816123 GCATAGATGCAGATGGGGCACGG + Intergenic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1081487820 11:43545597-43545619 GCAGAAAAGCAGATGAGGCAGGG - Intergenic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1083103255 11:60332481-60332503 GCTGAGATGCAGATGGGACCTGG - Intergenic
1083103357 11:60333606-60333628 GCTGAGATGCAGATGGGACCTGG + Intergenic
1083516756 11:63266364-63266386 ACTGAGAAGAAAATGGTGTAAGG - Intronic
1084096660 11:66915792-66915814 GCTGACAAGCACATGGTGTTGGG + Intronic
1085921540 11:80963690-80963712 GTTGACCTGCAGATGGTGCAAGG - Intergenic
1086388440 11:86335063-86335085 GCTGAGAAGCAGATGGGACAAGG - Intronic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087876064 11:103359415-103359437 GAAGAGAAGCAGTTAGTGCAAGG - Intronic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1089079000 11:115760687-115760709 GCTGTGAAACAGAGGGAGCATGG - Intergenic
1089385550 11:118065165-118065187 GTGGAGAAGCAGGTGGGGCAGGG - Intergenic
1089641076 11:119847643-119847665 GCTCAGAAGCAGGTGTTGCTGGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090533187 11:127612627-127612649 TCTCAGAAGCAGATGCTGCTAGG - Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1091886346 12:4019691-4019713 GCAGAGAAGGAGTTGGGGCACGG - Intergenic
1092262203 12:6958765-6958787 GATGAGAGGCAGTGGGTGCAGGG + Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092596365 12:10009659-10009681 GCTGTGAAGCAGATGCAGAAAGG - Intronic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1093906870 12:24703407-24703429 CCTGAGAAGAATTTGGTGCATGG - Intergenic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096801231 12:54111974-54111996 GGTTAGCAGCAGATGCTGCAGGG + Intergenic
1099674012 12:85733325-85733347 CCTGAGAAGCGGCTGGTGCAAGG - Intergenic
1101852533 12:108415601-108415623 GCAGAGATGGAGATGATGCATGG - Intergenic
1102552731 12:113703301-113703323 GATGACAAGAACATGGTGCAGGG + Intergenic
1103145356 12:118590636-118590658 GCTGAGAAGCAGCTGCATCAGGG + Intergenic
1103173429 12:118842108-118842130 GATGAGAAGCTGATGCTGAAAGG + Intergenic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103466604 12:121146734-121146756 GGTGAGAAGAAGCTTGTGCAGGG + Intronic
1103718871 12:122962759-122962781 GATTTGAAGCACATGGTGCAGGG - Intronic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1104948256 12:132427133-132427155 ACTGAGAAGCTGATGTTGGAAGG + Intergenic
1105379913 13:19877261-19877283 GCTGAGAAGTTGAAGGGGCATGG + Intergenic
1105486044 13:20833799-20833821 GCAGAGAAGCAGTGTGTGCAAGG + Intronic
1106693185 13:32141856-32141878 GGTGAGATGCAGAGGGTCCAGGG + Intronic
1109783905 13:67150107-67150129 CCTGGGAGGCAGATGTTGCACGG - Intronic
1110064876 13:71091118-71091140 GGAGAGAAACAGATGGTGAAAGG + Intergenic
1110936363 13:81294963-81294985 GCTGAAAAGCAAATGTTCCATGG + Intergenic
1113291897 13:108916290-108916312 GCAGCTAAGCAGAGGGTGCAAGG + Intronic
1113421099 13:110172023-110172045 GCTGAGAAGGAGCAGGGGCACGG - Intronic
1113901993 13:113802684-113802706 GCTGAGAAGCAGATGGCAGGAGG - Intronic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1115499155 14:34034123-34034145 GCTGATGAACAGAAGGTGCAAGG + Intronic
1115747530 14:36452524-36452546 GCTGAAATCCAGATGGTGCCAGG - Intergenic
1118333254 14:64830776-64830798 GCTCAGCACCAAATGGTGCAGGG - Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1119462946 14:74825957-74825979 TCTGAGAAGCAAATGGTAGACGG - Intronic
1119765178 14:77183300-77183322 GCTGAGAAGCTGAGGCTGCAAGG + Intronic
1121894122 14:97629472-97629494 GCTGAGAAGAACATAGGGCAAGG + Intergenic
1121986837 14:98515055-98515077 GCTCAGCAGCATATGGTGCCAGG - Intergenic
1122154320 14:99741400-99741422 GGTGAGAATCAGAAGCTGCAGGG - Intronic
1122339848 14:101020736-101020758 GCAGAGGACCAGATGGAGCATGG - Intergenic
1122405500 14:101498422-101498444 GCTGAGATGGAGACGGTGCGAGG - Intergenic
1123156589 14:106233257-106233279 GCTGGGAAGCTGATGGCACATGG - Intergenic
1123207358 14:106726370-106726392 GCTGGGAAGCTGATGGCACATGG - Intergenic
1123212382 14:106773364-106773386 GCTGGGAAGCCGATGGCACATGG - Intergenic
1123505403 15:20938237-20938259 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1123562642 15:21511947-21511969 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1123598887 15:21949231-21949253 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1124201608 15:27683020-27683042 TCTGAGAAGCAGGTGCTGGAAGG - Intergenic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1125267873 15:37904562-37904584 GCAGAGGAGCAGCTGGTGAATGG + Intergenic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1129258055 15:74345388-74345410 GGTGAGAGGCAGAGGGTGCTCGG - Intronic
1129381118 15:75167667-75167689 GCTGAGAAGCATATTGTGTCTGG + Intergenic
1130050506 15:80480100-80480122 TCTGAGAAGAAGATGGAGCATGG + Intronic
1130532793 15:84760247-84760269 GCTGGGAAGCAGATGATGGCAGG - Intronic
1131150960 15:90046949-90046971 GCTGAGAAGCAGGTGGGGCCAGG - Intronic
1202970992 15_KI270727v1_random:239080-239102 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132479417 16:159775-159797 GGTGAAAAGCTGTTGGTGCAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1136346602 16:29679828-29679850 TCTAAGAAGCAGATGGTACGGGG + Intronic
1136598314 16:31266734-31266756 GCAGAGGAGGGGATGGTGCAAGG + Intronic
1137687305 16:50395158-50395180 GCTGAGGACCAGGTGGTGAAGGG + Intergenic
1138865262 16:60810591-60810613 GCTGAGGAGCAGATGTTCCTGGG + Intergenic
1138969739 16:62130336-62130358 GCTGAGAATCAGAGTGTGGACGG + Intergenic
1139573524 16:67827649-67827671 GCTGAGCAGTGGATGGTGCATGG - Intronic
1140220227 16:73038324-73038346 GCTGAGAAGCGGATTCTGAAGGG - Intronic
1140297327 16:73721599-73721621 GCTGAAGAGCAGATGGTGCATGG - Intergenic
1141193459 16:81841926-81841948 GCTGGGAAGCTGGTGTTGCAAGG + Intronic
1141278889 16:82612943-82612965 GGTGTGAAGCAGAGTGTGCAAGG + Intergenic
1143577732 17:7804452-7804474 GATGAGCAGCAGAAGGTCCAGGG + Exonic
1143720277 17:8804301-8804323 GCCTAGAAGCAGTTTGTGCAGGG - Intronic
1144494568 17:15738149-15738171 ACTGAGAGGCAGACGGTGCCAGG - Intronic
1144624417 17:16837547-16837569 GCAGAGAAACAGAGGGAGCAGGG + Intergenic
1144639431 17:16929427-16929449 GCTGAGAGGCAGATGGTGCCAGG + Intergenic
1144882010 17:18435173-18435195 GCAGAGAAACAGAGGGAGCAGGG - Intergenic
1145058859 17:19719932-19719954 GCTGAGATGCCTGTGGTGCACGG - Intergenic
1145058872 17:19720006-19720028 GCTGAGATGCCCATGGTGCGTGG - Intergenic
1145058900 17:19720154-19720176 GCTGAGATGCCCGTGGTGCACGG - Intergenic
1145058916 17:19720228-19720250 GCTGAGATGCCCGTGGTGCACGG - Intergenic
1145150223 17:20509213-20509235 GCAGAGAAACAGAGGGAGCAGGG + Intergenic
1145271972 17:21409634-21409656 GCTGAGGAGCTGATGCTGCCAGG - Intronic
1145310180 17:21697099-21697121 GCTGAGGAGCTGATGCTGCCAGG - Intronic
1146696468 17:34912348-34912370 GAAGAGAAGCAGATAGAGCAAGG + Intergenic
1146844080 17:36172760-36172782 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146856385 17:36260695-36260717 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146864231 17:36327680-36327702 TCTGAGAGGCTGATGGTGCCAGG - Intronic
1146872295 17:36384606-36384628 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1146879654 17:36435691-36435713 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1147047307 17:37762867-37762889 GATGAGAAGCAGCTGTTACACGG + Intergenic
1147067092 17:37928268-37928290 TCTGAGAGGCTGATGGTGCCAGG - Intronic
1147075179 17:37985230-37985252 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1147078624 17:38007829-38007851 TCTGAGAGGCTGATGGTGCCAGG - Intronic
1147086704 17:38064776-38064798 TCTGAGAGGCTGATGGTGCCAGG + Intronic
1147094562 17:38131764-38131786 TCTGAGAGGCTGATGGTGCCAGG - Intergenic
1147102649 17:38188739-38188761 TCTGAGAGGCTGATGGTGCCAGG + Intergenic
1148229176 17:45920541-45920563 GCTGCCAGGCAGAAGGTGCACGG - Intronic
1150804279 17:68306965-68306987 ACTGAGTAGCAGATGGTTGAGGG - Exonic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1152255663 17:79238010-79238032 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1152673380 17:81623116-81623138 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
1152838915 17:82553790-82553812 GCTGTGACGCAGATGGTGGATGG + Intronic
1153466833 18:5397358-5397380 GCTAAGCGGCAGGTGGTGCACGG + Exonic
1153759548 18:8317314-8317336 GCTGAGGAGAAGATGGTGTGTGG + Intronic
1154356805 18:13627801-13627823 GCAGAGAGGCTGCTGGTGCAGGG - Intronic
1155549982 18:26954478-26954500 GGAAAGAAGCAGATGGTGCAAGG - Intronic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1157113570 18:44843112-44843134 GCTCAGAAGCAGTAGCTGCAGGG + Intronic
1157741360 18:50096310-50096332 TGTGAGAAGCAGATGTTGAAAGG - Intronic
1158629299 18:59098394-59098416 GCTGAGAAGGGTATGGGGCAAGG + Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1159074758 18:63667752-63667774 GCTGAGAAACACACGGTGGAAGG + Intronic
1159400004 18:67918885-67918907 GCTGATTAGAAGATGGTTCAGGG - Intergenic
1159921391 18:74230321-74230343 GCAGAGAAGCGGACAGTGCATGG - Intergenic
1160544657 18:79644856-79644878 GTCGAGAAGCAGATGGTTCTCGG - Intergenic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1163079425 19:14926589-14926611 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1163574581 19:18103114-18103136 GGTGGAAAGCAGATGGTGCGGGG + Intronic
1164677028 19:30107711-30107733 GCTGTGAGGGAGAAGGTGCAAGG - Intergenic
1164779078 19:30878232-30878254 ACTGAGAAACAGGTGGGGCATGG + Intergenic
1165015499 19:32877356-32877378 TCTGAAAAGGAGATGCTGCAGGG + Intergenic
1165103858 19:33457129-33457151 GATGAAAAGCAGAGGGTGCCAGG + Intronic
1165384949 19:35504876-35504898 GCTGAGAAACAGCTGCTGCTTGG - Intronic
1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG + Intronic
1166382485 19:42362235-42362257 GATGAGAAGCAGCAGGTGTAGGG + Intronic
1166772743 19:45294206-45294228 GGTGAGTAGGAGATGGTGAAAGG - Intronic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167550327 19:50155834-50155856 CGTGGGAACCAGATGGTGCAGGG - Intronic
1167624800 19:50580632-50580654 GCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1167881913 19:52466103-52466125 TCTGAGAAGCAGATGTTGAGGGG + Intronic
1168514505 19:57000520-57000542 GGAGAGGAGCAGATGGGGCAGGG - Intergenic
925295461 2:2773492-2773514 GATGAGAAGCACATGAGGCAAGG - Intergenic
925991892 2:9260870-9260892 GCGGAGAAGCAGATAGAGTAGGG - Intronic
926364054 2:12116664-12116686 GCTGAGAAACAGATGGAAGAAGG + Intergenic
926890252 2:17633441-17633463 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
926943372 2:18161718-18161740 GAAGAGAAAGAGATGGTGCATGG - Intronic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
927079220 2:19611026-19611048 GCTGGGAAGCGGAGGTTGCAAGG + Intergenic
927091324 2:19714911-19714933 GCTGAGACCCAGATGGCACATGG - Intergenic
927319365 2:21724530-21724552 TCTGAGATCCAGATGGTTCAAGG + Intergenic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
928534558 2:32227455-32227477 GCTGGGAAGCATATGGAGAAGGG - Intronic
929049670 2:37825408-37825430 GTTGAAAAACAGATGGTCCAGGG + Intergenic
929171731 2:38939046-38939068 CCTGGGAGGCAGATGTTGCAGGG - Intronic
929423215 2:41816237-41816259 GGTGAGAACCAGATGGGGAAGGG + Intergenic
929928267 2:46232858-46232880 ACTGAGGAGGAGCTGGTGCAGGG - Intergenic
930238915 2:48915804-48915826 ACTGTAAAGCAGATGGGGCAGGG - Intergenic
931686755 2:64800487-64800509 GCTAAGCAGCAGTTAGTGCATGG - Intergenic
933784486 2:85827899-85827921 ACTGAAAAGCAGGTGGTGCTGGG - Intergenic
934490901 2:94761530-94761552 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
935131107 2:100261536-100261558 TCTCAGAAGCAGGTGGTCCAGGG + Intergenic
936594279 2:113832782-113832804 GCTGGGAAGCCGAGGTTGCAGGG - Intergenic
936849173 2:116874453-116874475 CCTGAGAACCACATGGGGCAAGG - Intergenic
938092853 2:128444599-128444621 GCTCAGAGGGAGGTGGTGCAAGG + Intergenic
938170201 2:129069337-129069359 GCAGAGAAGCAGATGGCCCTGGG - Intergenic
938252942 2:129829834-129829856 GCTGAGGACCAGATGCTACAGGG - Intergenic
938278820 2:130050675-130050697 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG + Intergenic
938360151 2:130679967-130679989 TCTGAGATGCAGGTGGTGCCAGG - Intergenic
938436554 2:131286674-131286696 TCTGAGATGCAGGTGGTGCCAGG - Intronic
938908899 2:135867044-135867066 GCTTAGGAGAAGATGGAGCATGG - Intronic
939834518 2:147112210-147112232 GCTGAGAAGATGCTGGTGCTAGG + Intergenic
939982678 2:148799715-148799737 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940518509 2:154712948-154712970 GCTGTGGAACAGCTGGTGCAAGG + Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
942167398 2:173255184-173255206 GCAGGGAAGCAGTTGCTGCAGGG + Intronic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
943924784 2:193760808-193760830 TCTGAGAAGTAAGTGGTGCATGG + Intergenic
944471068 2:200054737-200054759 GCTGAGCAGCAGATGGTCTGCGG + Intergenic
945110127 2:206354948-206354970 CCTGAGAGGCAGAGGTTGCAGGG - Intergenic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
945700889 2:213169865-213169887 GGTGAGAATCACTTGGTGCAGGG - Intergenic
946341315 2:219071167-219071189 GCTGAGCAGGGGATGGTGAAAGG - Intergenic
946372551 2:219289809-219289831 GCTGAGAAGCAGGGGGAGCCGGG + Exonic
946384395 2:219373744-219373766 GCTGAGAAGTGGATGATGAAGGG + Exonic
946400938 2:219468211-219468233 TCTGAGAAGTAGATGGAGGAGGG + Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
948083374 2:235226110-235226132 CCTGAGAAGCACATGCTCCAAGG + Intergenic
948463768 2:238142626-238142648 CCTGAAAGGCACATGGTGCAAGG + Intronic
948802604 2:240439685-240439707 ACTGAGAAGCAGATGCTGGTGGG - Intronic
1170822724 20:19767847-19767869 CCTGAGAGGCAGAGGTTGCAGGG + Intergenic
1172692152 20:36797369-36797391 GCTGAGGAGCCCAAGGTGCAAGG + Intronic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1173958662 20:47054476-47054498 GCTCAGAAACACCTGGTGCAGGG - Intronic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1175296493 20:57912412-57912434 CCTTGGAAGCAGATGGTGCCAGG - Intergenic
1175745140 20:61451295-61451317 GCTGAGACGCACATGCTCCATGG - Intronic
1175925390 20:62468829-62468851 GCTGGGAGGGAGATGGTGCCTGG + Intronic
1175986691 20:62767726-62767748 GCTCAGAAGCAGATGGTGGCTGG - Intergenic
1178773180 21:35524736-35524758 GTTGAGAAGCAGCTGGTGTTTGG + Intronic
1179322059 21:40301489-40301511 GCTAAGATGCAAATGGTGAATGG - Intronic
1179662588 21:42886653-42886675 GCTGAGAAGCACAGCCTGCAGGG - Intronic
1179930422 21:44567870-44567892 GCTGGGAAGCTCATGGTGCGGGG + Exonic
1180911566 22:19454482-19454504 GCAGAGAAAAAGCTGGTGCAGGG - Intronic
1181483283 22:23214684-23214706 TCTGAGAAGGAAATGGTGCCAGG - Intronic
1181620601 22:24088530-24088552 CCTGAGAGGCAGAGGTTGCAGGG + Intronic
1181656016 22:24299517-24299539 GCTGAGATGCAGACTGTTCAAGG - Intronic
1181782822 22:25205383-25205405 GCTGACCAGAAGATGGGGCAAGG - Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183597085 22:38819159-38819181 GCTGGGAAGCAACTGGTGCAGGG + Exonic
1184047328 22:41979584-41979606 GCTGAGAGTCAGCTGCTGCAGGG + Intronic
1184411699 22:44329905-44329927 GCTGGGAATCAGATGGTCCAGGG - Intergenic
1184445425 22:44544340-44544362 GCTGAGAAGCAGAGCCTGGAGGG + Intergenic
1184822272 22:46918261-46918283 GGAGAGAGGGAGATGGTGCAGGG + Intronic
1185014257 22:48334126-48334148 GAAGAGAAGCCAATGGTGCATGG - Intergenic
1185157469 22:49202833-49202855 GCAGAGAAAGAGATGGTGAAGGG + Intergenic
1185207917 22:49550797-49550819 GCTGAGGAGACGATGATGCAGGG - Intronic
949651013 3:6159490-6159512 GCTGAAAAGCAGATCGTGAAGGG - Intergenic
953201494 3:40781922-40781944 TCTGAGGAGCAGGTGGTGAATGG + Intergenic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
954956214 3:54520344-54520366 TCTGAGAAGCAGATGAAGCTGGG + Intronic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
956712722 3:72052218-72052240 GCTGAAAACCAGATGGTGGTTGG - Intergenic
956872250 3:73429423-73429445 GCTGAGAGTCAGATGGGTCACGG - Intronic
957002494 3:74902401-74902423 GCAGAGAAGGAGATGTTGCTGGG - Intergenic
958443392 3:94184125-94184147 GCTGAGGAGCAAATGCTTCAAGG + Intergenic
960542832 3:118880352-118880374 GAAGAGAAGCAGATGGTGACTGG - Intergenic
961533483 3:127554823-127554845 GCAGATGAGCAGATGGGGCAGGG - Intergenic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
961590424 3:127975560-127975582 GGTAAGAAGAAGCTGGTGCAAGG - Intronic
962001230 3:131299522-131299544 GCTGAGAGGTAGATGGTGGGAGG - Intronic
962234381 3:133694721-133694743 GCTGAGAGGGAGATGGGGCGAGG - Intergenic
962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG + Intergenic
962499396 3:135974666-135974688 GCTGAGAAGCAGAGTTTGAAAGG - Intronic
962991569 3:140582187-140582209 TCTGGGAGACAGATGGTGCAGGG + Intergenic
963788121 3:149556067-149556089 GCTGAGGAGCAGAGGGTGAGGGG + Intronic
963948108 3:151168779-151168801 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
967138685 3:186534249-186534271 GTTGAGAAGCAGAAGTTGCACGG + Intergenic
970815646 4:20152730-20152752 GCACAGAGGCAGATGGGGCATGG + Intergenic
971123352 4:23726572-23726594 GCAGAGAAGCGGTTGGGGCACGG + Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977988717 4:103416111-103416133 TCTAAGAAGCAGATGGTACGGGG - Intergenic
980309847 4:131112772-131112794 CCTGAGACTCAGATGGGGCAGGG - Intergenic
985070044 4:186158667-186158689 GCTGAGCAGCAGTGCGTGCAGGG - Intronic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
987066815 5:14297847-14297869 GCTGAGGAGGAGCTGGTGCGTGG - Intronic
987254174 5:16132245-16132267 GCTGAGAAGGAGAAGGGACACGG + Intronic
987334967 5:16890762-16890784 CCCGAGAAGCAGAGGTTGCAGGG + Intronic
994784339 5:104136863-104136885 GGCAAGAAACAGATGGTGCATGG - Intergenic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
997576480 5:134981408-134981430 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
997892874 5:137690500-137690522 GCAGAGAAGCAGAAGGGTCAAGG + Intronic
998295752 5:140967428-140967450 TGTGAGAACCAGGTGGTGCAAGG - Exonic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999330055 5:150667305-150667327 GCTGAGAATGAGGTTGTGCAAGG - Intronic
1000904880 5:166953027-166953049 GCTGAGAAGCAAAATGTGTAAGG - Intergenic
1001036654 5:168301664-168301686 GCTGAGAAGGAACTGGTTCAAGG - Intronic
1001108957 5:168879522-168879544 GCTGAGGAGCTGATGCTTCATGG - Intronic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1004429353 6:15529898-15529920 GCTGAGCAGCAGAGGGGGCCTGG - Intronic
1007570708 6:42888601-42888623 TCTGAGTTACAGATGGTGCAGGG - Exonic
1007996173 6:46310266-46310288 GCAGAAAAGCAGAAGGTTCAAGG + Intronic
1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG + Intergenic
1011582896 6:88890494-88890516 GCTGGAAAGCAGATGGTACTCGG - Exonic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1016031141 6:139339537-139339559 GCTGTGAAGCATCTGGTCCAAGG + Intergenic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017229453 6:152056880-152056902 GCTGAGAAGCACGTGGGGCATGG - Intronic
1017775454 6:157676836-157676858 GCTGAGAAGCAGTTGGTTCCTGG - Exonic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1021035414 7:15792338-15792360 GCTGACAAGGATATGGTGAAAGG + Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022523422 7:31022396-31022418 GATGAGCAGCACATGGAGCAGGG + Intergenic
1023222153 7:37930307-37930329 GATGGGAAGCCGGTGGTGCAGGG + Intronic
1023653888 7:42400440-42400462 CCTGAGAAGCAGATCATTCAAGG + Intergenic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1024228788 7:47348160-47348182 GCTGAGTACCAGGTGGTGCGTGG - Intronic
1024385189 7:48743010-48743032 GCAGAGAAGCAGGTGGTGCCTGG - Intergenic
1025140530 7:56459786-56459808 TCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1031339830 7:120585488-120585510 GCAGAGAAACATATGGTGCTTGG + Intronic
1031485500 7:122318264-122318286 GAAGAAAAGCAGATGCTGCAGGG - Intergenic
1034658122 7:152745426-152745448 GCTGAGAAAGAGATGGTGAAAGG + Intergenic
1034961032 7:155364548-155364570 GCAGAGAAGCAGAAGGTGCTGGG - Intronic
1035021270 7:155802397-155802419 GCTGAGAAGCAGGAGATGGAAGG + Exonic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1035535236 8:386092-386114 GCTCAGAAGCAGATTCTGCCTGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037563097 8:20092391-20092413 GATGAGCAGGAGAAGGTGCATGG - Intergenic
1039861235 8:41459519-41459541 GCAGAGAAGCGGAGGTTGCAGGG + Intergenic
1044621111 8:94191525-94191547 CCTGGGAGGCAGATGTTGCAGGG - Intronic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1047181132 8:122589201-122589223 GCTAATAAGCAGATGCTTCAAGG - Intergenic
1048819009 8:138362497-138362519 GATGTGAAGAAGATGTTGCAAGG + Intronic
1048951751 8:139502237-139502259 GCAGACATGCAGATGGTGTAGGG - Intergenic
1049194274 8:141307264-141307286 GCTGAGACGCAGAAGGTGCGGGG + Intronic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049322232 8:142002671-142002693 AGTGAGAAGCCGAGGGTGCAGGG + Intergenic
1049340119 8:142107685-142107707 GATGAGAACCTGAAGGTGCACGG - Intergenic
1049372622 8:142274968-142274990 GCAGAGGAGCAGAGGCTGCAGGG + Intronic
1049653414 8:143787287-143787309 GCTGGGAAGCAGATAGCACAGGG + Intergenic
1050020626 9:1280528-1280550 GCTGGAAAGCAGATGGCCCATGG - Intergenic
1050278636 9:4027055-4027077 GCTGAGAGAAAGATGGGGCAGGG - Intronic
1050575007 9:6985764-6985786 CCTGAGAGGCAGAGGTTGCAGGG - Intronic
1050660650 9:7879774-7879796 CCTGAGAACCACATGGGGCAGGG + Intronic
1051339624 9:16099586-16099608 TCTGAGAAGCAGCTTGTGGAAGG + Intergenic
1052369149 9:27645063-27645085 CCTGAGAGGCACATGGGGCAGGG + Intergenic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053667094 9:40324158-40324180 TCTGAGAGGCAGGTGGTGCCAGG - Intronic
1053916684 9:42949269-42949291 TCTGAGAGGCAGGTGGTGCCAGG - Intergenic
1054517516 9:66052125-66052147 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
1056741100 9:89256037-89256059 CCTGGGAGGCAGATGTTGCAGGG - Intergenic
1057305417 9:93909568-93909590 GCTGAGAACCTGTTGGGGCAGGG - Intergenic
1059489219 9:114653376-114653398 GCTGAGATCCAGATGTTGCTGGG + Intergenic
1059735402 9:117095035-117095057 GCTGAGAAGTAGCTGGGGTAGGG - Intronic
1060785855 9:126451188-126451210 GCTGAGGCCCAGATGGTGAAGGG - Intronic
1060911368 9:127353912-127353934 TCTGAGAACCAGAAGGTCCAGGG - Exonic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1062367106 9:136215956-136215978 GCTGAGAAGCAGACGGTGCCGGG - Intronic
1185513015 X:677207-677229 GCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1189208402 X:39261903-39261925 GCAGAGAAAAAGATGATGCATGG + Intergenic
1189959545 X:46311377-46311399 CCTGAGAAGCAGATGCTGGTTGG - Intergenic
1190502843 X:51096614-51096636 GGTGAGAAGCAGAGGGTGCCAGG + Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1198393377 X:136198869-136198891 ACTGAGCAGCAGCTGGTGAAGGG - Intronic
1199419426 X:147627018-147627040 GCTGAGAAGTAGACAGTGAATGG - Intergenic