ID: 1079347646

View in Genome Browser
Species Human (GRCh38)
Location 11:19667093-19667115
Sequence CACAGCTAGCAGCTTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079347646_1079347651 10 Left 1079347646 11:19667093-19667115 CCCCCAGGAAGCTGCTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1079347651 11:19667126-19667148 AATACTGTCCCCATTGTCACTGG 0: 1
1: 0
2: 3
3: 15
4: 125
1079347646_1079347652 11 Left 1079347646 11:19667093-19667115 CCCCCAGGAAGCTGCTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1079347652 11:19667127-19667149 ATACTGTCCCCATTGTCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 128
1079347646_1079347657 26 Left 1079347646 11:19667093-19667115 CCCCCAGGAAGCTGCTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1079347657 11:19667142-19667164 TCACTGGGTTCTCAGAGCCAGGG 0: 1
1: 0
2: 2
3: 27
4: 268
1079347646_1079347656 25 Left 1079347646 11:19667093-19667115 CCCCCAGGAAGCTGCTAGCTGTG 0: 1
1: 0
2: 2
3: 28
4: 235
Right 1079347656 11:19667141-19667163 GTCACTGGGTTCTCAGAGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079347646 Original CRISPR CACAGCTAGCAGCTTCCTGG GGG (reversed) Intronic
901047406 1:6405546-6405568 CACAGCTAGGAGGTGCATGGAGG - Intergenic
901182165 1:7349352-7349374 CACCTCTAGCCGCTTTCTGGGGG + Intronic
903366159 1:22806643-22806665 CACAGCTAACACCTGCCTGGCGG - Intronic
903462087 1:23527250-23527272 CAGTGCTAGCAGCTCCCTGGTGG - Intronic
904418593 1:30377408-30377430 CACTTCCAGCAGGTTCCTGGAGG + Intergenic
905033805 1:34904558-34904580 CAGTGATAGCGGCTTCCTGGCGG - Exonic
905559290 1:38913741-38913763 GACAGCGAGCAGCTTCCTGTTGG - Intronic
907968708 1:59359599-59359621 CACAGCTAAGACCTCCCTGGAGG + Intronic
908501136 1:64744986-64745008 CGCAGCCAGCAGCCTGCTGGCGG - Intergenic
908566986 1:65367240-65367262 CATTTCTAACAGCTTCCTGGGGG + Intronic
908667965 1:66513154-66513176 CAGATCTAGGAGCTTTCTGGAGG - Intergenic
909120440 1:71596535-71596557 CCCAGATAGCTGCTGCCTGGAGG - Intronic
911999279 1:104810352-104810374 CAAAGCTAGGAGTTTTCTGGAGG + Intergenic
912717738 1:111993848-111993870 TCCTGCTAGCAGCTTCCTGCGGG - Intergenic
914885325 1:151579904-151579926 CATTGTTAGCAGCTTCCTGAAGG - Intronic
916667244 1:166977104-166977126 CACACCTTGGAGCATCCTGGTGG - Intronic
919482296 1:198105455-198105477 CACAGGGAGCAGCTTGCTGCTGG - Intergenic
920041224 1:203098755-203098777 CCCAGCTTGCCCCTTCCTGGGGG - Intronic
920246472 1:204591394-204591416 CACATTTAACTGCTTCCTGGGGG - Intergenic
920857742 1:209676485-209676507 CAGAGGGAGCAGCTTCCTGAGGG + Intergenic
921101178 1:211930747-211930769 AACATCTGGGAGCTTCCTGGGGG + Intergenic
922377536 1:224983658-224983680 CAGTGCTAGGAGCTTTCTGGAGG - Intronic
923096692 1:230780652-230780674 GACAGAAATCAGCTTCCTGGTGG - Exonic
923145247 1:231193124-231193146 TGCGGCTAGCACCTTCCTGGAGG - Intronic
1063203909 10:3812288-3812310 CAGAGGGAGCAGCTCCCTGGCGG - Intergenic
1064031537 10:11886111-11886133 CTCAGCCAGCAGCCTCCTGAAGG + Intergenic
1067229061 10:44394396-44394418 GCCAGCCAGCACCTTCCTGGGGG + Intergenic
1067513571 10:46915978-46916000 TACAACATGCAGCTTCCTGGTGG + Intronic
1067648681 10:48135856-48135878 TACAACATGCAGCTTCCTGGTGG - Intergenic
1070467810 10:76742219-76742241 CACAGCTGCCTGCTACCTGGGGG - Intergenic
1070574669 10:77668763-77668785 CAGGGCTGCCAGCTTCCTGGTGG - Intergenic
1070641050 10:78170307-78170329 CTAAGTTAGAAGCTTCCTGGAGG - Intergenic
1073105486 10:101030251-101030273 CAGAGCTAGCAGATTCCTTCTGG - Exonic
1073332021 10:102676363-102676385 CCCACCCAGCAGCTTCCTGTCGG + Exonic
1074395640 10:113095845-113095867 CACAGCTTGCAGCACCCTGGGGG - Intronic
1075743288 10:124709079-124709101 TACTGCTAGCAGTTTCATGGGGG + Intronic
1075990162 10:126830307-126830329 CACAGCTAACATCTTACTGATGG + Intergenic
1077524554 11:3056698-3056720 CAGACCTGGCAGCTTCCGGGAGG - Intronic
1079347646 11:19667093-19667115 CACAGCTAGCAGCTTCCTGGGGG - Intronic
1080754151 11:35179430-35179452 CTCTTCTAGCAGCATCCTGGTGG - Intronic
1080776678 11:35393226-35393248 CACATCTGGCAGCTGCATGGAGG - Intronic
1081291136 11:41327304-41327326 AGCAGCCAGCAGCTTCCTGGTGG + Intronic
1082902980 11:58276303-58276325 CACAGAGAGAAGCTTCATGGGGG + Intergenic
1084203822 11:67579402-67579424 CACAGCCTGCAGCCTCCAGGAGG - Intergenic
1084384905 11:68837473-68837495 GAGAGCTAGCAGCTTGCTGTGGG + Intronic
1085035893 11:73299823-73299845 TCCATGTAGCAGCTTCCTGGTGG - Intergenic
1086082452 11:82918976-82918998 CAGTTCTAGCAGCTTTCTGGAGG + Intronic
1086297929 11:85392048-85392070 CAGTTCTAGGAGCTTCCTGGAGG - Intronic
1086755030 11:90550013-90550035 CAGAGCTAGAGGCTTGCTGGAGG - Intergenic
1088645623 11:111913967-111913989 CAGAGGTAGCAGCATCCTTGGGG + Exonic
1089381473 11:118035772-118035794 CACACTTAGCACCTGCCTGGAGG - Intergenic
1089450522 11:118592386-118592408 CACAGGGAGCAGGTTCATGGTGG - Intronic
1090955860 11:131512486-131512508 CACAGCTGGGTGCCTCCTGGAGG + Intronic
1091854545 12:3728800-3728822 CACAACTGGCAGCTCTCTGGAGG - Intronic
1092238853 12:6825521-6825543 CACAGCCAGCACCATCCAGGGGG - Exonic
1096611505 12:52805120-52805142 CACAACCTGCAGCCTCCTGGTGG + Intergenic
1098671561 12:73235957-73235979 TGCAGCCAGCATCTTCCTGGCGG + Intergenic
1100601767 12:96117754-96117776 AAGGGGTAGCAGCTTCCTGGGGG - Intergenic
1101045945 12:100806077-100806099 TACAGCTTGCAGTTTCCTGGAGG + Intronic
1101961745 12:109256067-109256089 CACAGCCAGGAGTGTCCTGGGGG + Intronic
1102196217 12:111026933-111026955 GACAGCTGGCAGCTTCCAGGAGG - Intergenic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1102432757 12:112896643-112896665 CCCAGCTGGCAGCCTCCTGGAGG - Exonic
1102718537 12:114996114-114996136 CACAGCTAGCAAATTCATGCTGG - Intergenic
1104606633 12:130194194-130194216 CACATGTAGGAGCTTTCTGGGGG + Intergenic
1106052347 13:26203565-26203587 CACTGCTAGGAGCTGCCTGGGGG - Intronic
1107601323 13:42015823-42015845 GACAGCCAGGAGCCTCCTGGGGG + Intergenic
1108484910 13:50913731-50913753 CACAGAAAGCAGTTTCATGGAGG + Intronic
1108595323 13:51944175-51944197 CACAGCCAGAACCTTCCTGAGGG + Exonic
1109415918 13:62040133-62040155 TAAAGTTAGCAGCTTCCTGAAGG + Intergenic
1110168664 13:72474070-72474092 CACAGCTAATGCCTTCCTGGGGG + Intergenic
1111456548 13:88491966-88491988 CAGAGCTTTAAGCTTCCTGGAGG + Intergenic
1111974952 13:94956602-94956624 CAGAGCTGGCAGCTTTCTTGTGG + Intergenic
1112701674 13:102017140-102017162 GACAGCTAGCAGCATACTTGGGG - Intronic
1113887108 13:113666751-113666773 CACAGTGACCAGCTTCCTGGGGG - Intergenic
1115315070 14:32016700-32016722 CTCAGCAAGCAGCTTCCTGAAGG + Intronic
1117108328 14:52421546-52421568 CAGATATAGCAGCTTCATGGTGG - Intergenic
1118307570 14:64668020-64668042 CACAGACAGCACTTTCCTGGGGG - Intergenic
1118617839 14:67587146-67587168 CACAGCTGGCAGGCTCCGGGTGG - Exonic
1118704952 14:68471885-68471907 CACAGCCACCAGTTTCCTGAGGG + Intronic
1119266980 14:73268550-73268572 CACAGGTAGCCCGTTCCTGGAGG - Exonic
1119358936 14:74031619-74031641 CACAGATGGCCGCTTCCTGCTGG + Intronic
1120145973 14:80978710-80978732 CACAGAAAGCTGTTTCCTGGAGG + Intronic
1121489135 14:94345559-94345581 CTCACCTAGTAGCTTCCTGGTGG + Intergenic
1121723874 14:96131846-96131868 CACAGCATGCAGCTCCGTGGTGG + Intergenic
1122124623 14:99572320-99572342 CACAGCTTTCAGTTTCCTTGGGG - Intronic
1123918483 15:25054441-25054463 CACAGGTAGGAGAGTCCTGGGGG + Intergenic
1124998171 15:34744275-34744297 CTCATCTAGCAGCTTCCTGAAGG + Intergenic
1125152652 15:36550709-36550731 CACTGCTAGGAATTTCCTGGGGG - Intergenic
1126129937 15:45330882-45330904 TGCAGCCAGCAGCTTCATGGTGG - Intergenic
1127597734 15:60503695-60503717 AAAAGCTAACATCTTCCTGGAGG - Intronic
1128241545 15:66104793-66104815 CACATCTAACAGCATCATGGGGG + Intronic
1128361216 15:66963153-66963175 CACTGCCGGCAGCATCCTGGAGG - Intergenic
1131075061 15:89490282-89490304 CTCAGCTAGCAGCTACCTGGAGG + Intronic
1131630234 15:94168393-94168415 CACAGCCGGTTGCTTCCTGGGGG - Intergenic
1134254780 16:12601962-12601984 CACCTCTAGGAGCTTCCTGAAGG + Intergenic
1136097181 16:27965554-27965576 CAGAGCTTGCAGCTTGCTGGGGG - Intronic
1136181708 16:28557357-28557379 CCCAGTTTGGAGCTTCCTGGAGG + Intronic
1136621208 16:31429655-31429677 CAAAGCTAGAAGCTTCCTATTGG - Intergenic
1137725989 16:50657074-50657096 CCCAGCTACCAGCTACTTGGAGG + Intergenic
1138115562 16:54357992-54358014 CCCAGCTGGCAGCTTCATGATGG - Intergenic
1139939935 16:70597958-70597980 CCCAGCTACCAGCTACTTGGAGG - Intronic
1140271565 16:73470823-73470845 CACGGCTACCTGTTTCCTGGGGG + Intergenic
1141618344 16:85222530-85222552 AATAGCTATCAGCCTCCTGGCGG - Intergenic
1142308023 16:89296376-89296398 CACAGCTCCCCGCTTCCTGCAGG + Intronic
1143086113 17:4417320-4417342 CAAGCCTGGCAGCTTCCTGGAGG + Intergenic
1143583343 17:7838890-7838912 CACAAATAGCACCTCCCTGGGGG + Intergenic
1143659534 17:8315983-8316005 CATGGCTAGCGGCTGCCTGGAGG - Intronic
1144086357 17:11812462-11812484 CAAAGCCAGGAACTTCCTGGAGG - Intronic
1144670289 17:17128998-17129020 CCCAGCTCCCAGCTGCCTGGTGG - Intronic
1144756904 17:17685401-17685423 CAGAGCTGGAGGCTTCCTGGAGG + Intronic
1145784059 17:27582750-27582772 CCCAGCTGGGAGCTCCCTGGGGG - Exonic
1146543568 17:33718831-33718853 GTCAGCTAGCAGCTTGCAGGTGG + Intronic
1147128954 17:38394581-38394603 CACATCTAGCAGTATCCTGAAGG - Intronic
1147656070 17:42091775-42091797 CCTAGTTAGCAGCTTCCTGAGGG - Intergenic
1147671422 17:42179009-42179031 CACAGACAGCAACTTCCTGCTGG - Exonic
1148699155 17:49577523-49577545 CACACCTGGGAGATTCCTGGAGG - Intronic
1149505501 17:57190526-57190548 CAAAGCTGGCACCATCCTGGTGG + Intergenic
1150093052 17:62346809-62346831 CAGTTCTAGCAGCTTTCTGGGGG + Intergenic
1150361030 17:64534304-64534326 CCTTGTTAGCAGCTTCCTGGTGG + Intronic
1151302014 17:73233296-73233318 CAAAACTAGCATCCTCCTGGAGG + Exonic
1151392323 17:73795647-73795669 GACTGCTGGCAGGTTCCTGGGGG + Intergenic
1151518779 17:74613977-74613999 CACACCTCCCATCTTCCTGGTGG - Exonic
1151886912 17:76928279-76928301 CACAGGGAGCAGATTTCTGGAGG + Intronic
1151902365 17:77024954-77024976 CATAGCTAGGAGCTGCCTGGTGG - Intergenic
1152003265 17:77660814-77660836 CACAGATAGAACCTTCCCGGTGG + Intergenic
1152634866 17:81426795-81426817 CACAGCCAGCAGCCGCCTGATGG + Exonic
1152635237 17:81428173-81428195 CACTACTAGCGGCCTCCTGGAGG + Intronic
1153764126 18:8359304-8359326 CCCAGCTCGCAGTTACCTGGAGG - Intronic
1153887398 18:9478850-9478872 CAGGGCGAGCAGCTCCCTGGTGG + Intronic
1157309191 18:46539054-46539076 GTTAGCAAGCAGCTTCCTGGTGG + Intronic
1157541210 18:48509244-48509266 CAGTTCTAGGAGCTTCCTGGAGG - Intergenic
1157913566 18:51641880-51641902 CACAACTTGCAGCTTCCCAGTGG - Intergenic
1161064566 19:2231306-2231328 CAGGGCTGGCAGCTCCCTGGAGG - Exonic
1161573159 19:5041275-5041297 AACAGGGACCAGCTTCCTGGTGG + Intronic
1163323531 19:16588452-16588474 CTCAGCTAGGATCTTCCAGGCGG - Intronic
1164627290 19:29737947-29737969 CATGCTTAGCAGCTTCCTGGAGG + Intergenic
1165077782 19:33290387-33290409 CACTGTGAGCAGCTTCATGGTGG + Intergenic
1165786441 19:38464632-38464654 CAGAGCCAGCAGAGTCCTGGGGG - Exonic
927327994 2:21828677-21828699 CACTTCTAGGAGCTTTCTGGAGG + Intergenic
928225892 2:29447734-29447756 CAAAGCCAGGAGCTACCTGGAGG - Intronic
928355097 2:30605321-30605343 CACTGATTGCAGCTTCCAGGTGG - Intronic
930051327 2:47218368-47218390 CACAGCTTGCAGCGTCCTTGCGG + Intergenic
932073831 2:68644973-68644995 CACAGCCTGGAGCTCCCTGGAGG - Intronic
932731387 2:74224533-74224555 CACAGCAAGCGGGTTCCTGTGGG - Intronic
933647642 2:84825491-84825513 CATAGCTAGAAGGTTCCTGGAGG + Intronic
934720203 2:96568860-96568882 CACAGTGAGCTGTTTCCTGGAGG + Intergenic
935433471 2:103003131-103003153 CACAGCCAGCAGCAGCCAGGGGG - Intergenic
935955585 2:108373666-108373688 CACACCTGGCTGCTTCCTGCTGG + Intergenic
936635311 2:114249533-114249555 CTCAAATTGCAGCTTCCTGGTGG + Intergenic
939673609 2:145043891-145043913 CATTGCTAGTTGCTTCCTGGAGG + Intergenic
939709010 2:145491883-145491905 CACATCTTTCAGCTTCCAGGTGG - Intergenic
940991699 2:160103783-160103805 CAAAGGTGGGAGCTTCCTGGAGG - Intronic
942413465 2:175734971-175734993 TACTGCTAGCAGCTTCCACGTGG - Intergenic
942642190 2:178072169-178072191 CACAGCCAGCCCCTTCCCGGTGG - Exonic
946757546 2:222962814-222962836 CTCAGTTAGCAGCTTCCACGTGG + Intergenic
947753656 2:232545623-232545645 CACAGCTGGCATCTTCCTCATGG + Exonic
948601074 2:239107813-239107835 CAGAGGCAGCAGCTTCCTGCAGG + Intronic
948677831 2:239609477-239609499 CACGGCACTCAGCTTCCTGGTGG + Intergenic
1168886868 20:1266314-1266336 CCCAGCTAGCCGCCTCCTGCAGG + Exonic
1169400259 20:5273729-5273751 CTCCACTGGCAGCTTCCTGGGGG + Intergenic
1169475521 20:5928015-5928037 CACAGTTGGCAGCTTAATGGTGG + Intergenic
1171165944 20:22971314-22971336 CAGTGCTAGGAGCTTTCTGGAGG - Intergenic
1171181579 20:23094772-23094794 CACAGCCAGCACCTACCTGGGGG - Intergenic
1173909673 20:46657216-46657238 CACACCCAGCTACTTCCTGGAGG - Intronic
1173922588 20:46757431-46757453 CCCAGCTAGCTGCTGCCTGCAGG - Intergenic
1175007231 20:55697786-55697808 CACAGCTAGAATTTTCCAGGAGG - Intergenic
1178743087 21:35221808-35221830 CACAGCTTTGAGCTTCCTGTAGG - Intronic
1178916993 21:36710408-36710430 CACAGCTCGCCACTTCCAGGTGG + Intronic
1179348593 21:40585083-40585105 CACAAGTAGAAGCTTCCTGAGGG + Intronic
1182289411 22:29266810-29266832 CACATCTACCAGTTTCCTGCAGG + Intronic
1183172337 22:36197584-36197606 CATAGCTTGCAGTTTCATGGGGG - Intronic
1184891453 22:47381959-47381981 CACCCCTCGCAGCTTCCTGTTGG - Intergenic
1185415103 22:50705406-50705428 CACCGCCAGCAGCTGCCTGGAGG + Intergenic
949591670 3:5500752-5500774 CACTGCCAACAGTTTCCTGGGGG - Intergenic
950437047 3:12986375-12986397 CAGAGCCTGCAGCTTCCTTGGGG + Intronic
950882867 3:16337202-16337224 CACAGCTAGCAGCTCCAAGATGG - Intronic
951085013 3:18502157-18502179 CAGATCTAGCAGTTTGCTGGAGG - Intergenic
954138302 3:48592408-48592430 CACAGCCCACAGCCTCCTGGTGG - Exonic
956688453 3:71854416-71854438 GACAGCTAGCAGCACCCAGGAGG + Intergenic
957286285 3:78221557-78221579 CACAGCTAGGATCTTCCTGGGGG + Intergenic
958923716 3:100134851-100134873 CAAAACAAGCAGCTTGCTGGTGG - Intronic
961361502 3:126370918-126370940 CAGAGCATGCACCTTCCTGGGGG + Intergenic
963010869 3:140769058-140769080 CACAGCTGTCAGCTGCCTGTGGG - Intergenic
963176471 3:142303074-142303096 CAGTTCTAGCAGCTTTCTGGAGG - Intergenic
963583560 3:147156101-147156123 CCTATCTAGCAGCATCCTGGAGG - Intergenic
963864742 3:150348365-150348387 CACTGCTAGCAGTTTCTTGGAGG - Intergenic
965688921 3:171334421-171334443 CACAGAAAGCATCTTCCGGGAGG + Intronic
966389164 3:179433442-179433464 AAGAGCTAGCAGCTTCCAGCTGG + Intronic
966479830 3:180394289-180394311 CACAACTAGTAGCTTTCTTGTGG + Intergenic
966984186 3:185164711-185164733 CCCCGATAGCAGCTCCCTGGGGG - Intergenic
968580852 4:1394059-1394081 CACAGTTGGCAGCTGCCTGCTGG - Exonic
968871308 4:3244101-3244123 CCCTGCTGGCAGCTGCCTGGGGG - Intergenic
969515255 4:7644171-7644193 CAGAGGTAGAAACTTCCTGGTGG - Intronic
969604435 4:8195458-8195480 CACACCCAGCAGCCTCCTAGAGG - Intronic
969908640 4:10422103-10422125 CACAATTAGAAGATTCCTGGGGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
973048937 4:45571033-45571055 CACACACAGCAGCTCCCTGGGGG + Intergenic
973731022 4:53822400-53822422 CACAGCCAGCAGCCTCCTTGGGG + Intronic
975088718 4:70374997-70375019 CAGTGCTAGGAGCTTTCTGGAGG + Intronic
976480430 4:85537485-85537507 TAAAGCTAGCAGATTCCTGTAGG + Intronic
979823922 4:125209402-125209424 CACAGCTAGCAGGTTGGTGCTGG + Intergenic
985782358 5:1878002-1878024 CAGGGCGAGCAGCTCCCTGGCGG + Exonic
985786111 5:1895914-1895936 CACAGCTGGGCCCTTCCTGGTGG + Intergenic
986456347 5:7924424-7924446 CATTGCTGGCAGCTTCCTGTGGG + Intergenic
989492092 5:42069377-42069399 CACAGCTAGTATCATACTGGGGG - Intergenic
996032303 5:118719478-118719500 CAGTTCTAGCAGCTTTCTGGAGG - Intergenic
997876593 5:137554123-137554145 CAGATCTAGGAGCTTTCTGGAGG - Intronic
999436356 5:151566508-151566530 CACTGTCAGCAGCTTCCAGGAGG + Exonic
999754381 5:154653549-154653571 CACAGATAACATGTTCCTGGGGG - Intergenic
1002322618 5:178384676-178384698 CAGAGCCAGAAGCCTCCTGGGGG + Intronic
1002414799 5:179114384-179114406 CACAGGGTGCAGCTTGCTGGAGG + Intronic
1003139233 6:3457018-3457040 CAGAGCTCGCGGCTTCCGGGAGG - Intronic
1003168292 6:3700369-3700391 CAAAGCTAGCAGCTACCATGTGG + Intergenic
1004171184 6:13296664-13296686 CATAGCTAGCTGATTCCTGGAGG - Intronic
1004763560 6:18698404-18698426 CACAGCTCGCAGTTTACTCGAGG - Intergenic
1005099777 6:22158644-22158666 CATAGCTAGCAGCTTCCAGAAGG - Intergenic
1009607435 6:65891395-65891417 CACACAGAGCAGCTTTCTGGTGG - Intergenic
1011227848 6:85127323-85127345 TACTGCTCGCAGGTTCCTGGTGG - Intergenic
1012141336 6:95630396-95630418 CACAGCTAAATGCTTCCTGCTGG + Intergenic
1012156250 6:95823043-95823065 CAGTTCTAGGAGCTTCCTGGAGG - Intergenic
1016573563 6:145542328-145542350 CACAGCTTGCCTTTTCCTGGTGG + Intronic
1018240740 6:161771436-161771458 CACAGGTAGCAGCTTGGGGGAGG + Intronic
1018632910 6:165835760-165835782 CACAGCCAGCAGCGTACAGGAGG + Intronic
1019195787 6:170282032-170282054 GCCAGCAAGCAGCTTCCTGAGGG + Intergenic
1019730424 7:2626769-2626791 CACAGCCAGCCGGTGCCTGGCGG - Intergenic
1020070496 7:5223869-5223891 CACAGGTGGGAGCTCCCTGGAGG - Intronic
1023041189 7:36174548-36174570 CTCATCCAGCAGCTGCCTGGCGG - Intronic
1024001353 7:45191270-45191292 CACTGCTAGGAGCTTCCTGTAGG + Intergenic
1024011801 7:45273396-45273418 CACATCTAGCATGTTGCTGGTGG - Intergenic
1027231729 7:76276602-76276624 CACAAAAAGCAGCTTCCTGGAGG + Intronic
1032089922 7:128906389-128906411 CACAGACATCAGATTCCTGGAGG + Intronic
1033597113 7:142866093-142866115 CACCGCTGGCAGGTTCCTGGCGG - Exonic
1034292780 7:149945910-149945932 CCCAGATAGCTGCTTCCTGCCGG - Intergenic
1036217003 8:6889140-6889162 CACAGCTTGCAACTCCCTGCGGG - Intergenic
1038019046 8:23537541-23537563 CAAGCCCAGCAGCTTCCTGGTGG + Intronic
1038083937 8:24173134-24173156 AACATCTAGCACCTTCCTGGTGG - Intergenic
1040108114 8:43551431-43551453 CAAAACTAGCACCTTCCTCGGGG - Intergenic
1041040762 8:53843543-53843565 CTCTGCTAGCTGCTTCCGGGCGG - Intronic
1047327914 8:123857746-123857768 CTCAGCCAGCAGGTTCTTGGAGG + Intronic
1049411397 8:142475467-142475489 CACAGCTTCCAGCCGCCTGGGGG - Exonic
1051252245 9:15172294-15172316 CATTTCTAGAAGCTTCCTGGTGG + Intronic
1053424858 9:38004072-38004094 CACAACTCCCAGGTTCCTGGAGG + Intronic
1056493386 9:87130698-87130720 CAGAGCTAGACACTTCCTGGTGG - Intergenic
1056846779 9:90045122-90045144 CACAGGCTGCAGCTTCCTAGGGG + Intergenic
1057040493 9:91844292-91844314 CACTGTTTGCAGGTTCCTGGGGG + Intronic
1057065824 9:92050025-92050047 CAAAGCAAGAATCTTCCTGGAGG - Exonic
1057297381 9:93857152-93857174 AACTCCTAACAGCTTCCTGGAGG - Intergenic
1057707247 9:97404719-97404741 CCCAGGAAGCTGCTTCCTGGAGG + Intergenic
1057857530 9:98613010-98613032 CAGAGCGTGCAGCTTCCTGTGGG - Intronic
1058039088 9:100284453-100284475 CCCAGCAAGCAGCCTCCTGCTGG + Exonic
1059415141 9:114157525-114157547 AGCAGCCAGCAGCCTCCTGGTGG + Intronic
1060284195 9:122234434-122234456 CACAGGAAGCAGCATCCTGCAGG + Intergenic
1061286872 9:129628667-129628689 CCCAGCATGCAGCTTCCTGGGGG - Intronic
1061667342 9:132168318-132168340 CAGAGGTACCAGCTGCCTGGGGG - Intronic
1061959679 9:133981693-133981715 CACACATAGCATCTTCTTGGTGG - Intronic
1062019126 9:134308011-134308033 CACTGCTTGCTGTTTCCTGGGGG + Intergenic
1187735166 X:22295674-22295696 CACAGCCAGGAGCTTTTTGGGGG - Intergenic
1190896938 X:54629144-54629166 CAGATCTAGAAGCTTTCTGGAGG + Intergenic
1192014127 X:67310554-67310576 CAGTTCTAGGAGCTTCCTGGAGG + Intergenic
1194932314 X:99902295-99902317 CAGTTCTAGGAGCTTCCTGGAGG - Intergenic
1195796116 X:108649001-108649023 CAGTTCTAGCAGCTTTCTGGAGG - Intronic
1196831263 X:119777366-119777388 CACCGGGACCAGCTTCCTGGGGG - Intergenic
1196894509 X:120321758-120321780 TGCAGCAAGCAGCTGCCTGGAGG + Intergenic
1200139299 X:153890650-153890672 CAGAGGTAGCAGCTCCCTTGAGG - Intronic
1200769683 Y:7112228-7112250 CACAGTTTCCAGTTTCCTGGAGG + Intergenic