ID: 1079349647

View in Genome Browser
Species Human (GRCh38)
Location 11:19681624-19681646
Sequence CTATTGGTGTGGAGGACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079349647_1079349659 21 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349659 11:19681668-19681690 GGCCAGCCTTTGGCAAGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 173
1079349647_1079349657 11 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349657 11:19681658-19681680 GGGAGGATCTGGCCAGCCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 225
1079349647_1079349661 26 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349661 11:19681673-19681695 GCCTTTGGCAAGTCTGGGATTGG 0: 1
1: 0
2: 0
3: 17
4: 148
1079349647_1079349654 -6 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349654 11:19681641-19681663 CAATAGCCTGCAGTTCTGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 123
1079349647_1079349658 20 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349658 11:19681667-19681689 TGGCCAGCCTTTGGCAAGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1079349647_1079349651 -10 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349651 11:19681637-19681659 ACACCAATAGCCTGCAGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 110
1079349647_1079349656 0 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349656 11:19681647-19681669 CCTGCAGTTCTGGGAGGATCTGG 0: 1
1: 0
2: 3
3: 24
4: 267
1079349647_1079349652 -9 Left 1079349647 11:19681624-19681646 CCCTTGGTCCTCCACACCAATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1079349652 11:19681638-19681660 CACCAATAGCCTGCAGTTCTGGG 0: 1
1: 0
2: 2
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079349647 Original CRISPR CTATTGGTGTGGAGGACCAA GGG (reversed) Intronic
903111015 1:21133557-21133579 CTATTGGTTTGGAGTCCCACTGG + Intronic
904614413 1:31742269-31742291 CTGGTGGTGTGGAGAACCACAGG + Intronic
907687643 1:56629271-56629293 ATCTTGGTTTGGAGGAGCAAGGG - Intronic
912729796 1:112092020-112092042 CAATTGGGGTGGAGGAAGAAGGG + Intergenic
914716983 1:150261608-150261630 CCATTGTTGTGCAGGTCCAAAGG - Exonic
915721693 1:157990590-157990612 CAACTGGTGTTGAGGACCACTGG + Intergenic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
920713288 1:208316073-208316095 CCATGGATGTGGAGGAGCAAAGG + Intergenic
921259430 1:213372405-213372427 CTATCTATGTGCAGGACCAAAGG - Intergenic
1066336112 10:34480149-34480171 AGATAGGTGTGGAGGATCAAAGG + Intronic
1072329484 10:94332855-94332877 ATATTTGTGTGGATAACCAAAGG - Intergenic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1078308335 11:10213638-10213660 CTATTGGTCTAGAGGCCAAAAGG + Intronic
1078410157 11:11108038-11108060 CCATTGATGAGGAGGTCCAAAGG - Intergenic
1079349647 11:19681624-19681646 CTATTGGTGTGGAGGACCAAGGG - Intronic
1081137738 11:39459938-39459960 CTGCTGTTGTGGAGAACCAATGG - Intergenic
1081458611 11:43250114-43250136 CTTTTGGTGTAAAGTACCAACGG + Intergenic
1087466411 11:98512250-98512272 CTATTGGTGAGGAGGTAAAATGG - Intergenic
1089918959 11:122188799-122188821 CCATGGATGTGAAGGACCAATGG + Intergenic
1096743380 12:53710422-53710444 CTATTGGGTTGGAGGACGAGGGG + Intronic
1096800978 12:54110272-54110294 CTATGGGTGTGGAGTACCAGGGG - Intergenic
1103362475 12:120362113-120362135 CTGGTGGTGTGGGGGACCAGAGG - Intronic
1105996116 13:25673686-25673708 CTATTGGTGCGTAGGAAAAATGG + Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1111658562 13:91181018-91181040 CTATGGGTTTGGAGAACCAGAGG + Intergenic
1114734736 14:25032636-25032658 CTAGTGGTGGGGAGGACAACAGG + Intronic
1115709892 14:36039321-36039343 CTCTTGGGGTGGAGGACAAGTGG - Intergenic
1117872246 14:60213370-60213392 TTATTGATGTAGAAGACCAAAGG - Intergenic
1118636747 14:67755008-67755030 CTATTGGTGTGGGGCAGAAAGGG - Intronic
1122139760 14:99655810-99655832 CTCTTGGGTTGGAGGAACAAAGG + Intronic
1122302138 14:100737167-100737189 AGATTGGGGTGGAGGACCCAGGG - Exonic
1127703566 15:61525589-61525611 GTATTGGTGTGAAGGAAGAATGG - Intergenic
1128955919 15:71944704-71944726 CTATTGGTGTTAAGGATCAATGG - Intronic
1132909309 16:2300121-2300143 CTATTGGTGTGGGAAGCCAAGGG - Exonic
1135037345 16:19089350-19089372 CCATAGGTGAGGAGGACCACGGG - Intergenic
1136143511 16:28301998-28302020 GTATTTGTGTTGAGGACCAAGGG + Intronic
1141895616 16:86957012-86957034 CTTTTGGTGCAGAGGTCCAATGG - Intergenic
1143916371 17:10296324-10296346 CTTATGGTGTGGAAGACCCAAGG + Intergenic
1146427402 17:32754683-32754705 CTATGGATGTGAAGGAGCAAGGG + Intronic
1146609184 17:34289516-34289538 CCATTGATCTGGAGGGCCAATGG + Intergenic
1147888462 17:43700201-43700223 CCAGTGGGGTGGGGGACCAAGGG + Intergenic
1151504525 17:74518336-74518358 CTATTGGTGGGGAGGTAAAATGG + Intergenic
1157333873 18:46723037-46723059 CCATTGGTGCCGAGGACCATGGG + Intronic
1157615356 18:48984086-48984108 CTGTTGGTCTGGATGACCACAGG - Intergenic
1157753578 18:50198665-50198687 CTAGTGGTGAGGAGGAGAAAGGG - Intergenic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
926334084 2:11850235-11850257 CCAATTGTGTGAAGGACCAATGG - Intergenic
927622098 2:24672037-24672059 CCATGGATGTGGAGGACTAATGG + Intronic
929920378 2:46167395-46167417 CTGTTGGTGAGGAGGACAACAGG + Intronic
935265796 2:101392775-101392797 CTATTAGTGAGTAGCACCAAAGG - Intergenic
938160709 2:128982362-128982384 CCATGGATGTGGAGGACCACAGG + Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
943678654 2:190744193-190744215 CTGTTGGTGTGTGGGAGCAAAGG - Intergenic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
1170531003 20:17291614-17291636 CAATTGCTGTGGAGGACAATTGG - Intronic
1171852750 20:30320063-30320085 CCATGGGTGTGGAGTACCAGGGG - Intergenic
1172544726 20:35751262-35751284 CTATTGTTGTAAAGGAGCAAGGG + Intergenic
1177624906 21:23646761-23646783 CTTTGGGTGTGGAGGAGCACAGG - Intergenic
1178785910 21:35653024-35653046 CTCTTGGACTGGAGGAACAATGG - Intronic
956232391 3:67031441-67031463 ATAGTGTTGTGTAGGACCAAGGG - Intergenic
956948588 3:74253426-74253448 CTAATGGTGAGGAGGACAAAGGG + Intergenic
958913504 3:100022275-100022297 GTGGTGGAGTGGAGGACCAATGG - Intronic
959374840 3:105576411-105576433 CTTTTGGTGTGGGAGATCAAAGG + Exonic
971252553 4:24985508-24985530 CTATTGGAGAGGAGGATCCACGG - Intergenic
976665728 4:87588753-87588775 CTATTGGTTTGAAGGGGCAACGG - Intergenic
993048170 5:82892755-82892777 CTGGTGCTGTGCAGGACCAATGG + Intergenic
1001602470 5:172938076-172938098 CTATTGGTGTGCAGGGACATGGG + Intronic
1002549861 5:179979671-179979693 CTGGTGGCTTGGAGGACCAAGGG - Intronic
1003148586 6:3529742-3529764 CTATTGGTCTGGATAACCCAGGG - Intergenic
1006816380 6:36853232-36853254 AGATAGGTGTGGAGGACCATGGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1016585013 6:145674285-145674307 CTGTAGGTCTGTAGGACCAAAGG + Intronic
1018171429 6:161146295-161146317 CTCTAGGTGTAGTGGACCAAGGG - Intronic
1019812267 7:3173462-3173484 CTAAGTGTGTGGATGACCAAAGG + Intronic
1021920417 7:25479432-25479454 CTCTTGGTGGGGAGGGTCAATGG + Intergenic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1037457705 8:19080702-19080724 GAATTGGTTTTGAGGACCAACGG + Intronic
1049187479 8:141265200-141265222 CTGTGGGTGAGGAGGACCAGAGG - Intronic
1050727716 9:8670775-8670797 CTAGGGGTGTGGATGACCACTGG + Intronic
1052261058 9:26516729-26516751 CTATTGTTGTGAAGCACTAAAGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053790545 9:41683343-41683365 CCATGGGTGTGGAGTACCAGGGG - Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054154614 9:61631458-61631480 CCATGGGTGTGGAGTACCAGGGG + Intergenic
1054178890 9:61895042-61895064 CCATGGGTGTGGAGTACCAGGGG - Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054474389 9:65562534-65562556 CCATGGGTGTGGAGTACCAGGGG + Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054658647 9:67685789-67685811 CCATGGGTGTGGAGTACCAGGGG + Intergenic
1059368745 9:113807886-113807908 CTCTAGGTGTGGAGGTCCAATGG - Intergenic
1189497347 X:41521050-41521072 CAGTGAGTGTGGAGGACCAAGGG - Intronic
1190617978 X:52257764-52257786 ATATTTGTGTTGGGGACCAAGGG + Intergenic
1190847348 X:54206531-54206553 GTATTGGTGGGGAGATCCAAAGG - Intronic
1194610147 X:96033801-96033823 CAATTGGTTGGCAGGACCAACGG + Intergenic
1197176514 X:123492060-123492082 CTATTGTTTTGGAGGATCCAGGG - Intergenic
1202576327 Y:26329877-26329899 CTTTTTGTGTGGAGAGCCAATGG - Intergenic