ID: 1079354068

View in Genome Browser
Species Human (GRCh38)
Location 11:19715408-19715430
Sequence CCCCATGCAGAAGTGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079354068_1079354072 1 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354072 11:19715432-19715454 TTCCCTTCATCCATGGACTTGGG 0: 1
1: 0
2: 0
3: 15
4: 197
1079354068_1079354078 19 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354078 11:19715450-19715472 TTGGGGTTTATGAGGTGTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 135
1079354068_1079354073 2 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354073 11:19715433-19715455 TCCCTTCATCCATGGACTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 190
1079354068_1079354077 11 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354077 11:19715442-19715464 CCATGGACTTGGGGTTTATGAGG 0: 1
1: 0
2: 1
3: 18
4: 163
1079354068_1079354080 27 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354080 11:19715458-19715480 TATGAGGTGTAGTGGGCAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1079354068_1079354070 -6 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354070 11:19715425-19715447 ATGGGGTTTCCCTTCATCCATGG 0: 1
1: 0
2: 1
3: 8
4: 130
1079354068_1079354071 0 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354071 11:19715431-19715453 TTTCCCTTCATCCATGGACTTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1079354068_1079354081 30 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354081 11:19715461-19715483 GAGGTGTAGTGGGCAGTCGGTGG 0: 1
1: 0
2: 0
3: 15
4: 203
1079354068_1079354079 20 Left 1079354068 11:19715408-19715430 CCAGGGTACACTTCTGCATGGGG 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1079354079 11:19715451-19715473 TGGGGTTTATGAGGTGTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079354068 Original CRISPR CCCCATGCAGAAGTGTACCC TGG (reversed) Intronic
902866232 1:19281768-19281790 CCCCTTGCACCAGTGTGCCCAGG + Intergenic
904433537 1:30479757-30479779 CCCCATGCAGCCGTGTCCCTGGG + Intergenic
904601009 1:31672678-31672700 CCCTATGCAGGAGGGTTCCCTGG - Intronic
904887714 1:33753760-33753782 CCCCATGCACCAATGTGCCCAGG + Intronic
905965640 1:42093114-42093136 CCCCTTGCACCAGTGTGCCCAGG - Intergenic
906991837 1:50747327-50747349 CCCCTTGCATCATTGTACCCTGG + Intronic
907491603 1:54812180-54812202 CTCCATGCAGGTGTGTACCCAGG + Exonic
909728916 1:78870833-78870855 CCCCTTGCATAAATGTTCCCTGG - Intergenic
915787029 1:158624401-158624423 CCCCTTGCATCAGTGTGCCCTGG + Intronic
916272901 1:162963052-162963074 CCCCACCCAGAAGTGGACTCAGG + Intergenic
917211823 1:172639596-172639618 CCTCATGCAGGATTCTACCCTGG - Intergenic
917228822 1:172814071-172814093 CACCTTGCATAAGTGTCCCCTGG - Intergenic
918308379 1:183267678-183267700 CCGCCTGCAGGAGTGTGCCCAGG + Intronic
918668155 1:187178214-187178236 CTCCCTGCATCAGTGTACCCTGG - Intergenic
919657666 1:200213646-200213668 CGCCACGCGGAAGTGCACCCTGG - Intergenic
920339506 1:205267186-205267208 CCCCAGGGGGAAGTGTAACCTGG + Intronic
921758279 1:218883609-218883631 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
923721742 1:236472828-236472850 CCCCATGCAGATGTGTGACTTGG - Intronic
1062987057 10:1778880-1778902 CCTCATGCAAAAGTTTACCAGGG + Intergenic
1063767688 10:9160992-9161014 CCCCATGCACCAGTGTGCCTTGG + Intergenic
1065833355 10:29634930-29634952 CCCCAGGCTGAAGTGTCCTCAGG - Exonic
1067663832 10:48256576-48256598 CCCAATGCAGGAGTGTCTCCAGG - Intronic
1068369176 10:56091520-56091542 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
1068434518 10:56973447-56973469 CCCCTTGCATCAGTGTATCCTGG - Intergenic
1068662111 10:59633210-59633232 CCCCAAGCAAAAGTGCAACCTGG + Intergenic
1069885715 10:71622368-71622390 CCCCATGCAGAAGGGAAAACAGG - Intronic
1069993482 10:72328946-72328968 CCTCAGGCAGAAGGGAACCCGGG + Intergenic
1075532838 10:123244527-123244549 CCCTATGGAGAAGTGCACCTGGG - Intergenic
1079273006 11:19006079-19006101 CCCCATGCATCAGTGTGCCCTGG + Intergenic
1079354068 11:19715408-19715430 CCCCATGCAGAAGTGTACCCTGG - Intronic
1079970702 11:27031985-27032007 CCCCATGCTGCAGCTTACCCTGG + Intergenic
1080136142 11:28857330-28857352 ACCCTTGCAGCAGTGTGCCCTGG - Intergenic
1080964168 11:37195108-37195130 CCCCTAGCACTAGTGTACCCAGG - Intergenic
1081045549 11:38269456-38269478 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1081364068 11:42213677-42213699 CCCCATGTAGCAGTGCACCTTGG + Intergenic
1082733070 11:56824316-56824338 CGCCTTGCAGCAGTGTGCCCTGG - Intergenic
1084230591 11:67749948-67749970 CTCCATCCAGCAGTGTAACCAGG - Intergenic
1084308926 11:68304693-68304715 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
1084498620 11:69521009-69521031 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1084499355 11:69525632-69525654 CGCCAAGCAAAAGTGCACCCAGG + Intergenic
1087495868 11:98890385-98890407 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1087938200 11:104060422-104060444 TCCCACCCAGATGTGTACCCAGG - Intronic
1088567190 11:111184473-111184495 CCCCTTGCAGCAGTGTGCCCTGG + Intergenic
1090756287 11:129794714-129794736 CCCCTTGCATTAGTGTGCCCTGG - Intergenic
1092853016 12:12647925-12647947 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1093788205 12:23216441-23216463 CCCCTTGCAGCAGTGTGCCCTGG + Intergenic
1094379802 12:29830811-29830833 CCTCTTGCACCAGTGTACCCTGG - Intergenic
1094471286 12:30804099-30804121 CCCCTTGCACAAGTGTGCCCTGG - Intergenic
1095872947 12:47050678-47050700 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1097302693 12:58035460-58035482 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1097549183 12:61045875-61045897 GCACATGCAGAAGAGTACACTGG - Intergenic
1098559044 12:71851741-71851763 CCCCTTGCATCAGTGTGCCCTGG - Intronic
1098698098 12:73584885-73584907 CCACATGCAGAGAAGTACCCTGG + Intergenic
1103081961 12:118031341-118031363 CCCCAGGCAGCAGTTTATCCTGG - Exonic
1104727092 12:131084761-131084783 CCCCATGGAGTAATGTGCCCAGG - Intronic
1104832228 12:131761127-131761149 TCCCAGGCAGAAGTGTACAATGG - Intronic
1106383653 13:29264238-29264260 CCCCATGCACTAGTGTGCCCTGG - Intronic
1107456404 13:40559765-40559787 CCCCATGCAGATGAGTGCCCTGG - Exonic
1107987356 13:45786878-45786900 CCCCATTCAGAAGTGACCTCTGG + Intronic
1108832605 13:54498572-54498594 CCTCCTGCACTAGTGTACCCTGG + Intergenic
1108855844 13:54791608-54791630 CCCCTTGCACCAGTGTCCCCAGG - Intergenic
1110343606 13:74420038-74420060 CCCCCTCTAGAATTGTACCCAGG - Intergenic
1110704239 13:78586857-78586879 GCTCATGCAGAAGAGTACTCGGG + Intergenic
1113061101 13:106323374-106323396 CCCAGGGCAGAAGTTTACCCTGG + Intergenic
1113601516 13:111572562-111572584 CAGCATGAAGAAGTGAACCCAGG - Intergenic
1114081409 14:19204015-19204037 CCCCCTGCACCAGTGTACCCTGG + Intergenic
1118419944 14:65590846-65590868 CCCCATGGAGAATTTTATCCAGG - Intronic
1118691456 14:68344287-68344309 GCCCATGCACCAGTGTGCCCTGG + Intronic
1119612370 14:76074481-76074503 CCCCATTCTGAAGAGGACCCTGG - Intronic
1119706762 14:76787916-76787938 CCCCTAACAGAAGGGTACCCTGG - Exonic
1120407177 14:84104101-84104123 CCCTTTGCAAAAGTGTGCCCTGG + Intergenic
1121177400 14:91901034-91901056 CTCCATGAAGGAATGTACCCTGG - Intronic
1121326689 14:93024295-93024317 CCCCAGGCAGAAGGATGCCCAGG + Intronic
1121922387 14:97894179-97894201 CCCCATGCTGAAATGCAGCCAGG - Intergenic
1123064684 14:105611539-105611561 CCCCCTGCACCAGTGTGCCCTGG + Intergenic
1123073987 14:105657180-105657202 CCCCCTGCACCAGTGTGCCCTGG + Intergenic
1126203902 15:46020285-46020307 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
1135485901 16:22864372-22864394 CCTCATGAAGAACTGTACCTGGG + Intronic
1137222263 16:46467344-46467366 CCTCATGAAGAAGTGTTCCTGGG + Intergenic
1137778621 16:51077743-51077765 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1138305758 16:55973004-55973026 CCTCTTGCACCAGTGTACCCAGG - Intergenic
1142281172 16:89148450-89148472 CTCCATGCATCAGTGTAGCCTGG - Intronic
1146051231 17:29555163-29555185 CCCCATGCAGTTGTGCACCCCGG + Intergenic
1147162762 17:38577676-38577698 ACCAATGCAGAACTGTACACAGG + Intronic
1148961619 17:51398009-51398031 CTCCAGGCACAAGTGTCCCCTGG + Intergenic
1151275041 17:73027939-73027961 CTCCAAGCAGACGTGTCCCCAGG + Intronic
1154484492 18:14862822-14862844 CCCCTTGCACAAGTGTGCCCTGG + Intergenic
1156306992 18:35886416-35886438 CTCCATGCAGATCTGTACACAGG - Intergenic
1156322398 18:36038756-36038778 CCCCTTGCATCAGTGTGCCCTGG + Intronic
1156789508 18:40954103-40954125 CCCCTTGCACGAGTGTGCCCTGG + Intergenic
1156858795 18:41813383-41813405 CCCCTTGCATCAGTGTAACCTGG - Intergenic
1158541947 18:58365111-58365133 CCCCATCCAGAGATGTTCCCGGG - Intronic
1159054708 18:63452227-63452249 CCCCATGCCTATGTGTTCCCAGG - Intergenic
1160010104 18:75100870-75100892 CCCCTTGCAGCAGTGTGCCCAGG - Intergenic
1160221104 18:76978521-76978543 CACCCTGCAGATGTGAACCCAGG - Intergenic
1162854903 19:13460712-13460734 CCCCAGGCACATTTGTACCCAGG + Intronic
1163092152 19:15027753-15027775 CCCAATGCAGAAGTCAGCCCTGG - Intergenic
1163200818 19:15767656-15767678 CCCAGTGAAGATGTGTACCCTGG + Intergenic
1168516465 19:57013550-57013572 CCCCTTGCATGAGTGTGCCCTGG + Intergenic
925090374 2:1150426-1150448 TCTCATGCAGATGTGTGCCCAGG - Intronic
927094737 2:19738979-19739001 CCCCGTGCTGGAGTGTCCCCAGG - Intergenic
929086201 2:38169760-38169782 CCTCATGCAAAAGTGTTGCCCGG + Intergenic
933199682 2:79434809-79434831 CACCATGCAGGAGAGAACCCAGG - Intronic
934536594 2:95139399-95139421 CCCCTTGCAGCAGTGTGCCCTGG + Intronic
935931612 2:108133008-108133030 CCCTTTGCAGCAGTGTGCCCTGG - Intergenic
935982441 2:108640548-108640570 CCCCAGGCAGAGGTGTACTGAGG - Intronic
936721069 2:115253693-115253715 CCCCTTGCAGCAGTGTGCCTTGG - Intronic
936898385 2:117455149-117455171 CCCCTTGCATCAGTGTTCCCTGG + Intergenic
937117758 2:119420963-119420985 CCCCTTGCACCAGTGTACCCAGG - Intergenic
937327954 2:121003335-121003357 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
937927836 2:127181793-127181815 TCCCAAGCAGAAGTGGACCCTGG + Intergenic
938867808 2:135442364-135442386 CCCCATCCAAAAGTGTACAAAGG + Intronic
943631578 2:190258571-190258593 CCCCTTGCATCAGTGTAGCCTGG + Intronic
943754502 2:191543925-191543947 CCTCATGCAAATATGTACCCTGG + Intergenic
944446707 2:199799077-199799099 CCCCAGGCAGGAGGGAACCCTGG - Intronic
945266858 2:207899173-207899195 CCCAATTCAGAAATGTAACCAGG - Intronic
947197604 2:227584203-227584225 CCCCTTGCACCAGTGTGCCCAGG + Intergenic
948547379 2:238742519-238742541 GGCCATGCTGAAGTGAACCCAGG - Intergenic
1169180545 20:3562304-3562326 CCCCTTGCACAAGGGCACCCTGG - Exonic
1169999179 20:11596165-11596187 CCCCTTGCATAAGTGTGACCTGG - Intergenic
1170122091 20:12922746-12922768 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
1172090785 20:32430867-32430889 CTCCATGCAGAAATGTACTAAGG - Intronic
1175487807 20:59357816-59357838 GCCCAAGCAGGAGTGTCCCCTGG + Intergenic
1175794740 20:61764627-61764649 CCCCATGCATAAGTGGAGCTTGG - Intronic
1176723229 21:10410154-10410176 CCCCTTGCACAAGTGTGCCCTGG + Intergenic
1176796836 21:13376643-13376665 CCCCTTGCACAAGTGTGCCCTGG - Intergenic
1177281120 21:18984423-18984445 TCCCAACCAGAAGTGGACCCAGG + Intergenic
1177594073 21:23212857-23212879 CCCCTTGCAGCAGTGTGCCCTGG - Intergenic
1178154148 21:29832133-29832155 CCCCATGCATCAGTGTGGCCTGG - Intronic
1178429068 21:32503101-32503123 CTCCATCCAGCAGTGTAACCAGG + Intronic
1179536939 21:42058977-42058999 CCCCAGGCTGACGTGGACCCTGG + Intergenic
1180304386 22:11062891-11062913 CCCCTTGCACAAGTGTGCCCTGG + Intergenic
1180499365 22:15918671-15918693 CCCCCTGCACCAGTGTACCCTGG - Intergenic
1181482276 22:23207833-23207855 CTCCATGCAGAAGTCTTCTCTGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184692971 22:46125710-46125732 CCCCATGCAGAGCTGAGCCCTGG - Intergenic
1185357262 22:50381209-50381231 CCCCATGCTGAGGTGGAGCCTGG - Intronic
950788891 3:15456607-15456629 CCCCCTGCAGAAGTGTTTTCTGG - Intronic
950955445 3:17048005-17048027 CCCCATGCAGGAGTGTGTCGGGG - Intronic
952221328 3:31326985-31327007 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
952569853 3:34701498-34701520 CCTCTTGCAGAAGTGTGACCTGG - Intergenic
952807911 3:37374902-37374924 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
953871356 3:46630014-46630036 CCACATGGAGAAGTATCCCCAGG + Intergenic
954292041 3:49654907-49654929 CCCCATACCGAAGTGGGCCCCGG + Exonic
957047154 3:75384968-75384990 CTCCATCCAGCAGTGTAACCAGG - Intergenic
957412864 3:79862799-79862821 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
959507985 3:107176599-107176621 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
960542022 3:118871750-118871772 CCCCTTGCATTAGTGTGCCCTGG + Intergenic
961879223 3:130049064-130049086 CTCCATCCAGGAGTGTAACCAGG - Intergenic
964092341 3:152892105-152892127 CCCCTTGCACCAGTGTGCCCAGG - Intergenic
965298431 3:166978108-166978130 CCCCTTGCAGCAGTGTGCCTTGG + Intergenic
965782681 3:172304364-172304386 ACAAATGCAGAAGTATACCCAGG - Intronic
965891475 3:173519508-173519530 CCCCTTGCACAAGTGTGCCCTGG + Intronic
966500722 3:180635645-180635667 CCCCATGTATCAGTGTGCCCTGG - Intronic
969435666 4:7187874-7187896 CCTGAGGCAGAAGTGGACCCAGG + Intergenic
969823895 4:9741433-9741455 CTCCATCCAGCAGTGTAACCAGG + Intergenic
973131474 4:46653674-46653696 CACCTTGCACCAGTGTACCCTGG - Intergenic
974867426 4:67597642-67597664 CCCCTTGCATCAGTGTGCCCTGG + Intronic
975521995 4:75311272-75311294 TCCCTTGCACCAGTGTACCCTGG + Intergenic
977271032 4:94917436-94917458 CCTCTTGCAGCAGTGTGCCCTGG + Intronic
977874202 4:102129742-102129764 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
979969332 4:127114663-127114685 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
986014738 5:3747974-3747996 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
986601614 5:9478520-9478542 CCCCTTGCATCAGTGTGCCCTGG + Intronic
986758680 5:10860350-10860372 CCCCTTGCAGAAGTGTAAGCTGG + Intergenic
987870872 5:23615047-23615069 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
989586758 5:43079914-43079936 ACCCAGGCTGAAGTGCACCCAGG + Intronic
996217886 5:120891485-120891507 GCTCATGGTGAAGTGTACCCAGG + Intergenic
999209870 5:149878616-149878638 CCCCATGCGGGAGTGTAAACAGG - Intronic
999250549 5:150179894-150179916 CAGCATGCGGAATTGTACCCTGG + Intronic
999900280 5:156079699-156079721 CCTCTTGCAGAATTGTGCCCTGG - Intronic
1002697284 5:181099388-181099410 CCCCATGCAGATGAGTGCCCTGG - Intergenic
1002723204 5:181278277-181278299 ACCCTTGCACAAGTGTGCCCTGG + Intergenic
1002971526 6:2027110-2027132 CTCCATGAAGAAGAGGACCCTGG + Intronic
1005908123 6:30283635-30283657 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1009059005 6:58375029-58375051 CCCCTTGCACCAGTGTGCCCAGG - Intergenic
1010498558 6:76566728-76566750 CCCCTTGCAGCAGTGTGCCCTGG - Intergenic
1012597305 6:101055115-101055137 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1012617314 6:101293071-101293093 CCCCTTGCATTAGTGTGCCCTGG - Intergenic
1012883354 6:104816853-104816875 ACCCATGCATCAGTGTGCCCTGG + Intronic
1016242987 6:141953485-141953507 CCCCTTGCATCAGTGTCCCCTGG + Intergenic
1016513017 6:144864355-144864377 CCCCTTGCATCAGTGTGCCCTGG + Intergenic
1018510586 6:164520302-164520324 CCCCTTGCAGCATTGTGCCCTGG + Intergenic
1018768848 6:166955652-166955674 CTCCAGGCTGGAGTGTACCCAGG + Intronic
1019312017 7:367504-367526 CCCCCTGCAGAAGTGCCCTCTGG - Intergenic
1020314285 7:6893977-6893999 CTCCATCCAGCAGTGTAACCAGG - Intergenic
1022486867 7:30785846-30785868 TCCCATGCAGAAGTCAACACAGG - Exonic
1029459280 7:100686067-100686089 CCCCATGCAGAAGGGCCCCAAGG - Exonic
1029681728 7:102116143-102116165 CCCCATACAGAGGTGGAGCCTGG - Intronic
1031193697 7:118587160-118587182 CCCCTTGCATCAGTGTTCCCTGG + Intergenic
1031669757 7:124528510-124528532 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1031796060 7:126175667-126175689 CCCCTTGCACAAGTTTTCCCTGG + Intergenic
1034950716 7:155295643-155295665 CCCCATGAAGAAATGCAGCCTGG - Intergenic
1036275649 8:7349197-7349219 TCCCATGCAGAAGGGGAACCTGG - Intergenic
1036841029 8:12121914-12121936 TCCCATGCAGAAGGGGAACCTGG + Intergenic
1039158920 8:34595422-34595444 CCCCTTGCACCAGTGTGCCCAGG - Intergenic
1039168501 8:34714346-34714368 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1040028957 8:42807002-42807024 GCCCATGCAGAAGTCCACCAGGG - Intergenic
1043533577 8:81176148-81176170 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1048038941 8:130706641-130706663 CCCCTTGCATCAGTGTAGCCTGG - Intergenic
1048086528 8:131186687-131186709 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
1048554179 8:135458222-135458244 CCCCACCCAGAAGTTTCCCCTGG - Intronic
1049813459 8:144586737-144586759 CCAGAAGCAGAAGTGTCCCCAGG + Intronic
1051868997 9:21715026-21715048 CCCCTTGCAGAAGTGTGCCCTGG - Intergenic
1053885390 9:42641681-42641703 CCCCTTGCACAAGTGTGCCCTGG + Intergenic
1054224409 9:62449130-62449152 CCCCTTGCACAAGTGTGCCCTGG + Intergenic
1058067554 9:100566182-100566204 CTCAATGTAGTAGTGTACCCGGG + Intronic
1060513008 9:124248035-124248057 TCCCATACAGAACTGTAACCTGG + Intergenic
1060720714 9:125975056-125975078 TCCCCTGCAGAAGTGTAAACTGG - Intergenic
1061389499 9:130309734-130309756 CCCCCTGCAGGACTGGACCCAGG + Intronic
1203370323 Un_KI270442v1:297734-297756 CCCAAGGCATTAGTGTACCCTGG - Intergenic
1189431325 X:40950171-40950193 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1189532642 X:41902095-41902117 CTCCATGCTGCAGTGGACCCAGG - Intronic
1192034773 X:67550121-67550143 CCCCATTCGGAAGTATACACAGG + Intronic
1192937042 X:75871012-75871034 CCCCTTGCACAAGTGTGCCCTGG + Intergenic
1193026275 X:76849479-76849501 CCTCTTGCATCAGTGTACCCTGG - Intergenic
1193205156 X:78739503-78739525 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1193724745 X:85025720-85025742 CCCTTTGCAGCAGTGTGCCCTGG - Intronic
1193998787 X:88400668-88400690 CCCCTTGCAGCAGTGTGCCCTGG + Intergenic
1194119173 X:89938958-89938980 CCCCTTGCACTAGTGTGCCCTGG - Intergenic
1195160017 X:102162052-102162074 CCCCTTGCACCAGTGTGCCCAGG - Intergenic
1195907193 X:109855965-109855987 CCACATCTAGAAGTGTACCTGGG + Intergenic
1196223489 X:113139010-113139032 CCCCTTGCATCAGTGTGCCCTGG - Intergenic
1196829625 X:119765897-119765919 CCCCTTGCACCAGTGTGCCCAGG + Intergenic
1196970158 X:121099693-121099715 CCCCTTGCACCAGTGTGCCCTGG - Intergenic
1199091865 X:143702195-143702217 CCCCTTGCAGTAGTATGCCCTGG + Intergenic
1199384645 X:147209029-147209051 ACCCTTGCAGCAGTGTGCCCTGG + Intergenic
1199423692 X:147676566-147676588 CCCCTTGCACCAGTGTGCCCTGG + Intergenic
1200472047 Y:3596517-3596539 CCCCTTGCACTAGTGTGCCCTGG - Intergenic