ID: 1079356883

View in Genome Browser
Species Human (GRCh38)
Location 11:19737167-19737189
Sequence ACAGGGACTCCTGTGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079356875_1079356883 25 Left 1079356875 11:19737119-19737141 CCATAAGTGGACAGAAGTTTAGA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1079356883 11:19737167-19737189 ACAGGGACTCCTGTGGTTCTGGG 0: 1
1: 0
2: 3
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079356883 Original CRISPR ACAGGGACTCCTGTGGTTCT GGG Intronic
900326368 1:2110469-2110491 ACAGAGACTCCTCTGGTACCAGG + Intronic
900528497 1:3140981-3141003 ATGGGGACTCCTCTGGCTCTGGG - Intronic
901815529 1:11791360-11791382 AGTGGGACTCCAGTTGTTCTTGG - Intronic
905019553 1:34799215-34799237 ACTGGGTGTCCTGTGGCTCTGGG - Intronic
910163539 1:84298994-84299016 ACAGAGAGTCGTGTGGCTCTGGG + Intronic
911505973 1:98751864-98751886 AGTGGAACTCCTGTTGTTCTTGG + Intronic
912679005 1:111716567-111716589 AAGCGGCCTCCTGTGGTTCTGGG + Exonic
915803500 1:158819336-158819358 ACAGTGACTCCTGTGAATGTAGG - Intergenic
917600451 1:176568649-176568671 ACAGGAACTCCTAGAGTTCTTGG - Intronic
919070405 1:192748415-192748437 AGATGGACTTCTGTGGTTTTAGG + Intergenic
922182029 1:223243102-223243124 ACAGGGAGCCCTGTGGCTCCAGG + Intronic
922789873 1:228305706-228305728 ACAGGGTCTCATGTCCTTCTCGG + Intronic
924740713 1:246792914-246792936 CCAGGGGCTCCTGCGGTTCTGGG + Intergenic
1065093115 10:22253495-22253517 CCGGGGACCCCTGTGGGTCTCGG - Intergenic
1066651891 10:37664243-37664265 GGAGGGACTCCTGTAGTTCCAGG - Intergenic
1067035658 10:42914554-42914576 GGAGGGACTCCTGTAGTTCCAGG - Intergenic
1074755712 10:116622454-116622476 ACAGGCAGTCCTGTGTTTTTGGG - Intronic
1077538758 11:3136663-3136685 CCAGGGCCTCCTGTGGGCCTGGG - Intronic
1079356883 11:19737167-19737189 ACAGGGACTCCTGTGGTTCTGGG + Intronic
1081866554 11:46363534-46363556 ACAGGAGCTCCTGTGGTGCCCGG - Intronic
1082933670 11:58634637-58634659 ACAGAGTCTCCTCTGATTCTGGG + Intergenic
1083377068 11:62232652-62232674 CCAGGGACTCCAGTGGATCGGGG - Intergenic
1083489678 11:63007024-63007046 ACAGGGCCTCCTCAGGGTCTTGG - Intronic
1084082008 11:66833570-66833592 AGAGGGACTCCTCAGGATCTAGG + Intronic
1084435718 11:69138155-69138177 TCAGGGGCTCCTGAGGTTATGGG + Intergenic
1087062074 11:93988981-93989003 AAAGGGACTGCTGTTGTGCTGGG + Intergenic
1092094587 12:5831174-5831196 ACTGGGGCTCCTGGGGTGCTGGG - Intronic
1108390844 13:49946073-49946095 CCAGTGACTCCCCTGGTTCTCGG + Intergenic
1115364138 14:32537379-32537401 ACTGGGACTGTTGTGGTTATGGG + Intronic
1116065230 14:39973386-39973408 ACTGGGACTTCTGTGCTTCCTGG + Intergenic
1116966255 14:51018158-51018180 ACAGGGATTGAGGTGGTTCTTGG + Intronic
1118107485 14:62676430-62676452 ACAGAGACTCCTGTGACTGTCGG - Intergenic
1119782253 14:77284314-77284336 ACAGGGCCCCATGTGGTTCCTGG + Intronic
1121090422 14:91177783-91177805 AAATGGAATCCTGTGGATCTTGG - Intronic
1121850868 14:97219982-97220004 GCAGGGCCTCCTGTGATTCCAGG + Intergenic
1125589530 15:40845655-40845677 ACAGGGAGGCCTTTGGCTCTGGG + Intronic
1127711242 15:61600326-61600348 ACAGGGACTCTTGGGAATCTGGG + Intergenic
1128868152 15:71131597-71131619 ACATGTACTCCTGTGATTATTGG - Intronic
1133128356 16:3661501-3661523 GCTGGGCCTCCGGTGGTTCTTGG - Exonic
1134300704 16:12988117-12988139 ACTGAGACTCCTGTGTCTCTAGG + Intronic
1135427043 16:22347207-22347229 ACAGGGAGTCCTGTTCCTCTTGG + Exonic
1138271119 16:55696526-55696548 AAAGGGGTTCCTATGGTTCTTGG - Intronic
1139531759 16:67545945-67545967 ACAGGCCCTCCTGTGCTTCCTGG + Exonic
1139558874 16:67729294-67729316 ACTGGTACTGCTGTGGTGCTGGG + Exonic
1139602235 16:67993700-67993722 ACAGGGACACATGTGGCCCTGGG - Exonic
1141038756 16:80653929-80653951 ACAGTGACTCCTGGGGTTTGAGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142372404 16:89690454-89690476 ACGGGGACCCCTGTGGCTCAGGG + Intronic
1142770198 17:2091222-2091244 ACAGGGAATCCTCTGGAGCTGGG + Intronic
1142860189 17:2756236-2756258 CCAGGGGCTCCTGTGTTTCGGGG - Intergenic
1143525390 17:7468922-7468944 CCAGGGACTGATGAGGTTCTGGG + Intronic
1143916935 17:10301239-10301261 GCAAAGACTCCTGTGGTTCCAGG - Intronic
1144062553 17:11597082-11597104 CCAGGGACTGCTGAGTTTCTGGG - Intergenic
1144968058 17:19090097-19090119 ACAGAGACTCCTGTGGTTAGGGG - Intergenic
1144979859 17:19161966-19161988 ACAGAGACTCCTGTGGTTAGGGG + Intergenic
1144988363 17:19216266-19216288 ACAGAGACTCCTGTGGTTAGGGG - Intronic
1152244041 17:79176069-79176091 TCAGGGCCTACTGTGGTGCTTGG + Intronic
1152526123 17:80889197-80889219 ACAGGGAATCCTGGGGGTTTGGG + Intronic
1152789240 17:82269834-82269856 CCAGACACCCCTGTGGTTCTGGG + Intronic
1154201764 18:12305346-12305368 GCAGGGACTCCTGAGGTCCGGGG - Intergenic
1157131354 18:45010168-45010190 ACATGAACTGCTGTGGCTCTTGG + Intronic
1158452651 18:57580825-57580847 ACAGGGAATCCTGGGGCGCTGGG - Intronic
1158532616 18:58277139-58277161 ACGGGGAATCCTGTGTATCTTGG + Intronic
1158645371 18:59241164-59241186 ACACGATCTCCTGTGGTCCTGGG - Intergenic
1158998096 18:62944179-62944201 ATGGGGAATCCTGTGCTTCTTGG + Intronic
1160468468 18:79103987-79104009 AAAGGGACTCTTCCGGTTCTTGG - Intronic
1166400069 19:42472010-42472032 GCAGGGTCTCCTTTGTTTCTTGG - Intergenic
1167792998 19:51692327-51692349 GCAGGGACTCCTGGGTCTCTGGG + Intergenic
925366352 2:3314696-3314718 CCTGGGACTCCTCTGGTTCTAGG + Intronic
926060747 2:9803187-9803209 TCAGGGACACCTGGGCTTCTTGG + Intergenic
927995774 2:27484797-27484819 ACAGGGCCTCCTGTTGACCTTGG + Intronic
928000423 2:27518836-27518858 ACAGGTGCTCATGTGCTTCTTGG + Exonic
928244341 2:29614375-29614397 ACAGGGCCTACCATGGTTCTAGG - Intronic
929267274 2:39931836-39931858 ACAAAGACTCCTTTGCTTCTGGG + Intergenic
930046970 2:47181038-47181060 ACAAGGAATTCTGTGGTCCTGGG + Intergenic
932075218 2:68656261-68656283 ACAGGGAATTATGGGGTTCTGGG + Intergenic
932563101 2:72889268-72889290 ACAGGGAGTCTTGTGATACTGGG + Intronic
934604256 2:95682336-95682358 ACAGGCACCCCTGTGGCTCAGGG + Intergenic
934613634 2:95758178-95758200 CCAGGGAATCCTGTGGGTGTTGG - Intergenic
934647266 2:96066237-96066259 CCAGGGAATCCTGTGGGTGTTGG + Intergenic
934840638 2:97622057-97622079 CCAGGGAATCCTGTGGGTTTTGG + Intergenic
936339390 2:111617956-111617978 ACAGGAACTCCAGTGCTCCTGGG + Intergenic
936537652 2:113324561-113324583 ACAGGCACCCCTGTGGCTCAGGG + Intergenic
936563068 2:113558731-113558753 ACAGGTAATCATGTGGCTCTAGG - Intergenic
936901581 2:117487162-117487184 ACAGAGACTCCTCAGTTTCTTGG + Intergenic
937460419 2:122080530-122080552 ACTGGAACGCCTGTGGTCCTGGG + Intergenic
938456474 2:131468719-131468741 AAAGAGATTCCTGTGGTGCTAGG - Intronic
939264054 2:139849231-139849253 ACAGTGATTCCTGTTGTCCTGGG + Intergenic
941329056 2:164154770-164154792 CCAGGAACTCCTGAGTTTCTGGG + Intergenic
942327122 2:174785387-174785409 ACAGGGACTTCTGGGGTGCCTGG + Intergenic
943267657 2:185755839-185755861 ACAGTGACTGCTGTAATTCTTGG - Intronic
944558608 2:200912609-200912631 ACAGGGTCTCCTGTGTTGCCAGG + Intronic
944869967 2:203900202-203900224 ACAGGGTCTGCTTTGTTTCTGGG - Intergenic
945990068 2:216388629-216388651 ACAGGGAAGCCTGGGTTTCTGGG + Intergenic
1169138449 20:3212046-3212068 CCTGGGCCACCTGTGGTTCTAGG + Intronic
1169141979 20:3231574-3231596 GCAGGGCCTCCTCTGTTTCTAGG - Intronic
1169592902 20:7164447-7164469 AAGGGGGCTCCTGTGGTTTTGGG - Intergenic
1171367084 20:24632624-24632646 AAAGGGACCCCTATGGTCCTGGG - Intronic
1172481861 20:35276168-35276190 ACAGGGACTCCTGCTGCCCTGGG + Exonic
1175189105 20:57199249-57199271 ACAGGTACCCCTCGGGTTCTGGG - Intronic
1175745080 20:61450923-61450945 ACAGGGACTCCTCAGGACCTGGG - Intronic
1178620760 21:34172326-34172348 CCAGGCACTCCTGTGGTAGTAGG + Intergenic
1178942088 21:36914818-36914840 CCAGAGACTCCTGTGGGTGTCGG - Intronic
1179335417 21:40447096-40447118 ACAGTGACCCCTGTGCTGCTAGG - Intronic
1181013285 22:20054529-20054551 ACACGGGCTCCTGTGGTTGGGGG + Intronic
1182441654 22:30368114-30368136 AGAGGGACTCCAGTGGTTTCAGG + Intronic
1183238640 22:36639438-36639460 AGAGGGACTTATGTGGGTCTGGG + Intronic
951276643 3:20695339-20695361 ACATAGATTCCTGGGGTTCTTGG - Intergenic
955328323 3:58026567-58026589 ACAGGGAATTCTGTGGCTCCTGG + Intronic
961566114 3:127764228-127764250 CCACAGACTCCTGGGGTTCTAGG + Intronic
964764617 3:160167778-160167800 CCAGGGACTGGTATGGTTCTAGG - Intergenic
965958787 3:174404167-174404189 CCAGGAATTCCTGTGATTCTTGG - Intergenic
969409801 4:7020444-7020466 ACAGGGAGCCCTGTGGTTGGGGG + Intronic
969542663 4:7803452-7803474 ACTGGGTCCCCTGTGGTTTTGGG - Intronic
970531314 4:16988379-16988401 ACATGGGCTCCTTTGGTTCTTGG - Intergenic
976303466 4:83536560-83536582 ACAGGGACTGCTGTGGCGCTCGG + Exonic
978712338 4:111799658-111799680 ACAGGTACTACTGTGGGACTTGG - Intergenic
979162288 4:117478040-117478062 ACAGGGAATCCTGTTATTTTGGG + Intergenic
979617879 4:122765021-122765043 ACATTGACTCCTCTGGTTCCAGG + Intergenic
980806414 4:137820354-137820376 ACAGGCACTCCTGTAGGTCAAGG + Intergenic
982818938 4:159922345-159922367 ATAGGGAGTCCTGTTGCTCTGGG + Intergenic
984823940 4:183907116-183907138 AGAGGGCCTGCTGTGGATCTTGG - Intronic
985095959 4:186413687-186413709 ACAGGGACCCCTGCGGCACTTGG + Intergenic
986921659 5:12691251-12691273 ACAGTGAATCTTTTGGTTCTGGG + Intergenic
987101469 5:14594813-14594835 ACAGAGACTCCTGAGGTGCTGGG - Intronic
991669381 5:69032508-69032530 ACAGGGATTCTTGTGTTTTTAGG - Intergenic
993260390 5:85650496-85650518 AAAGGCACTCATGTGGTTGTAGG - Intergenic
994356031 5:98794689-98794711 ACAGGGAGAGCTGTGTTTCTGGG - Exonic
995027246 5:107438477-107438499 CCAGAGACTCCTTTGGTTTTGGG + Intronic
997209980 5:132071601-132071623 ACAGGGAGCCCTGGGGTTTTAGG - Intergenic
998533993 5:142912139-142912161 ACAGCAACTTCTGTGTTTCTGGG + Intronic
1004413702 6:15405175-15405197 ATAGGAATTCCTGTTGTTCTTGG - Intronic
1004984605 6:21067158-21067180 ACAGGGACCTGTGTGGTACTTGG - Intronic
1005520791 6:26598632-26598654 TCAGGGACTCCTGAGGGCCTGGG + Exonic
1007168676 6:39847135-39847157 ACAGGCCCTGCTGTGTTTCTAGG + Intronic
1007182058 6:39936125-39936147 ACTTGGACTCCTGTAGTGCTGGG + Intergenic
1007794679 6:44337982-44338004 AAAGGGACTTTTGTGTTTCTGGG + Intronic
1007829824 6:44629672-44629694 ACAGGGTCTGCTGGGGTGCTGGG + Intergenic
1007925689 6:45647666-45647688 CCAGGGCCTCCTGTGCTCCTTGG + Intronic
1008871675 6:56279434-56279456 CCTGGGACTCCTGTAGTTCCTGG + Intronic
1009041630 6:58186674-58186696 ATAGAGATTCCTGAGGTTCTTGG + Intergenic
1009217482 6:60940989-60941011 ATAGAGATTCCTGAGGTTCTTGG + Intergenic
1012004370 6:93694093-93694115 CCAGGGACTCCTGTGGTTATAGG + Intergenic
1014626117 6:123728126-123728148 AGAGGCAATCCTGTGATTCTGGG + Intergenic
1017734179 6:157346032-157346054 ACAGGGACCCCTGAGCCTCTTGG - Intergenic
1018540307 6:164872767-164872789 ACTGGTAGTCCTGTGGTCCTCGG - Intergenic
1020016332 7:4834196-4834218 ACAGGGGCTTCTGGGGCTCTTGG + Intronic
1023900802 7:44477034-44477056 ACAGGGACCTCGGTGCTTCTTGG - Intronic
1024270569 7:47638483-47638505 TCAGGGACTCCTAGGGTGCTTGG - Intergenic
1025092155 7:56073159-56073181 ACAGGGAATCCTGTGGGACATGG + Intronic
1026143962 7:67729548-67729570 ACACAGACTCCTGTGGCTGTCGG - Intergenic
1026145827 7:67745636-67745658 ACAGTGACTGCTGTGATACTGGG + Intergenic
1027194596 7:76021050-76021072 ACAGGGTCTTATGTGATTCTAGG - Intronic
1029510982 7:100994923-100994945 ACAGGGGCTGCTGTGGTGCCGGG - Exonic
1029511704 7:100999594-100999616 ACAGGGGCTGCTGTGGTGCCGGG - Exonic
1029512200 7:101002843-101002865 ACAGGGACTGCTGTGGTGCTGGG - Exonic
1033108125 7:138549393-138549415 GCAGGGATTCCTCTGCTTCTTGG - Intronic
1033449859 7:141452957-141452979 ACTGGAACACCTGTGGTTCATGG - Intronic
1037627571 8:20621352-20621374 TCAGGGCCTGCTGTGGTTATGGG + Intergenic
1043529081 8:81130005-81130027 ACAGGGTTTCCTTTGGTTCTAGG - Intergenic
1045483993 8:102616024-102616046 TCAGGGATTCCTGTGATTCTAGG + Intergenic
1048073131 8:131041458-131041480 ACAGAGACGCCTCTGGATCTAGG + Exonic
1049382781 8:142325678-142325700 GGAGGGACACCTGGGGTTCTGGG + Intronic
1049889664 9:56956-56978 ACAGGTAATCATGTGGCTCTAGG + Intergenic
1051262994 9:15283714-15283736 ACAGGGATTCCTGTGCATATCGG + Intronic
1053731150 9:41058231-41058253 ACAGGTAATCATGTGGCTCTAGG + Intergenic
1054697364 9:68373858-68373880 ACAGGTAATCATGTGGCTCTAGG - Intronic
1057216980 9:93234580-93234602 CCCTGGACTCCTGTGGTTCCAGG + Intronic
1057321702 9:94019252-94019274 ACATGGGCTACTGTGGTTATTGG + Intergenic
1059321964 9:113476875-113476897 ACAGGGGTTCCTGTGGCTTTCGG + Intronic
1060466585 9:123912512-123912534 ACAGGGTTTCCTGTGGTGTTTGG - Intronic
1060743236 9:126113278-126113300 ACAGGGGCTCCTGGGGCTCATGG + Intergenic
1060790328 9:126481602-126481624 ACAGGAACTCCTGAGGTTGGGGG + Intronic
1062005823 9:134237944-134237966 ACAAGGAGGCCTGCGGTTCTGGG + Intergenic
1186260660 X:7775468-7775490 ACAGGGAGTCCTGTGCACCTGGG - Intergenic
1187392632 X:18896032-18896054 ACAGGGGCCCCTGTGCTTCATGG - Intronic
1189699303 X:43700402-43700424 ACAGGGACTCCTGTGGATATGGG + Intronic
1191217737 X:57951210-57951232 ACATGGCCTCCTGTTATTCTGGG - Intergenic
1192338344 X:70240307-70240329 GCAGGCACTCCTGTGCTCCTGGG - Exonic
1195495092 X:105521846-105521868 ACAGGGTCTCTTATGTTTCTTGG - Intronic
1197744807 X:129924925-129924947 ACAGGGGCTCCTCTTCTTCTGGG - Exonic
1199449134 X:147959741-147959763 ACATGGGCTCCTGTTCTTCTGGG - Intergenic
1200050859 X:153430752-153430774 ACAGGGTCTCCTCTGGTTATGGG + Intergenic
1201978534 Y:19881083-19881105 GCAGGGACTACTGTGCTCCTAGG - Intergenic