ID: 1079357478

View in Genome Browser
Species Human (GRCh38)
Location 11:19742147-19742169
Sequence TGGAGTATAAGGGGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079357478_1079357492 30 Left 1079357478 11:19742147-19742169 CCTCCTGAGCCCCTTATACTCCA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1079357492 11:19742200-19742222 ACTCAGCAGTCATCGGGACTTGG 0: 1
1: 0
2: 2
3: 3
4: 68
1079357478_1079357488 7 Left 1079357478 11:19742147-19742169 CCTCCTGAGCCCCTTATACTCCA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1079357488 11:19742177-19742199 CAAACATTTTTGGAAGACCATGG 0: 1
1: 0
2: 6
3: 67
4: 361
1079357478_1079357484 -3 Left 1079357478 11:19742147-19742169 CCTCCTGAGCCCCTTATACTCCA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1079357484 11:19742167-19742189 CCAGCCCAACCAAACATTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 120
1079357478_1079357489 23 Left 1079357478 11:19742147-19742169 CCTCCTGAGCCCCTTATACTCCA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1079357489 11:19742193-19742215 ACCATGGACTCAGCAGTCATCGG 0: 1
1: 0
2: 1
3: 19
4: 149
1079357478_1079357491 24 Left 1079357478 11:19742147-19742169 CCTCCTGAGCCCCTTATACTCCA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1079357491 11:19742194-19742216 CCATGGACTCAGCAGTCATCGGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079357478 Original CRISPR TGGAGTATAAGGGGCTCAGG AGG (reversed) Intronic
904308314 1:29605383-29605405 TGGAAGAAAAGGGGCTCAAGGGG - Intergenic
904433518 1:30479703-30479725 TGGAGTATCAGGTGCGCTGGGGG - Intergenic
905408058 1:37750699-37750721 TGTAGTACCAGGTGCTCAGGAGG - Intronic
906979142 1:50609504-50609526 TGTAGTATCAGCTGCTCAGGAGG - Intronic
908619340 1:65959956-65959978 TGCAGTTTAGGAGGCTCAGGAGG - Intronic
909957336 1:81795945-81795967 TGCACTAAAAGGGGATCAGGAGG + Intronic
911074761 1:93862284-93862306 TGGAGGAGAAGGGGGTCAAGAGG + Intergenic
912385150 1:109267784-109267806 TGGAGCAAAAGGACCTCAGGAGG - Intronic
913129080 1:115822182-115822204 TGGATTAAAAGGGACTTAGGGGG + Intergenic
915046717 1:153023503-153023525 TGGATTGTATGGGCCTCAGGAGG + Intergenic
918107266 1:181425690-181425712 TGGGGTATGAGCGGCTGAGGTGG - Intronic
920821703 1:209387612-209387634 TGGGGTTAAAGGGGATCAGGAGG - Intergenic
924038300 1:239957860-239957882 TGGAGCAGGAGGGGCTCAGCAGG - Intergenic
1062822111 10:542185-542207 GGGAGCAGAAGGAGCTCAGGAGG - Intronic
1063978249 10:11433872-11433894 CGGAGTGGAAGGGGCTGAGGTGG + Intergenic
1065167634 10:22996630-22996652 TGGAGAATGAAGGGCTCAGTTGG - Intronic
1066117527 10:32253752-32253774 TGCAGTATTTGGGGCACAGGAGG + Intergenic
1069621253 10:69838599-69838621 TGGTGTTTCAGAGGCTCAGGAGG - Intronic
1070546166 10:77454550-77454572 TAGAGTGAAAGGGGGTCAGGTGG - Intronic
1071366995 10:84909550-84909572 TGGAGTATAGTGGAGTCAGGAGG - Intergenic
1072407548 10:95168971-95168993 TGGCGCATCAGGGGTTCAGGTGG - Intergenic
1072566319 10:96619552-96619574 AGGAGGAAATGGGGCTCAGGAGG - Intronic
1072660409 10:97360363-97360385 TGGAGTCTAAGGGGCCCTGGGGG - Intronic
1074843354 10:117375719-117375741 TGGAGGATAAGGCGGTCCGGCGG + Intergenic
1075314842 10:121444520-121444542 TTGAGTAGAAGGGACTCAGTTGG - Intergenic
1075448325 10:122529368-122529390 GGGAGTAGAAGGGGCACAAGGGG - Intergenic
1079007281 11:16800840-16800862 TGGAGCATCTGGGGCTGAGGGGG + Intronic
1079357478 11:19742147-19742169 TGGAGTATAAGGGGCTCAGGAGG - Intronic
1080788680 11:35499662-35499684 TGGAGTAAAGAGGGCTGAGGTGG - Intronic
1082018045 11:47507026-47507048 TTGAGTAAAAAGGGCGCAGGAGG - Intronic
1083212063 11:61194301-61194323 TGGGGGATGTGGGGCTCAGGTGG - Intergenic
1083974922 11:66110689-66110711 TGGAGTCTCAGGTACTCAGGAGG - Intronic
1089298083 11:117481568-117481590 GGGAGTAGGAGGGGCTGAGGGGG + Intronic
1092219637 12:6703990-6704012 TGGGGCTTAAGGGGCCCAGGAGG - Intergenic
1095508192 12:42920894-42920916 TGGAGTATAAGGCACACAGTTGG - Intergenic
1097233803 12:57526859-57526881 GGGGGTAGCAGGGGCTCAGGGGG - Exonic
1097878196 12:64662903-64662925 TGTGTTTTAAGGGGCTCAGGGGG + Intronic
1098918485 12:76281139-76281161 TGGATTTTCAAGGGCTCAGGGGG + Intergenic
1104345288 12:127991207-127991229 AGGAGTTTAAGGGGCAGAGGGGG + Intergenic
1105831089 13:24163278-24163300 TGTAGTCCAAGGTGCTCAGGAGG + Intronic
1110740502 13:78990572-78990594 TGCAGGGTGAGGGGCTCAGGAGG - Intergenic
1117914020 14:60658285-60658307 TGGAGTTTGAGGCGCTCTGGCGG - Intergenic
1122253013 14:100453634-100453656 GGGAGTACAATGGTCTCAGGAGG - Intronic
1122400307 14:101463113-101463135 TAAAGTATATGGGGCCCAGGAGG + Intergenic
1122537359 14:102474985-102475007 TTGAGGATGAGGGGCTGAGGAGG - Intronic
1122931013 14:104933143-104933165 TGGAGGAGGTGGGGCTCAGGGGG - Exonic
1126273543 15:46849105-46849127 TGGTGTACAAGGTGCTCATGGGG + Intergenic
1126673433 15:51136902-51136924 TAGAGGAGTAGGGGCTCAGGTGG + Intergenic
1130939007 15:88492340-88492362 TGGAGGATAAGGTGGTTAGGAGG - Intergenic
1131738089 15:95356218-95356240 TGGAGTATAAGGGCCAGAAGAGG - Intergenic
1131987117 15:98053609-98053631 TGGAGAATAATGGGTTAAGGAGG - Intergenic
1133568224 16:7015436-7015458 TGGAGTATAAGGCACTGAGCAGG + Intronic
1135153743 16:20033483-20033505 TGAAGAATATGGGGCTGAGGTGG + Intronic
1136073504 16:27803010-27803032 TGGAGTTTGAGGGGCTCGTGAGG - Intronic
1136154371 16:28373363-28373385 TGTAGTCTCAGCGGCTCAGGAGG - Intergenic
1136208719 16:28741899-28741921 TGTAGTCTCAGCGGCTCAGGAGG + Intergenic
1138413122 16:56855183-56855205 TTGTGTGTGAGGGGCTCAGGGGG + Intergenic
1139942090 16:70612699-70612721 TGGAGCCTTTGGGGCTCAGGAGG + Intronic
1140178022 16:72684412-72684434 TGGGGCAAAAGGGGCTGAGGTGG + Intergenic
1140357003 16:74315025-74315047 TGGAGCCAAAGGAGCTCAGGAGG - Intergenic
1145901501 17:28493340-28493362 TGGAGGAAAAGGGGCTCAATGGG + Intronic
1146860155 17:36290255-36290277 TGGATTAGAAGGTGCTCAGCTGG + Intronic
1147090481 17:38094346-38094368 TGGATTAGAAGGTGCTCAGCTGG + Intergenic
1147106732 17:38226180-38226202 TGGATTAGAAGGTGCTCAGCTGG - Intergenic
1147386228 17:40083977-40083999 TGGACTGTAAGGGGCCCAGGTGG + Exonic
1148074233 17:44926416-44926438 GGGAGTACAAGGGGCCCAGCTGG + Exonic
1148422791 17:47562357-47562379 TGGATTAGAAGGTGCTCAGCTGG + Intronic
1149449610 17:56739363-56739385 TGGAGAATCGGAGGCTCAGGAGG + Intergenic
1150283372 17:63942053-63942075 GGGAGCATGCGGGGCTCAGGGGG + Intronic
1151530563 17:74702086-74702108 GGGAGTAGAAGGGTCTCAGGTGG + Intronic
1158659888 18:59377212-59377234 TGGAGTATCAAGGGCTCTGATGG - Intergenic
1161425621 19:4201211-4201233 AGGAGTAGTTGGGGCTCAGGAGG + Intronic
1163801820 19:19370395-19370417 TGTAGTACCAGGTGCTCAGGAGG + Intergenic
1166797028 19:45432772-45432794 AGGAGTGTAAGGGGGCCAGGTGG + Intronic
1168307013 19:55441287-55441309 TGGAGTGTACGGGGCTAGGGTGG - Intronic
925026530 2:611812-611834 TGCAGGAGAGGGGGCTCAGGAGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928804209 2:35131458-35131480 TGGAGTGTCAGTTGCTCAGGAGG + Intergenic
930088424 2:47514730-47514752 TGGAGTCCAAGAGACTCAGGGGG - Intronic
931513752 2:63028522-63028544 TGTAGTATCAGGTACTCAGGAGG - Intronic
934081435 2:88471879-88471901 TGGAAGAGAAGGGGCTGAGGTGG - Intergenic
935724526 2:106011380-106011402 TGGAGGATAAAGGGCTTTGGGGG + Intergenic
935836083 2:107055406-107055428 TGTAGTATATGGGGCAGAGGTGG + Intergenic
936452294 2:112642806-112642828 TGGAGTAGAGGGAGCTCAAGTGG - Intergenic
937963152 2:127478828-127478850 TGAAGTATTTGGGGCTCAAGGGG + Intronic
938710902 2:133975602-133975624 TGGAAAATAAGGGGCTGGGGTGG - Intergenic
947383776 2:229570688-229570710 TGGAGTATGAGGGGCACGAGAGG + Intronic
948007784 2:234624527-234624549 TTGAGTCTAAGAGGATCAGGTGG - Intergenic
948174053 2:235929140-235929162 TGGCATCCAAGGGGCTCAGGTGG - Intronic
948734630 2:239993792-239993814 GGGAGGATAAGGGGGTCAGCAGG + Intronic
1169300828 20:4440717-4440739 AGGAGTAAAATGGGATCAGGAGG + Intergenic
1171796692 20:29572070-29572092 TGCAGTATGAGGGCCCCAGGAGG + Intergenic
1174299072 20:49568686-49568708 AGGAGTGTAAGGGGGTCAGGAGG + Intergenic
1175888958 20:62307652-62307674 TGGAGCAGAAGGGGCTGGGGTGG - Exonic
1181518606 22:23432673-23432695 TGGAGGCTAAGGGCCTCACGTGG - Intergenic
1181639081 22:24187462-24187484 TGGAGTATATGGGGCAGACGGGG + Intronic
1182682914 22:32096423-32096445 TGCAGTGTGAGGGGCTGAGGAGG - Intronic
1182795704 22:32990135-32990157 AGGAGGATAAGGGGATCACGGGG + Intronic
1184780415 22:46646289-46646311 GGGAGCATCAGGGGCTCAGGAGG - Intronic
1185034148 22:48462511-48462533 TGGAGGCTAAGAGGCTCAAGAGG - Intergenic
950965678 3:17144146-17144168 TGGAGTCCCAGGGGCTGAGGAGG - Intergenic
951218676 3:20047134-20047156 TGGAGTGCAGTGGGCTCAGGTGG + Intronic
953226209 3:41024042-41024064 TGGAGTTTAAGGGGCCAAGTGGG - Intergenic
956781253 3:72605156-72605178 GGGAGTGCATGGGGCTCAGGTGG - Intergenic
957198646 3:77103087-77103109 TGGAGCAGAAGGAGCACAGGGGG + Intronic
960111262 3:113847724-113847746 TGTAGTCCCAGGGGCTCAGGAGG + Intronic
961069852 3:123912749-123912771 TGGAGTATTTGGGGATCTGGTGG - Intronic
963438899 3:145311227-145311249 AGGAGAATAAGCGACTCAGGTGG + Intergenic
964098414 3:152960975-152960997 TGGAATATAAGGGCTTCAGATGG - Intergenic
964415796 3:156446205-156446227 TGGAGCTTAAGGATCTCAGGTGG + Intronic
964703596 3:159595202-159595224 TGGAGAAGCAGGGGCTCAGTAGG - Intronic
967235928 3:187383462-187383484 TGGAGAAGACGGGGCCCAGGTGG + Intergenic
968592243 4:1465015-1465037 TGGGGTGGAAGGGCCTCAGGTGG + Intergenic
969278746 4:6154890-6154912 TGGAGTGAGAGGGTCTCAGGGGG - Intronic
969692554 4:8711596-8711618 TGGATTACAAGGAGGTCAGGTGG - Intergenic
971593566 4:28498688-28498710 TGGAGAATAAGAGGCTGAGGTGG - Intergenic
972527616 4:39931209-39931231 TGTAGTATCAGCTGCTCAGGGGG - Intronic
975968838 4:80009517-80009539 TGGAGTATACGGTGCTAAGTAGG - Intronic
983042035 4:162940933-162940955 TGGAGTAAGAGGAGCTAAGGTGG - Intergenic
984445660 4:179832434-179832456 GGGAGTCTAAGGGGGCCAGGAGG - Intergenic
986040056 5:3985044-3985066 TGAAGGACAAGGGGCACAGGAGG + Intergenic
986357787 5:6945544-6945566 TGTAGGATAAGGGACTCAGAGGG + Intergenic
988565275 5:32315738-32315760 TGTAGTACAAGGTACTCAGGAGG + Intergenic
990504652 5:56432399-56432421 TGGAATAAAAGTGGCTCAAGAGG - Intergenic
991262852 5:64685640-64685662 TGGAGAGTAAGGGGCACAGTAGG - Intergenic
991395724 5:66203042-66203064 TGGAGTCCAGGTGGCTCAGGAGG + Intergenic
991475176 5:67011206-67011228 TGGGGTACCAGGGCCTCAGGAGG - Intronic
992077600 5:73205547-73205569 TGGAGTTTAACTGGCTGAGGTGG + Intergenic
992814949 5:80427672-80427694 TGTAGTATAAGTGTCTAAGGTGG + Intronic
993966746 5:94368565-94368587 TGGAGTAAAACAGGCTCTGGAGG + Intronic
997432667 5:133851555-133851577 TGGAGGAGAAGGGGCACAGAAGG - Intergenic
1003032582 6:2615359-2615381 TGGAGTAACTGGGGCCCAGGAGG + Intergenic
1003760820 6:9176950-9176972 TGTAGTTCAAGGGGCTCAGGAGG - Intergenic
1004516669 6:16327200-16327222 TGTAGTCTGAGGGGCTCGGGTGG + Exonic
1007037005 6:38684100-38684122 TGTAGTCCAAGGTGCTCAGGAGG + Intronic
1007853383 6:44827990-44828012 GGGACTATAAGGAGATCAGGTGG + Intronic
1013924241 6:115449539-115449561 TGGAGTATAAGAGACTCTGAAGG + Intergenic
1014025178 6:116638163-116638185 TGGAGAATAATGGGATCATGGGG - Intronic
1019135169 6:169903375-169903397 GGGAGTAGAAAGGGGTCAGGAGG - Intergenic
1019599954 7:1876271-1876293 TGGAGGCTAAGGGCCTCACGTGG + Intronic
1020013034 7:4816676-4816698 TGGGGTGCAGGGGGCTCAGGGGG + Intronic
1022029997 7:26483820-26483842 TGGAGAAAGAGGGGCTCAGAAGG + Intergenic
1023848580 7:44138196-44138218 CGGCGCATGAGGGGCTCAGGAGG + Intergenic
1024984382 7:55182658-55182680 TGGAGTAAAAGGGGCTGTGCAGG - Intronic
1029451110 7:100642165-100642187 TGGAGAAGGAGGGGCACAGGTGG + Intronic
1030046509 7:105501831-105501853 TGGAGTCTCAGGTACTCAGGAGG + Intronic
1033120647 7:138664463-138664485 TGGAGGATTAGGGGCGCTGGAGG - Intronic
1038010772 8:23474381-23474403 TGGAGCAAAAGGAGCTCAAGGGG + Intergenic
1038057814 8:23877572-23877594 TGGAGAATAAGGGACTGAAGGGG + Intergenic
1039484853 8:37902425-37902447 TGAAGTAGGAGGGGCTCAGCTGG + Intergenic
1040310723 8:46235452-46235474 TGGGGCATCAGGGACTCAGGGGG + Intergenic
1043116697 8:76264165-76264187 TGGAGACTGAGGGGTTCAGGTGG - Intergenic
1049012295 8:139895092-139895114 TGGAGTTAAAGTGGCTCCGGGGG - Intronic
1055490133 9:76796368-76796390 TGGGGCATGAGGGCCTCAGGAGG - Intronic
1056834726 9:89945186-89945208 TGGAGGCCAAGGGGCTCAGTTGG + Intergenic
1061433250 9:130544521-130544543 GGGAGTCCCAGGGGCTCAGGCGG - Intergenic
1061636098 9:131909421-131909443 TGGACTCTGAGGGGCTCAAGGGG + Intronic
1062005729 9:134237598-134237620 TGGAATTTAAGGGCCCCAGGAGG + Intergenic
1203345585 Un_KI270442v1:31802-31824 TGGAATACAATGGACTCAGGTGG + Intergenic
1186313305 X:8343052-8343074 GGGAGGATCATGGGCTCAGGAGG + Intergenic
1188291778 X:28398336-28398358 TGGAGTATATGGGGATCTGAAGG + Intergenic
1188757791 X:33986111-33986133 TGAAGTTTAAGGGGCCCAGAAGG - Intergenic
1191105463 X:56769419-56769441 TGGGGGAGAAGGGGCTCGGGCGG + Intergenic
1191106456 X:56774821-56774843 TGGGGGAGAAGGGGCTCGGGCGG + Intergenic
1191107449 X:56780223-56780245 TGGGGGAGAAGGGGCTCGGGCGG + Intergenic
1192185818 X:68946219-68946241 TGGAGGGAAAGAGGCTCAGGAGG - Intergenic
1193277405 X:79605147-79605169 TTGACTATAAGGGGCTGAGGTGG - Intergenic
1196909113 X:120468379-120468401 TGGAGACTAAGGGGTTCAGGGGG - Intronic
1201627889 Y:16035242-16035264 TGAAGGAGAGGGGGCTCAGGAGG - Intergenic
1201713390 Y:17016799-17016821 TGTAGTATCAGCTGCTCAGGAGG + Intergenic