ID: 1079357757

View in Genome Browser
Species Human (GRCh38)
Location 11:19743973-19743995
Sequence CTGTATCTGAGGCCAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079357757_1079357762 13 Left 1079357757 11:19743973-19743995 CCCTCCACTGGCCTCAGATACAG 0: 1
1: 0
2: 1
3: 19
4: 205
Right 1079357762 11:19744009-19744031 CACCTAATATGTGTTAGATAAGG 0: 1
1: 1
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079357757 Original CRISPR CTGTATCTGAGGCCAGTGGA GGG (reversed) Intronic
900457433 1:2784022-2784044 CTGCCTCTGAGGCCAGGCGAGGG + Intronic
900719753 1:4167819-4167841 CTGTATCTGACCCATGTGGATGG - Intergenic
901622957 1:10603898-10603920 CAGCATCTGAGGCCGGTGAAAGG + Intronic
902205944 1:14868265-14868287 CTGCGTCTGAGGCCACTGGAGGG + Intronic
902979638 1:20113666-20113688 CTTTATCTTAGGACAGTGGAGGG + Exonic
903782382 1:25829355-25829377 TGGTATCTGTAGCCAGTGGAGGG - Intronic
905824284 1:41017208-41017230 CGGAAGCTGAGGCCAGTGGGTGG - Intronic
907730563 1:57061598-57061620 CTGGAACTGAGACCAGTGGGTGG - Intronic
908626527 1:66050273-66050295 TTGTATCGGTGGCCAGTGGCAGG + Intronic
912623788 1:111191405-111191427 CTGTATCTCAAGCCAGAAGAGGG - Intronic
915631410 1:157155950-157155972 CTGGGTCTGAGGACAGAGGAAGG - Intergenic
917788305 1:178483266-178483288 CTGTAGCTGTGGCCAGTGTAGGG - Intergenic
918176405 1:182049957-182049979 CTTTATTTTAGGCCAGTTGATGG + Intergenic
919117713 1:193301487-193301509 CTGTGACTGAGGCCTGAGGAAGG + Intergenic
919822112 1:201480256-201480278 CTGTTTCTCTGGCCACTGGACGG + Intergenic
923301113 1:232641485-232641507 CTGTACCTGAGGCCAGTCTAAGG + Intergenic
924278738 1:242414515-242414537 CTGTATCTCAGATCAGTTGAGGG + Intronic
1063422666 10:5925752-5925774 CTGGAGCTGAGGGCAGTGCAGGG - Intronic
1063551101 10:7034276-7034298 CTGTATCTGAGGTATGTGGAAGG - Intergenic
1063551108 10:7034342-7034364 CTGTATCTGAGGTATGTGGAAGG - Intergenic
1067563405 10:47319921-47319943 GTGTCTCTGTGGCCAGTGGCTGG - Intergenic
1068670973 10:59723267-59723289 CTGTATCTTCTGCCATTGGAAGG + Intronic
1068684895 10:59860228-59860250 CTGTGTCTGAGTCCTGGGGATGG - Intronic
1069618772 10:69823535-69823557 CGGCTTCTGAGGCCAGAGGAGGG - Intronic
1071507236 10:86240229-86240251 CTGTACCTGAGGCCCATGGCTGG + Intronic
1075791977 10:125091345-125091367 CAGTATCTGAGGACTGGGGAGGG + Intronic
1077263157 11:1634035-1634057 GTGTATCTGAGGGCAGTCCAGGG + Intergenic
1079357757 11:19743973-19743995 CTGTATCTGAGGCCAGTGGAGGG - Intronic
1079990649 11:27242965-27242987 CTGAATTTGAGACCAGTGAAGGG + Intergenic
1080382763 11:31791030-31791052 TTCTAGCTGTGGCCAGTGGAAGG - Intronic
1081580645 11:44349320-44349342 CTGTTTCTGTGGCCTGTGCAGGG + Intergenic
1084149833 11:67282927-67282949 CTGTCTCAGAGGCCAGAGTAGGG - Intronic
1084792520 11:71483519-71483541 CTCTATGTGAGGACAGTGGAAGG + Intronic
1085427116 11:76414427-76414449 CTGTAGCTGAGGTTAGGGGATGG - Intronic
1085734712 11:79029442-79029464 TTGTGTCTGAGGGCAGTGTATGG + Intronic
1089791855 11:120951305-120951327 CTGCATCTGAGGCAGGTGGGAGG - Intronic
1090241315 11:125183958-125183980 ATGTATTTGAGGCAAATGGAGGG - Intronic
1092317433 12:7432703-7432725 CTGGGTTTGAGGCTAGTGGATGG - Exonic
1092565678 12:9662753-9662775 ATGTATCTGAGAGCACTGGAAGG - Intergenic
1092796645 12:12116869-12116891 CTGTACCTGAGTGGAGTGGAAGG - Exonic
1094091465 12:26654836-26654858 CTGTTTCTAAGGTCACTGGAGGG - Intronic
1097709089 12:62898914-62898936 CAGTGTCTGAACCCAGTGGACGG - Intronic
1097730541 12:63123549-63123571 CTGTGTCTGAGGTCAGGAGATGG - Intergenic
1098818936 12:75206811-75206833 TTGAATCTGAGGACAGAGGAAGG - Intronic
1099701648 12:86091346-86091368 TAATATCTGAGGCCAGTGGGGGG - Intronic
1099778958 12:87170285-87170307 CAGTATCTTGGGCCACTGGAAGG + Intergenic
1099871513 12:88355394-88355416 CATTATTTGAGGCCATTGGAAGG + Intergenic
1100537180 12:95522431-95522453 ATGTATCTGAGGAAACTGGAAGG - Intronic
1101535066 12:105609020-105609042 CTGCTTCTGAAGCCAGTAGATGG + Intergenic
1102589255 12:113945320-113945342 CAGTCTCTGAAGCCAGAGGAGGG - Intronic
1103937001 12:124482248-124482270 CTGCCTCTGGGGCCAGGGGAGGG - Intronic
1104451815 12:128875344-128875366 CTGGAACCGAGGCCATTGGAAGG - Intronic
1112324781 13:98436586-98436608 CTGTAACTCAGGGCAGGGGAAGG + Intronic
1116402370 14:44523821-44523843 GGGTAACTGAGGCAAGTGGATGG + Intergenic
1118829098 14:69412581-69412603 TTGTATCAGAGCCCAGTGGCCGG + Intronic
1118973961 14:70661577-70661599 CTTTATCTCATGCCAGTGGGTGG + Intronic
1119572908 14:75691944-75691966 CTCTATCTGGGGCCATTGGTTGG + Intronic
1121020535 14:90577624-90577646 ATGTCTCTGAGGCCATTGGCTGG - Intronic
1121584333 14:95052473-95052495 CTGAATCAGAAGCCAGTGGTGGG - Intergenic
1122882145 14:104694990-104695012 CTTTTTCTGAGGACAGAGGAGGG + Intronic
1127038976 15:54952396-54952418 TTATAACTGAGGCCATTGGAAGG + Intergenic
1127652091 15:61019492-61019514 CTCAAACTGAGGACAGTGGAAGG + Intronic
1128337213 15:66794762-66794784 CAGTATCGGATGCCAGTGGATGG - Intergenic
1128703563 15:69821866-69821888 CTGTGTCTGAGGACCGTGGCGGG - Intergenic
1129366188 15:75056593-75056615 CTGTCCTTGTGGCCAGTGGAGGG + Intronic
1131699335 15:94917222-94917244 CTGTATGTGTGGCCGGTGGCTGG + Intergenic
1131785711 15:95909108-95909130 CAGTATTTGGGGCCAGTGAATGG - Intergenic
1131824173 15:96304179-96304201 CTGAAGCTGAAGCCAGGGGAGGG + Intergenic
1133216732 16:4297165-4297187 CTGCATCTGGGGCCGGAGGAGGG - Intergenic
1137444944 16:48525960-48525982 CTTTTTCTGAGGTCAGGGGAGGG + Intergenic
1139621967 16:68152592-68152614 CTGCCTCTGAGGCCAGTTCAAGG - Intronic
1140691868 16:77492339-77492361 TTGTATCTCAGCCCAGTGGGTGG - Intergenic
1141573763 16:84951100-84951122 CTGTGTCAGAGGCCAGCGGGGGG + Intergenic
1141995647 16:87635033-87635055 CTGTCCCAGAGTCCAGTGGAGGG - Intronic
1142017921 16:87761247-87761269 CTGCCTCTGAGGCCGGTGGGTGG + Intronic
1142415575 16:89939275-89939297 GTGGGTCTGGGGCCAGTGGAAGG + Intergenic
1142973717 17:3630513-3630535 CTGAGTCTGACCCCAGTGGAGGG - Intronic
1147602205 17:41753774-41753796 CTGGAGCTCAGGGCAGTGGAGGG - Intergenic
1147659815 17:42111530-42111552 CTGAATCTGGGGCCAGGGGTAGG + Intronic
1148079692 17:44960807-44960829 CTGGATCTTATGTCAGTGGATGG + Intronic
1148505820 17:48126366-48126388 CTGAATCTGAGGCACCTGGAAGG - Intergenic
1149556069 17:57574397-57574419 CTGTAGCACAGGCCATTGGATGG + Intronic
1152032774 17:77854296-77854318 CTGCAGCAGAGGCCAGGGGAGGG - Intergenic
1152607315 17:81298726-81298748 CTGTCTCTGAGGCAAGTGACTGG - Intergenic
1152849948 17:82627605-82627627 CTGTGTGTGAGGCCAGTGAGTGG - Intronic
1153959631 18:10130044-10130066 CTGTACCAGAGGCCAGCGGAGGG - Intergenic
1154350641 18:13580421-13580443 CTGTCTCTGCAGCCAGAGGATGG + Intronic
1157204663 18:45687960-45687982 CTGTCCCTGAGGTCAGAGGAGGG + Intergenic
1157754896 18:50209108-50209130 CTGTATTTGAGTTGAGTGGAAGG - Intergenic
1158653378 18:59307538-59307560 CTCTTACTGAGGCCAGGGGAGGG - Intronic
1158825633 18:61215584-61215606 CTTTCTCTTAGGCCAGTGGCAGG - Intergenic
1160346311 18:78135187-78135209 GTGCATAAGAGGCCAGTGGAAGG - Intergenic
1162203100 19:9035521-9035543 CTGTGCCTGATGCCAGAGGATGG - Intergenic
1162308749 19:9892171-9892193 GTGTATCTGAGGCACGTGCATGG + Intronic
1165329478 19:35133672-35133694 CTGTGAGTGAGGCCAGGGGATGG - Exonic
1165913432 19:39243902-39243924 CTGGATCTGTGGGCAGAGGAGGG + Exonic
1165917523 19:39269721-39269743 CTGGATCTGTGGGCAGAGGAGGG - Exonic
1166276553 19:41758008-41758030 CTGCATCTGAGGCCAGTCATGGG + Intronic
1168279884 19:55299863-55299885 TGGTATCTGAGGCCTGTGGACGG - Intronic
929054291 2:37862773-37862795 CTGTAAGTGAGGCCACAGGAAGG + Intergenic
929098345 2:38285515-38285537 ATGTAGTTGAGGCCAGTGAAGGG - Intergenic
929552082 2:42900773-42900795 CTGTTGCTGGGGCCTGTGGATGG + Intergenic
931201324 2:60100202-60100224 CTGTGGCTGAGGCCAACGGATGG - Intergenic
931304907 2:61018408-61018430 CTAGATCTGAGGCCTATGGATGG + Intronic
932082391 2:68726804-68726826 CTCTGTGTGAGCCCAGTGGATGG - Intronic
932453723 2:71832612-71832634 CTGTATCTGAGGACAGTTCCAGG - Intergenic
933634636 2:84694092-84694114 CTGCATCTGAGGCCAGGGTTTGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934819501 2:97359993-97360015 CAGTAGCTGAGGCCAGGGGAGGG - Intergenic
935102104 2:100006786-100006808 GCGTATGTGAGGCCAATGGACGG - Exonic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937323742 2:120976575-120976597 CAGTCTCTCAGGCCAGGGGAAGG + Intronic
937380419 2:121371649-121371671 CGGTTTCTCAGGGCAGTGGAAGG - Intronic
937528111 2:122795789-122795811 CTGTATCTGACCCCATTTGATGG + Intergenic
937697848 2:124827589-124827611 CAGTATCTGAGGTTAGAGGAAGG + Intronic
938099066 2:128485924-128485946 CTCCCTCTGAGGCCAGTGAATGG + Intergenic
941079161 2:161040480-161040502 GTGTTTCTGAGGCCAGAGGATGG - Intergenic
941984290 2:171494645-171494667 CTCTAAGTGAGGCCAGTGGCTGG - Intergenic
942378409 2:175361092-175361114 CTGTAGATGAGGTCAATGGAAGG - Intergenic
944753445 2:202734749-202734771 CAGTATCTTAGGCCATTTGAGGG + Intronic
948550763 2:238771815-238771837 CTCTGTGTGAGGCCAGAGGAAGG - Intergenic
948600230 2:239103734-239103756 CTGTATGTGAGACCTGTGGTGGG + Intronic
948862597 2:240760176-240760198 CCTTAGCTGAGCCCAGTGGAAGG - Intronic
1170457271 20:16544822-16544844 CTGTATATGAGGACAGTGCTAGG - Intronic
1170817275 20:19724358-19724380 GTGTATCTGAGGCCACTTGAGGG - Intergenic
1172486937 20:35304064-35304086 CTGTATCTGCAACCAGGGGAGGG + Exonic
1173188531 20:40859219-40859241 CTGTGTCTGAGCCTACTGGAGGG - Intergenic
1173433182 20:43009623-43009645 CTGCAGCTGAGGGCAGTGGAGGG + Intronic
1173460346 20:43238327-43238349 CTTTGTCTAAGGCCAGAGGATGG - Intergenic
1174151187 20:48487685-48487707 CTGTACCTGAGTCCTGAGGAGGG + Intergenic
1177856609 21:26406940-26406962 CTGGCTCTGAGGACAGAGGAAGG - Intergenic
1177898413 21:26883065-26883087 CAGCAGCTGAGGCCAGAGGATGG + Intergenic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1181369540 22:22405156-22405178 CTGTAGCTGTGGCCAGGTGAGGG + Intergenic
1181541325 22:23574623-23574645 CTGTCTCTAAGGCCACTGCAGGG + Intronic
1181797058 22:25318699-25318721 CTGTCTCTAAGGCCACTGCAGGG - Intergenic
1182019254 22:27067132-27067154 CTGTAGCAGAGGCCAGGGAAAGG - Intergenic
1184730506 22:46368803-46368825 GTGTTGCTGAGGCCACTGGAGGG - Intronic
1185121662 22:48975062-48975084 CTGAATGTGTGGCCAGTGGTTGG + Intergenic
950715734 3:14846540-14846562 CAGTTTCTGAGGCCTGTGGCCGG - Intronic
950836038 3:15919918-15919940 GTGTCACTGAGGACAGTGGAGGG + Intergenic
953450308 3:42999961-42999983 CCGTATTAGAGGCAAGTGGAGGG - Intronic
955010172 3:55006302-55006324 CTCGCTCTGAGGCCAGGGGAAGG - Intronic
955903229 3:63779405-63779427 CTGTGTCTGAGGCCGGGGGAGGG - Intergenic
956717456 3:72090951-72090973 CAGTATCTGAGGTCAGGTGAAGG + Intergenic
959222012 3:103532069-103532091 CTGAACCTGAGCCCAGTTGATGG + Intergenic
959991970 3:112640009-112640031 CTGTATCTCAGCCAAGGGGAGGG + Intronic
960998863 3:123358904-123358926 CAGTGCCTGAGGCCAGTGGCTGG - Intronic
968454480 4:689934-689956 CTGTTGCTGAGGCCAGTATAGGG + Intergenic
970108137 4:12608276-12608298 CTGGATCTCAGGCAAGTTGAAGG - Intergenic
970191945 4:13525701-13525723 CTTCATAAGAGGCCAGTGGAAGG - Intergenic
970590380 4:17555015-17555037 CTGGATCTGAAGCGAGGGGAAGG - Intergenic
971213265 4:24640224-24640246 CTGTACCTGTTTCCAGTGGAGGG + Intergenic
977097675 4:92767122-92767144 AAGTATCTGAGAGCAGTGGAGGG - Intronic
979759628 4:124386090-124386112 ATGTAGCTGAAGTCAGTGGATGG + Intergenic
980410417 4:132410471-132410493 CTGTATCTGTGGCCAGTAGAGGG + Intergenic
981316139 4:143341534-143341556 CTGCTTCTGAGGCCAGAGCAAGG + Intronic
982397790 4:154930779-154930801 CTGTATCTGAAGCAGGTTGAAGG + Intergenic
983998118 4:174210485-174210507 CTGAAGCTCAGGGCAGTGGAGGG + Intergenic
985196546 4:187436355-187436377 CTGCTTCTGAGGCCTGTGAAAGG - Intergenic
986183903 5:5418784-5418806 CTTCACCTGAGGCCAGTGGGGGG - Intergenic
992177506 5:74164868-74164890 CTCAATCTCAGGCCAGAGGATGG + Intergenic
996507938 5:124288663-124288685 CTGTATATAAGGCCAGTTGAAGG - Intergenic
997471254 5:134118324-134118346 CTGGATCTAAGGCCTGTGGCAGG - Intronic
998266059 5:140668681-140668703 CTGTCTCTGGGACCAGCGGAAGG + Exonic
999308876 5:150538680-150538702 CTGGTGCTGAGGTCAGTGGATGG - Intronic
1000113696 5:158133893-158133915 CTGCACCTGGGGCTAGTGGATGG + Intergenic
1002181994 5:177435437-177435459 CTGTGAGGGAGGCCAGTGGAGGG + Intronic
1002299074 5:178247487-178247509 GTGAGTCTGAGGCCAGTAGAGGG + Intronic
1003173718 6:3739452-3739474 GTGTGGCTGAGGTCAGTGGAGGG - Intronic
1005016254 6:21377968-21377990 CTGTGTTTAAGGCCAGGGGAAGG + Intergenic
1006166779 6:32070011-32070033 CTGGATCTGAGCCGAGTGGCTGG + Intronic
1006767894 6:36524981-36525003 CTGTATCTGTGGGCACTGGGTGG + Intronic
1011834741 6:91417845-91417867 CTGGATGTGATGCCAGGGGATGG + Intergenic
1012018197 6:93880444-93880466 CTGCATCTGAGGGTGGTGGATGG + Intergenic
1016157675 6:140832758-140832780 CAGTAATTGAGGCCACTGGAAGG - Intergenic
1018067681 6:160134963-160134985 CTGTATCAGCGTCCAGTGGTAGG + Intronic
1018588058 6:165384926-165384948 CTGTCTGTGTGGCCAGAGGATGG + Intronic
1019011718 6:168848399-168848421 CTGGGTGTGAGGCCAGAGGAGGG + Intergenic
1019156977 6:170045784-170045806 CTGTTCCTGAGCCCTGTGGATGG + Intergenic
1021075753 7:16302412-16302434 CTGTACCTGAGCTCACTGGATGG - Intronic
1022804113 7:33804661-33804683 TTTTATCTGAAGGCAGTGGAAGG - Intergenic
1023940273 7:44765034-44765056 CTGCATCTGTGGCCACTGGAGGG + Intronic
1024147383 7:46531377-46531399 CTGTTGCTGAGGCCTTTGGAGGG + Intergenic
1025231562 7:57206222-57206244 CTGTACCTGAGTCCTGAGGAGGG - Intergenic
1025873125 7:65453624-65453646 CTGTTTGTGTGGCCTGTGGAGGG + Intergenic
1027045198 7:74986582-74986604 CAGTATCTGAGCTCAGTGCATGG - Intronic
1027464859 7:78502934-78502956 CTGAATCTGAGGCCAGATTAAGG + Intronic
1027963255 7:84973707-84973729 CTACATGGGAGGCCAGTGGATGG - Intergenic
1029387614 7:100253927-100253949 CAGTATCTGAGCTCAGTGCATGG + Intronic
1029706289 7:102278073-102278095 CTGGAGCTGAGGCCAGGGGAGGG - Intronic
1031401284 7:121328825-121328847 CTGTCCCTGAGGCCAGTGCCCGG + Intronic
1031841315 7:126742743-126742765 CTTTATGGGAGTCCAGTGGAAGG - Intronic
1032425420 7:131818810-131818832 TTGTCCCTGAGCCCAGTGGATGG - Intergenic
1033119160 7:138651806-138651828 TTGTATCTGAGGGCATAGGAAGG - Intronic
1039453137 8:37691646-37691668 CTGTGTCTGAAGCCGGGGGATGG + Intergenic
1041249176 8:55918235-55918257 CTGTCTCAGAGGCCTGTGGGAGG - Intronic
1044538062 8:93380344-93380366 CTGTATCTTGTCCCAGTGGAAGG - Intergenic
1045018213 8:98017901-98017923 CAGTAGCTGACTCCAGTGGATGG + Intronic
1045065047 8:98437046-98437068 CTGTGTGTGAGGGGAGTGGAGGG - Intronic
1047510241 8:125510285-125510307 CTGCATCTGAGGTGGGTGGATGG + Intergenic
1048419504 8:134262907-134262929 TTGTATCTAATGCCAGTGAATGG + Intergenic
1048754904 8:137727724-137727746 CTGTCTCTTAGGCCTGTGGGCGG - Intergenic
1049311230 8:141934937-141934959 CTGGATCTGAAGCCAGAGGCTGG + Intergenic
1049569630 8:143363070-143363092 CTGTTTGTGGGGCCAGGGGAGGG - Intergenic
1051991829 9:23161403-23161425 CTGGATCTCAGGCTATTGGATGG - Intergenic
1056554520 9:87677608-87677630 CTTCATCTGAGACCAGGGGAAGG - Intronic
1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG + Intronic
1058206506 9:102115377-102115399 CAGTCCCTGAGGCCAGTAGAAGG - Intergenic
1058899520 9:109430323-109430345 CTGTATATGAAGCCAGGGGTGGG - Intronic
1061473068 9:130842819-130842841 CTGGATCTGCGGCCACTGCAGGG + Intronic
1061661394 9:132132550-132132572 TTGTTTCTGAAGCCAATGGAGGG + Intergenic
1062259827 9:135655992-135656014 CTGAGTCTGAGGACAGAGGAGGG - Intergenic
1187630464 X:21164139-21164161 CTCTGTCTGAGGGCAGTAGATGG + Intergenic
1188495610 X:30780026-30780048 CAGTATCTGAGGGCAGTGGTTGG + Intergenic
1189911687 X:45816493-45816515 CTGTAACTGAGGCTGGTAGATGG + Intergenic
1194581343 X:95675874-95675896 ATGTATCTGTGGTCAGTTGATGG + Intergenic
1197828811 X:130619668-130619690 CTGTATCAGAAGACAGTAGAAGG + Intergenic
1198482197 X:137051700-137051722 CTGTATCTCAGGCTGGTTGAGGG - Intergenic
1199785832 X:151103948-151103970 CTCTTTCTGAGCTCAGTGGAGGG + Intergenic