ID: 1079357924

View in Genome Browser
Species Human (GRCh38)
Location 11:19745461-19745483
Sequence AGGTGTGTGGAGGGCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079357924_1079357931 12 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357924_1079357934 25 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357934 11:19745509-19745531 CTGCCCCTGGCTTTTGACACTGG 0: 1
1: 0
2: 0
3: 18
4: 187
1079357924_1079357938 30 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357938 11:19745514-19745536 CCTGGCTTTTGACACTGGAAAGG 0: 1
1: 2
2: 0
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079357924 Original CRISPR AGGTGTGTGGAGGGCTACTC TGG (reversed) Intronic
900238957 1:1605698-1605720 AGGTGTGGGGTGGGCTGGTCAGG + Intergenic
900239145 1:1606333-1606355 AGGTGTGGGGTGGGCTGGTCAGG + Intergenic
900239187 1:1606483-1606505 AGGTGTGGGGTGGGCTGGTCAGG + Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
902863070 1:19259718-19259740 AAGTGTGTGGAGGGCTAGGAAGG - Exonic
904746786 1:32716381-32716403 AGGTGTGTGGCGGGATGCCCAGG + Intergenic
906510090 1:46405798-46405820 AGGTGGGTGGAGGGCGCTTCTGG + Intronic
911745484 1:101437443-101437465 CGGTGTGAGGAGAGGTACTCAGG + Intergenic
912009679 1:104944006-104944028 AGGTGTGTGGAAGTACACTCTGG - Intergenic
912601007 1:110933513-110933535 GGTTGTGTGGAGGGCATCTCTGG + Intergenic
915527686 1:156486171-156486193 AGGTGTCTGCTGGGCCACTCAGG - Intronic
1063111182 10:3038705-3038727 AAGTGTGTGGAGGCACACTCTGG - Intergenic
1067799808 10:49351207-49351229 AGGTATGTGGAGGGCTGCAGGGG - Intergenic
1069789819 10:71012355-71012377 AGGTGTGTGCAGGGCTATCAGGG + Intergenic
1071567877 10:86680911-86680933 AAGTGGGTGGAGGGCTGCTTGGG + Intronic
1074164297 10:110861137-110861159 AGGTGTGTGTGGAGTTACTCAGG - Intergenic
1075542280 10:123324985-123325007 AGGAGTGAGGTGGGCTGCTCAGG - Intergenic
1076434503 10:130430828-130430850 AGCTCTGTGGAGGGCGCCTCAGG - Intergenic
1077015718 11:398318-398340 AGGTGTGTGCAGGGGTACGGAGG - Intronic
1078611955 11:12828450-12828472 GGGTGTGTTGAGGGCGACCCGGG + Intronic
1079357924 11:19745461-19745483 AGGTGTGTGGAGGGCTACTCTGG - Intronic
1080060818 11:27954874-27954896 AGGTCTGTGGAAGGCTTCACTGG + Intergenic
1080259142 11:30326810-30326832 AGGTGTGTGCAGTTTTACTCAGG + Intronic
1080396891 11:31898468-31898490 AGATGTGTGGTGGGCTTCTGAGG + Intronic
1082952774 11:58835149-58835171 AGCCATGTGGAGGGCTTCTCTGG - Intronic
1083900351 11:65640543-65640565 AGGTGTGTGGGTGGCGACTGGGG + Intronic
1085120781 11:73966100-73966122 AGGTGTGGGGAGGTCTGCTTAGG - Intronic
1096263071 12:50104872-50104894 AGGTCTCAGGAGGGCTGCTCTGG + Intronic
1098397003 12:70029693-70029715 AGGTTAGTAGAGGGATACTCAGG - Intergenic
1100090366 12:90961079-90961101 AGGTATCTGGAGGACTACTCTGG + Intergenic
1101751495 12:107586117-107586139 AGGTGTTCGGAGAGCTCCTCAGG + Intronic
1104000370 12:124856329-124856351 AGGTGTGTGCATGCCTACACAGG + Intronic
1106337321 13:28796009-28796031 AGGTGTGTGGCGAGGTACGCCGG + Intergenic
1113836249 13:113330354-113330376 AGGTGTGTGGAAGGAAACCCAGG + Intronic
1113836360 13:113330833-113330855 AGGTGTGTGGAAGGAAACCCAGG + Intronic
1115154242 14:30320260-30320282 AGGTTTGTGGAGGGCCCCTGGGG + Intergenic
1118110761 14:62716469-62716491 AGGTGTGTGGAGGCCAAGTGAGG - Intronic
1119426712 14:74540089-74540111 AGGTGTGAGGAGGGGTGCTGAGG - Intronic
1120847595 14:89139608-89139630 ACCTGTGTGGAGAGCTTCTCAGG + Intronic
1122065735 14:99173314-99173336 GGGTTTTTGGAGGGCTCCTCTGG - Exonic
1129299311 15:74616206-74616228 AGGGGTCTGAAGGGCTTCTCTGG - Intronic
1131264330 15:90906699-90906721 AGGTGTGTTCAGGGCCTCTCTGG + Intronic
1131653213 15:94424752-94424774 TGGTGTGTGAAGGGGTACTTTGG + Intronic
1132203298 15:99969757-99969779 TGGTGTGTGGAGCGCTGCTGGGG + Intergenic
1134094052 16:11407179-11407201 AGGTGTGTGGAGGTCAGCCCAGG - Exonic
1137542747 16:49376395-49376417 GGCTGTGTGGGGAGCTACTCAGG + Intronic
1140589756 16:76337756-76337778 AGGTCTATGGACGGCTGCTCTGG - Intronic
1142050349 16:87954002-87954024 AGGTGTGTGGATTCCTACGCCGG + Intronic
1143046869 17:4088421-4088443 ATGTGTCTGTAGGTCTACTCCGG + Intronic
1143953765 17:10653462-10653484 AGGGGTGGGGAGGGCAACTGAGG - Intronic
1147980504 17:44271138-44271160 GAGTGTGTGAAGGGCCACTCAGG - Intergenic
1151747302 17:76018421-76018443 AGGTCTGTGTAGGGATACTCAGG - Intronic
1152347061 17:79759673-79759695 AGGGGTGTGGAGTCCTCCTCAGG - Intergenic
1152794103 17:82298501-82298523 AGGACTGTGGAAGGCTGCTCTGG - Intergenic
1152927148 17:83092509-83092531 AGGTGGGTTGGGGGCGACTCTGG + Intronic
1152927168 17:83092566-83092588 AGGTGGGTTGGGGGCGACTCTGG + Intronic
1152927189 17:83092623-83092645 AGGTGGGTTGGGGGCGACTCTGG + Intronic
1153236094 18:2989778-2989800 AGGTGTGTGGCAGGCTCCTGTGG + Intronic
1155085497 18:22454017-22454039 AGGTGTGTGTAGGGATAGGCAGG + Intergenic
1155785344 18:29891593-29891615 AGGTGAGTGAAGAGCGACTCAGG - Intergenic
1158481092 18:57822466-57822488 AGGTTTGTGGAGGGCTGTTCTGG + Intergenic
1160003828 18:75053388-75053410 AGGTGTGTGGAGGGAAACCACGG + Intronic
1161065181 19:2233977-2233999 AGGTGTGTGCAGGGCTGCAGAGG - Exonic
1161482597 19:4518364-4518386 AGGTGGGTGTCGGGCTGCTCAGG - Intergenic
1162520689 19:11177861-11177883 GGGTGTGGGGAGGGCTCTTCTGG - Intronic
1163160618 19:15461829-15461851 AGGTGTGTGGAGTGGTATACAGG - Intronic
1163699133 19:18778439-18778461 AGGTGGGTGGCGGGCTGCTTTGG - Exonic
1165933781 19:39376858-39376880 AGGAGTCTGGAGGCCAACTCAGG - Intronic
930024222 2:47020581-47020603 AGGTGGCTGTAGGGCTGCTCTGG + Intronic
933271270 2:80235653-80235675 AGGTGGGGGCAGGGCTCCTCTGG - Intronic
934636400 2:95992768-95992790 AGGTGTGAGGAGGGGCAATCGGG + Intergenic
934797245 2:97112658-97112680 AGGTGTGAGGAGGGGCAATCGGG - Intergenic
934836163 2:97590781-97590803 AGGTGTGAGGAGGGGCAATCGGG + Intergenic
936388004 2:112047644-112047666 TGGGATGTGGAGGGCTACGCCGG - Intergenic
937084110 2:119159128-119159150 AGGTGTCAGCAGGGCTCCTCTGG + Intergenic
938115166 2:128597528-128597550 AGGGGGGTGGAGAGCTACTTGGG + Intergenic
938370962 2:130768172-130768194 TTGTGTCTGGAGGGCGACTCTGG + Intergenic
939722472 2:145671570-145671592 AGGTGGGTGGAGGCCCACACAGG + Intergenic
941077084 2:161017995-161018017 AGTTCTGTGGAGGGCCCCTCAGG - Intergenic
946374801 2:219301632-219301654 AGGAGTGTGGAGAGCTGCTCAGG + Exonic
947169984 2:227301007-227301029 AGGAGTCTGGAGGGCTAAGCAGG + Intronic
948868119 2:240785492-240785514 AGGGGTGTGGCGGGCTCCTTGGG - Intronic
1168953748 20:1819920-1819942 AGGGGTGCGGAGGCCCACTCTGG - Intergenic
1169119291 20:3085467-3085489 ATGAGTGTGGAGAGCTACTATGG + Intergenic
1175955363 20:62606276-62606298 AGGTGTGGGGAGGGCCCTTCTGG - Intergenic
1176458201 21:6931128-6931150 AGGTCTGTAGACGGCTGCTCTGG - Intergenic
1176836375 21:13796223-13796245 AGGTCTGTAGACGGCTGCTCTGG - Intergenic
1178996760 21:37409007-37409029 AGGTGTGTGGTGGGAAGCTCTGG + Intronic
1179285996 21:39977952-39977974 ACGTGAGTGGATGGCTATTCAGG - Intergenic
1180151525 21:45950639-45950661 AGGTGGGTGCATGGCTGCTCTGG - Intergenic
1180888969 22:19271384-19271406 AAGTGTGTGTGTGGCTACTCTGG + Intronic
1184747781 22:46466001-46466023 CGGTGTGGGGAGGGCGCCTCTGG + Intronic
1184817236 22:46881551-46881573 AGGCGTGTGGCAGGCAACTCAGG + Intronic
1184864898 22:47196945-47196967 ATGTGTGTGGATGCCTTCTCTGG + Intergenic
954136214 3:48583348-48583370 AGGTGTGAGGGGTGCTACTCTGG - Intronic
954219465 3:49144166-49144188 AGGTGCTTGGATGGCTACTATGG - Intergenic
956819610 3:72941901-72941923 AGGTGTGTTCATTGCTACTCAGG - Intronic
961571772 3:127804426-127804448 AGGAGTGGGGAGTCCTACTCAGG - Intronic
962251294 3:133837728-133837750 AGGGCTGTGGAGGGCAACTCAGG - Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
967275886 3:187774095-187774117 TGGGGTGTGGAGGGTGACTCAGG - Intergenic
969227992 4:5811670-5811692 TGGTGTGTGAAGGGCTGGTCTGG - Exonic
969885749 4:10213839-10213861 AGGTCTGTGAATGGCTACTCTGG - Intergenic
970445976 4:16123669-16123691 AGGTGGGTGAAGGGCTCCTCGGG - Intergenic
971735685 4:30447497-30447519 AGGGTTGTGGAGGGCTTTTCAGG + Intergenic
971884562 4:32426511-32426533 AGTGGTGTTGAGGGCTACTAAGG + Intergenic
974244680 4:59299593-59299615 AGGTGGGTGAAAGGCTATTCTGG + Intergenic
979831998 4:125315461-125315483 TGGTGAGGGGAGGGCGACTCGGG + Intergenic
982149509 4:152437248-152437270 ACTTCAGTGGAGGGCTACTCAGG + Intronic
984669420 4:182465385-182465407 TGCTGTGTGGAGGGAGACTCAGG + Intronic
985641560 5:1065716-1065738 GGGGATGTGGAGGGCTGCTCTGG + Intronic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
990355052 5:54958822-54958844 AGGTGTGTGCAGGTCTACCAGGG - Intergenic
993172424 5:84435927-84435949 AGGTCTATAGAGGGCTGCTCTGG + Intergenic
993834136 5:92795857-92795879 AGGTCTATGGATGGCCACTCTGG - Intergenic
995014713 5:107297142-107297164 ATGTGTGTGTATGGGTACTCAGG - Intergenic
997852737 5:137347092-137347114 GGGAGGGTGGAGGGCTACCCAGG - Intronic
999178212 5:149647100-149647122 AGGTGTCTTAAGGGCTACTTGGG + Intergenic
1000169227 5:158685384-158685406 AGGTGTTTTGAGGGCTAGTTTGG - Intergenic
1000691543 5:164327396-164327418 AGGTCTATGGATGGCTGCTCTGG - Intergenic
1001241930 5:170077852-170077874 AGGGGTGTGGGGGGCTCCTTGGG - Intronic
1001781019 5:174369220-174369242 AGGAATGTGGAAGGCTGCTCAGG - Intergenic
1005985256 6:30869378-30869400 AGGTCTGTAGATGGCTGCTCTGG + Intergenic
1006706399 6:36024716-36024738 AGGTATGAGGAGGGCGACCCAGG - Exonic
1007417941 6:41702968-41702990 GGATGTGTGGAGGGCTGGTCCGG + Intronic
1010165811 6:72914007-72914029 AGGTGTAGGGAGGGCACCTCTGG + Intronic
1014635666 6:123843506-123843528 AGGTGTGTGGAGGGCCAGGGTGG + Intronic
1016900666 6:149097533-149097555 AGGTGTGTGGGTGGGTTCTCAGG - Intergenic
1017082458 6:150682669-150682691 CCGTGTGTGAAGGGCTGCTCAGG - Intronic
1017769176 6:157631863-157631885 AGCTGCGTGGAGCGCTAATCAGG - Intronic
1019058821 6:169241605-169241627 AGGTGTCTGCCGGGCTCCTCAGG - Intronic
1019088948 6:169508912-169508934 TGCTGTGTGGAGGGCAGCTCAGG - Intronic
1019172524 6:170141542-170141564 AGGTGTATGTTGGGCTACACCGG + Intergenic
1023842913 7:44106886-44106908 AGGTTTGTGCCGGGCTCCTCTGG + Exonic
1024108201 7:46115423-46115445 AGTTGTGAGGAGGACTAGTCAGG + Intergenic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1027162305 7:75811737-75811759 AGCTGCTTGGCGGGCTACTCGGG - Exonic
1029813524 7:103072367-103072389 AGGTGAGTGAAGGACTCCTCAGG + Intronic
1031439441 7:121775205-121775227 AGGTATGTGCAGGACTACACAGG + Intergenic
1039456825 8:37712710-37712732 AGGTGGGTGGAGGGCAAGTGGGG + Intergenic
1041551580 8:59108276-59108298 GGGTGTGTTGAGGACAACTCTGG - Intronic
1042286356 8:67115981-67116003 AGGTGTCTGGAAAGCTATTCTGG - Exonic
1043538369 8:81231250-81231272 AGGGGTGTGGCGGGCTGCTCAGG - Intergenic
1045729264 8:105216434-105216456 AGGTCTGTTGACGGCAACTCTGG + Intronic
1047179800 8:122576251-122576273 AGTTGTGTGGAAAGCTACTTTGG + Intergenic
1048484855 8:134837645-134837667 AGGGTTGGGGGGGGCTACTCAGG + Intergenic
1049013462 8:139903584-139903606 CGGTCTGTGCAGGGCTGCTCTGG + Intronic
1049349965 8:142159198-142159220 AAGTGTGTGCTGGGCTGCTCAGG - Intergenic
1049350229 8:142160456-142160478 AAGTGTGTGCTGGGCTGCTCAGG + Intergenic
1049437505 8:142594572-142594594 TGGTGTGTGGAGGGCTACAGTGG + Intergenic
1058785530 9:108382956-108382978 ATGTGTTTTGAGGACTACTCTGG + Intergenic
1059094882 9:111401675-111401697 AGGTCTATGAATGGCTACTCTGG - Intronic
1059130455 9:111742469-111742491 ATGTGTGTTTAGGGGTACTCGGG + Intronic
1059246629 9:112855072-112855094 AGGTGTGTGGAGGGCTAGGGAGG - Intronic
1062155600 9:135046521-135046543 AGGTGCATGGTGGGCCACTCCGG + Intergenic
1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG + Intergenic
1187885651 X:23886537-23886559 AGGTGTGTGGCTGGCTCCTTAGG - Intronic
1189294599 X:39909669-39909691 GAGTGTGTGGAGGGATAATCGGG + Intergenic
1189827626 X:44935958-44935980 AGGTGGTTGCAGAGCTACTCTGG + Intronic
1190441337 X:50477323-50477345 AAGTGCCTGGAGGGCTACTTTGG + Intergenic
1190984015 X:55484403-55484425 AGGTGTGTGGAGGGAGGCCCAGG - Intergenic
1191056068 X:56242503-56242525 ATGAGTGGGGAGGGCTACACTGG + Intronic
1191971043 X:66816271-66816293 AAGTGCCTGGAGGGCTACTTTGG + Intergenic
1192408994 X:70915756-70915778 AGGTGGGTGGAGGGGAACTATGG + Intergenic
1195370353 X:104166834-104166856 AGGAGTGGGAAGGGCTCCTCGGG - Exonic
1198065386 X:133091367-133091389 AGGAGTGCGGAGTGCTGCTCAGG - Exonic
1198883575 X:141308087-141308109 GAGTGTGTGCAGGGCAACTCTGG + Intergenic
1199390513 X:147272392-147272414 ATGTGTGTGGTGTCCTACTCAGG - Intergenic
1199860814 X:151799110-151799132 ATGTGTCTAGAGGGCCACTCTGG + Intergenic