ID: 1079357924

View in Genome Browser
Species Human (GRCh38)
Location 11:19745461-19745483
Sequence AGGTGTGTGGAGGGCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079357924_1079357938 30 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357938 11:19745514-19745536 CCTGGCTTTTGACACTGGAAAGG 0: 1
1: 2
2: 0
3: 18
4: 161
1079357924_1079357931 12 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357924_1079357934 25 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357934 11:19745509-19745531 CTGCCCCTGGCTTTTGACACTGG 0: 1
1: 0
2: 0
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079357924 Original CRISPR AGGTGTGTGGAGGGCTACTC TGG (reversed) Intronic