ID: 1079357931

View in Genome Browser
Species Human (GRCh38)
Location 11:19745496-19745518
Sequence GTTGTCACCATTCCTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079357928_1079357931 -8 Left 1079357928 11:19745481-19745503 CCTGCTTCCCTACATGTTGTCAC 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357925_1079357931 3 Left 1079357925 11:19745470-19745492 CCCTCCACACACCTGCTTCCCTA 0: 1
1: 0
2: 3
3: 52
4: 508
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357924_1079357931 12 Left 1079357924 11:19745461-19745483 CCAGAGTAGCCCTCCACACACCT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357926_1079357931 2 Left 1079357926 11:19745471-19745493 CCTCCACACACCTGCTTCCCTAC 0: 1
1: 0
2: 4
3: 42
4: 459
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357927_1079357931 -1 Left 1079357927 11:19745474-19745496 CCACACACCTGCTTCCCTACATG 0: 1
1: 0
2: 2
3: 25
4: 294
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357921_1079357931 26 Left 1079357921 11:19745447-19745469 CCTCGATTTTGTCCCCAGAGTAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357923_1079357931 13 Left 1079357923 11:19745460-19745482 CCCAGAGTAGCCCTCCACACACC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357920_1079357931 27 Left 1079357920 11:19745446-19745468 CCCTCGATTTTGTCCCCAGAGTA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174
1079357922_1079357931 14 Left 1079357922 11:19745459-19745481 CCCCAGAGTAGCCCTCCACACAC 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1079357931 11:19745496-19745518 GTTGTCACCATTCCTGCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079357931 Original CRISPR GTTGTCACCATTCCTGCCCC TGG Intronic