ID: 1079361638

View in Genome Browser
Species Human (GRCh38)
Location 11:19775370-19775392
Sequence TAGGGCCCGAGGCAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079361632_1079361638 2 Left 1079361632 11:19775345-19775367 CCTCTTGTAGTCATTCAGTCTAA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1079361638 11:19775370-19775392 TAGGGCCCGAGGCAGGATGTGGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079361638 Original CRISPR TAGGGCCCGAGGCAGGATGT GGG Intronic
900092606 1:926941-926963 TTGGGCCTGAGGTAGGATGGGGG + Intronic
900586928 1:3437113-3437135 CAGGGCCCCAGGCAGGGTGCAGG - Exonic
902990010 1:20180753-20180775 GAGGGCCCGAGGCTTGATGAGGG + Intergenic
904893113 1:33794131-33794153 CAGGGTCCCTGGCAGGATGTGGG - Intronic
905218900 1:36430441-36430463 GAGGGCCTGAGCCAGGATGGTGG + Intronic
906712414 1:47940749-47940771 CAGGGACAGAGGCAGGATGCAGG + Intronic
907038135 1:51234930-51234952 TGGGGTCCGTGGCAGGGTGTGGG + Intergenic
912321716 1:108719975-108719997 TATGGGCCAAGGCAGAATGTAGG + Intronic
912853739 1:113148983-113149005 TAGGCCCTGAGGCTGGATTTTGG - Intergenic
913103927 1:115594859-115594881 TGGGGCCCAGGGCAGGGTGTGGG - Intergenic
913468229 1:119164778-119164800 CAGGGGCCGAGGCAGGAGGATGG + Intergenic
913957928 1:143320706-143320728 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
914052237 1:144146064-144146086 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
914126960 1:144820477-144820499 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
915252841 1:154602783-154602805 CAGGCCCCTAGGCAGGATTTAGG - Intronic
919779208 1:201211786-201211808 TAGGGAGCGAGGCAGGTTCTAGG + Exonic
919830911 1:201539464-201539486 TGGTGCCCGAGGGAGGCTGTGGG + Intergenic
919956979 1:202427319-202427341 TAGGGCCAGAGGCAGGGTGGTGG - Intronic
920791880 1:209100778-209100800 GGGGGCCTGAGGCAGCATGTTGG + Intergenic
924739789 1:246788304-246788326 TAGGGTCCGAGCCAGGGTCTGGG + Intergenic
1063161299 10:3420814-3420836 CAGAGCCAGAGGTAGGATGTAGG + Intergenic
1066178448 10:32936074-32936096 TGGGGCCTTATGCAGGATGTTGG - Intronic
1067060635 10:43076490-43076512 TGGGGCCGGAGGCAGGAGGCGGG - Intergenic
1067689217 10:48490643-48490665 AGGTGCCCAAGGCAGGATGTTGG + Intronic
1067794821 10:49313320-49313342 GAGGCCCTGAGGCAGGAAGTAGG + Intronic
1076514478 10:131036141-131036163 CAGGGCCTGAGGCAGGCTGGAGG + Intergenic
1077117426 11:891455-891477 TCTGGCCCTAGGCAGGAAGTGGG - Intronic
1077405127 11:2379288-2379310 CAGGGGCCGAGGGAGGGTGTAGG + Intronic
1077405150 11:2379353-2379375 TAGGGGCTGAGGGAGGGTGTAGG + Intronic
1077747331 11:4921273-4921295 GAGGCCCCAAGGCAGGATTTGGG - Intronic
1078525504 11:12097964-12097986 TTGGGGCCGAGGCAGGAGGATGG - Intronic
1079361638 11:19775370-19775392 TAGGGCCCGAGGCAGGATGTGGG + Intronic
1080220373 11:29895971-29895993 TAGAGCTTGAGGCAGGATGCTGG + Intergenic
1080763217 11:35272558-35272580 TGGGGCCCAAGGCAGGACATGGG + Intronic
1084653611 11:70502756-70502778 TAGGGCCCCAGGCTGGAGCTGGG + Intronic
1086258552 11:84909889-84909911 AATGGCCAGAGGCAGGATGCAGG - Intronic
1087094745 11:94307757-94307779 GAGGGCCTGAGGAAGGAGGTAGG - Intergenic
1089299662 11:117490919-117490941 TGGGGCTGGAGGCAGGATCTGGG + Intronic
1091220354 11:133926891-133926913 GAGGGCCCGGGGTGGGATGTTGG - Intronic
1091300064 11:134502030-134502052 TGGGGCCAGAGGCAGGAGGTGGG + Intergenic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1092209604 12:6637847-6637869 TGGGGCCCTAGGGATGATGTGGG - Intergenic
1095234080 12:39776410-39776432 TAGGGCACTGGGCAGGCTGTTGG - Intronic
1095723154 12:45423317-45423339 TAGGGCACTGGGCAGCATGTTGG + Intronic
1096570774 12:52521855-52521877 TGTGGCCCGAGGCTGGAGGTAGG + Intergenic
1097009139 12:55940204-55940226 CAGGGCCAGGGCCAGGATGTAGG - Intronic
1098203192 12:68078968-68078990 TATGGCCTGAGGCAGAATGAGGG + Intergenic
1100807937 12:98307351-98307373 TTGGGTCTGAGGCAGAATGTGGG - Intergenic
1101588597 12:106107071-106107093 TTGGGCAAGAGGAAGGATGTAGG - Intronic
1110423071 13:75335227-75335249 GATGGCCCGATGCAGGGTGTGGG - Intronic
1112799975 13:103099885-103099907 CAGGGCCAAAGGCAGGGTGTTGG + Intergenic
1114654789 14:24309737-24309759 CAGGGCCTGAGGCAAGAGGTGGG + Intronic
1116090544 14:40299295-40299317 TAGAGCACCAGGCAGGATCTTGG + Intergenic
1118276893 14:64393557-64393579 TAGGACCCCAGCCAGGCTGTTGG + Intronic
1118410325 14:65470794-65470816 AGGGGCCTGAGGCAGGAAGTGGG - Intronic
1119805007 14:77476808-77476830 TAGAGGCCAAGGCAGGAGGTAGG + Intronic
1120039290 14:79734295-79734317 TAGGGACCAAGACAGGATGTAGG + Intronic
1121145652 14:91579782-91579804 TAGGCCCCAAGACAGCATGTAGG - Intergenic
1121718109 14:96090529-96090551 CAGGGACCCAGGCAGGATGATGG + Exonic
1122826027 14:104371045-104371067 TGGGGACCGAGCCAGGATGGAGG + Intergenic
1202930454 14_KI270725v1_random:29368-29390 TAGGGCCAGAGCCAGGGTGTGGG - Intergenic
1123421896 15:20142042-20142064 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1123443186 15:20304593-20304615 TAGGGCCCGAGCCAGGGTCTGGG - Intergenic
1123531124 15:21148582-21148604 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1124613273 15:31223655-31223677 TTGGGCCCAAGGCAGGAGGAAGG - Intergenic
1125733601 15:41908426-41908448 TACAGCCCGAGGCAGGAGGAGGG - Intronic
1125887265 15:43238206-43238228 GAGGGCCAGAGGCAGGGTGAGGG - Intronic
1125896787 15:43309195-43309217 AAGGCCCTGAGGCAGGAAGTGGG + Intergenic
1126567221 15:50113063-50113085 TAGGGCCAGAGGGAGGAAGGGGG - Intronic
1128568147 15:68714680-68714702 GAGGGCCCGGGGCAGCCTGTGGG + Intronic
1128639216 15:69323464-69323486 CTGGGCCAGAGGCAGGATGGGGG + Intronic
1129661884 15:77557368-77557390 GCAGGCCCGAGGCAGGATTTGGG + Intergenic
1129823466 15:78619885-78619907 AAGGGTCCCAGGCAGGAGGTCGG + Intronic
1131179607 15:90230870-90230892 TAGGCCCAGAGGCAGCAGGTCGG + Intronic
1131838792 15:96415528-96415550 TGGGGCCCAAGGCTGGAGGTGGG + Intergenic
1136718072 16:32301089-32301111 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1136773902 16:32861057-32861079 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1136836448 16:33507359-33507381 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1136896707 16:34000462-34000484 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1138226758 16:55302672-55302694 TAGGGCCTGGGGTAGGATTTGGG - Intergenic
1142121396 16:88388254-88388276 CAGAGCCAGAGGCAGGATGGGGG + Intergenic
1142239891 16:88940413-88940435 CAGGCCCCGAGCCAGGCTGTGGG - Intronic
1203008356 16_KI270728v1_random:216676-216698 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1203076322 16_KI270728v1_random:1123168-1123190 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1203146631 16_KI270728v1_random:1807660-1807682 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1142467890 17:146508-146530 TGAGGCTCGAGGCAGGAGGTGGG - Intergenic
1143697064 17:8629483-8629505 TAGGGCCTTAGGAAGGAGGTTGG - Intronic
1144573800 17:16416532-16416554 TAGGGCCTGAGGCAGCGTGGTGG + Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1151537499 17:74747236-74747258 TGGGGCCCAAGGCAGGTTGCAGG + Exonic
1151586781 17:75013613-75013635 TAGTGCCAGAGGTAGGAAGTAGG + Intronic
1152580723 17:81164604-81164626 TGGGCCCCGAGGCAGGGTATGGG + Intronic
1154210719 18:12376920-12376942 GTGGGCCCGAGGCAGGGTGGAGG + Intronic
1154402653 18:14056478-14056500 TAGGGTTCGAGGCAGAATGTTGG + Intergenic
1154415041 18:14171891-14171913 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1157759244 18:50247793-50247815 TAGGACTGGAGGCAGGAGGTGGG + Intronic
1161249757 19:3274144-3274166 TAGGCCCCAAGGGAGGATGGGGG + Intronic
1161618488 19:5285943-5285965 GAGGGCCCCAGGGAGGAGGTGGG + Intronic
1161733576 19:5977436-5977458 TAGGCCCCGCCGCAGGATCTGGG - Intronic
1162110561 19:8397608-8397630 CAGTGCCCGAGGCAGGAAGTTGG + Intronic
1163175098 19:15558927-15558949 GAGAGGCCGAGGCAGGAAGTCGG - Intergenic
1165438160 19:35808119-35808141 TAGGGGCCGAGGAAGCATGAAGG - Intronic
1166010977 19:39942683-39942705 TAGGACCCGAGACAGCATATTGG + Intergenic
1166996294 19:46721179-46721201 AAGGTCCTGAGGCAGGAGGTGGG + Intronic
1167456458 19:49598841-49598863 TAGGGAGAGAGGCAGGAGGTTGG + Intronic
1167765023 19:51476424-51476446 CAGGACCTGAGGCAGAATGTGGG + Intergenic
1168497998 19:56870122-56870144 GAGGGCCCGAGGCATCATGTTGG - Intergenic
1202691634 1_KI270712v1_random:98488-98510 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
924964391 2:61797-61819 TAGGGGCCGAGACAGGTAGTGGG + Intergenic
925063052 2:908165-908187 TAGGGCCCTAGAGAGGATGGGGG - Intergenic
925412335 2:3647123-3647145 TAGGGCCCCAGACAGGCTGCAGG + Intergenic
926200170 2:10789791-10789813 AAGGGCCCGGGACACGATGTCGG + Exonic
927880842 2:26688961-26688983 CAGGGCCCAAGGAAGCATGTGGG - Intergenic
927996687 2:27492086-27492108 GAGGGCCAGAGGCAAGATGTGGG + Exonic
929233550 2:39584412-39584434 TAGGAACTGAGGCAGGACGTGGG - Intergenic
929575146 2:43046739-43046761 GAGGGCCCCAGGCTGGGTGTGGG - Intergenic
930009443 2:46924729-46924751 CAGGGCCTGAGGCAGGAGGATGG - Intronic
933954754 2:87355462-87355484 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
934238950 2:90251688-90251710 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
934274244 2:91565022-91565044 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
939214627 2:139219957-139219979 TAAGGCAGGTGGCAGGATGTAGG + Intergenic
941134018 2:161690777-161690799 TGGGGCCTGTGGCAGGGTGTTGG + Intronic
947790989 2:232869258-232869280 AAAGGCCTGAGGCAGGATCTGGG + Intronic
948424053 2:237876745-237876767 TATGGCTCGAGGCAGGAGGAGGG + Intronic
948614443 2:239189723-239189745 TGGGGCCCCAGGCATGATGCAGG - Intronic
948886900 2:240889127-240889149 CAGGGCCTGGGGCAGGATGGAGG - Intronic
1175790738 20:61738487-61738509 TAGGGCCCAAGGCAGCAGGCTGG + Intronic
1175941887 20:62541186-62541208 TAGGGCCCTTGGGAGGAGGTGGG + Intergenic
1176592466 21:8657964-8657986 CAGGGCCAGAGCCAGGGTGTGGG - Intergenic
1176866171 21:14056289-14056311 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1178316504 21:31570799-31570821 AAGGGCCCAAGGCAGGGTGCAGG + Intergenic
1179730871 21:43366781-43366803 TTGGGCCCTCGGCAGGATGGTGG - Intergenic
1180275325 22:10635111-10635133 CAGGGCCAGAGCCAGGGTGTGGG - Intergenic
1180549828 22:16530139-16530161 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1181354860 22:22291726-22291748 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1181582056 22:23834024-23834046 TGGGAACAGAGGCAGGATGTGGG - Intronic
1181681663 22:24499693-24499715 TAGGGTGTGAGGCAGGCTGTGGG - Intronic
1182010870 22:26999667-26999689 TTGGGTCAGGGGCAGGATGTGGG - Intergenic
1183281872 22:36936566-36936588 TTGGCCCCCAGGCAGCATGTCGG + Exonic
1184315929 22:43689217-43689239 CAGGGCCGGAGGCAGGGGGTTGG + Intronic
1184960033 22:47922038-47922060 GAGGGCCTGAGCCAGGATGGTGG - Intergenic
1185255426 22:49828409-49828431 GGGGCCCCGAGGCAGGATGGGGG + Intergenic
1185280352 22:49967212-49967234 TAGGGCCCCAGGCAGGCGTTAGG - Intergenic
949731675 3:7121039-7121061 TAGGGCCAGAGGCACCATGATGG - Intronic
950264343 3:11563194-11563216 AAGGGCCAGAGGCTGGATGTGGG + Intronic
950524996 3:13518342-13518364 GAGGGCCCGAGGAAGGAAGCAGG + Intergenic
954440755 3:50520843-50520865 CAGGGCCTGGAGCAGGATGTAGG - Intergenic
954675054 3:52311098-52311120 TGGGGCCTGAGGGAGGATGACGG + Intergenic
956664950 3:71633263-71633285 TGAGGCCTGAGGCAGGAGGTGGG + Intergenic
959694221 3:109232138-109232160 GCGGGCCCGAGGCAGCATCTAGG - Intergenic
961071098 3:123927993-123928015 TAGGACCAGAGCCAGGATTTTGG - Intronic
962312315 3:134335347-134335369 TAGGGTCAGAGACAGGATTTTGG - Intergenic
962388478 3:134952408-134952430 TAGGGCTGGATGCAGGATATAGG - Intronic
962915794 3:139902342-139902364 TAGTGACTGAGGGAGGATGTAGG - Intergenic
965310075 3:167116382-167116404 GAGGGCCCGGGGCGGGAAGTGGG - Intergenic
966647173 3:182259673-182259695 TGGCGCCCGAGGAAGGATGCAGG + Intergenic
968616653 4:1580574-1580596 TGGGGCCCGAGGTAGGAGGCGGG - Intergenic
968662081 4:1802843-1802865 CCGGGCACGAGGCAGGATGTGGG - Intronic
969518474 4:7661907-7661929 TACGGCCCTGGGCAGGAAGTTGG - Intronic
971525597 4:27613817-27613839 TAGGGTGCCAGGCAGGATGTGGG - Intergenic
974439468 4:61898177-61898199 TAGGGCAGAAGGCAGGATGGAGG + Intronic
976832324 4:89329684-89329706 TAGGGCCTGAGGCATGGTCTGGG + Intergenic
985499415 5:232458-232480 GAGGGGCCGAGGCAGGAGGATGG - Intronic
986054259 5:4120106-4120128 TGGGGGCCAAGGCAGGATGATGG - Intergenic
993431697 5:87840913-87840935 CAGGCCCCCAGGCAGCATGTAGG + Intergenic
1003078010 6:2999670-2999692 TAGGGGCCGAGGCGAGGTGTGGG + Intronic
1003220344 6:4155590-4155612 TGGGGCACAAGGCAGGAAGTTGG + Intergenic
1006820076 6:36886038-36886060 TGGGGCCCGAGGCTGGGTGGGGG + Intronic
1009557344 6:65189971-65189993 TCGGGCCAGAGACAGCATGTAGG + Intronic
1014724115 6:124955315-124955337 TGGGCCCCAGGGCAGGATGTAGG - Intergenic
1019151668 6:170010702-170010724 CAGGGCCTGAGGGAGGAAGTGGG + Intergenic
1020111143 7:5448496-5448518 TAGGGCCCCAGGCACGAAGCAGG + Intronic
1024281743 7:47724436-47724458 AAGGGCCACTGGCAGGATGTGGG + Intronic
1024854688 7:53764383-53764405 TGGGGCCTGAGGGAGGATGTGGG - Intergenic
1032077870 7:128844634-128844656 TAGGGGAAGAGGCAGGTTGTGGG - Intronic
1034427439 7:151021456-151021478 TAGAGCCCGGGGCAGGGGGTGGG + Intronic
1035732770 8:1864562-1864584 AGGGACCCGAGGCAGGAGGTGGG - Intronic
1041943142 8:63410384-63410406 TAGGGCCCCAGGCTGCAGGTTGG + Intergenic
1042004867 8:64169234-64169256 AAGGGGCCGAGGCAGCATGGGGG - Intergenic
1045632397 8:104140708-104140730 TAGGTCCCAAGGCAGCAAGTGGG - Intronic
1048070578 8:131016740-131016762 TAGGGCCAGAGGCAGGTCTTTGG + Intronic
1049275604 8:141718671-141718693 CTAGGCCTGAGGCAGGATGTGGG - Intergenic
1052978957 9:34433392-34433414 AAGGGCCTGAAGCAGGTTGTTGG - Intronic
1053691857 9:40590662-40590684 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1054272946 9:63046829-63046851 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1054303114 9:63391628-63391650 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1054401893 9:64718138-64718160 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1054435499 9:65202453-65202475 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1054494894 9:65819234-65819256 TAGGGCCAGAGCCAGGGTCTGGG + Intergenic
1056565762 9:87771317-87771339 GAGGACCCGAGGCAGGAGTTGGG - Intergenic
1057080723 9:92172640-92172662 CAGGGCCTGAGGCTGGATGCGGG + Intergenic
1057251573 9:93507594-93507616 TGGGGCCAGATGCAGGAGGTGGG + Intronic
1057267929 9:93631090-93631112 TAGGGGCAGAGGGAGGATGCGGG + Intronic
1059314299 9:113410746-113410768 TAGGACCCGAGGCAGGCTCTGGG + Exonic
1203622520 Un_KI270749v1:136797-136819 TAGGGCCAGAGCCAGGGTGTGGG - Intergenic
1186538341 X:10373039-10373061 TATGGCAGGATGCAGGATGTGGG - Intergenic
1189232266 X:39461745-39461767 TGGGGCCTGAGGCAGCCTGTGGG - Intergenic
1189301991 X:39958728-39958750 TTGGGGCAGAGGCAGGCTGTGGG - Intergenic
1201190497 Y:11439228-11439250 TAGGGCCAGAGCCAGGGTCTGGG - Intergenic
1202576888 Y:26337220-26337242 TAGGGCCAGAGGCAGGGTGGTGG + Intergenic
1202583100 Y:26402653-26402675 TAGGGCCAGAGCCAGGGTGTGGG + Intergenic