ID: 1079364215

View in Genome Browser
Species Human (GRCh38)
Location 11:19794998-19795020
Sequence TACTCCATAGGGTACTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079364215_1079364219 5 Left 1079364215 11:19794998-19795020 CCTACTCAGTACCCTATGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1079364219 11:19795026-19795048 ACTCAGTGGCTTCCTTTCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 253
1079364215_1079364225 28 Left 1079364215 11:19794998-19795020 CCTACTCAGTACCCTATGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1079364225 11:19795049-19795071 TACAGGAGTGCAGGCAAACAAGG 0: 1
1: 0
2: 0
3: 11
4: 158
1079364215_1079364220 11 Left 1079364215 11:19794998-19795020 CCTACTCAGTACCCTATGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1079364220 11:19795032-19795054 TGGCTTCCTTTCCCAGGTACAGG 0: 1
1: 0
2: 3
3: 20
4: 193
1079364215_1079364222 19 Left 1079364215 11:19794998-19795020 CCTACTCAGTACCCTATGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1079364222 11:19795040-19795062 TTTCCCAGGTACAGGAGTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 191
1079364215_1079364218 -9 Left 1079364215 11:19794998-19795020 CCTACTCAGTACCCTATGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1079364218 11:19795012-19795034 TATGGAGTAAGCATACTCAGTGG 0: 1
1: 0
2: 1
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079364215 Original CRISPR TACTCCATAGGGTACTGAGT AGG (reversed) Intronic
901465729 1:9419856-9419878 AACTCCATTGGGAACTAAGTTGG + Intergenic
904655270 1:32040864-32040886 TACTTCATACTGTGCTGAGTTGG - Intronic
913020682 1:114786433-114786455 TACTCAATATCGTACTGAATGGG - Intergenic
914335441 1:146710814-146710836 TACCCCATAGGTAACTGAATTGG + Intergenic
917237482 1:172909871-172909893 TATTCCATACAGTACTGAGAGGG + Intergenic
918739592 1:188111333-188111355 TTCTCCACAGTGTACTGTGTTGG - Intergenic
920419463 1:205821549-205821571 TACTTCATAGGGTAATTATTAGG + Intergenic
1069063446 10:63917842-63917864 TACTCTATAGGGCATTCAGTAGG + Intergenic
1073080649 10:100858266-100858288 TCCTTCAGTGGGTACTGAGTTGG - Intergenic
1075722230 10:124593814-124593836 TACTCCATAAGGTACTGATATGG + Intronic
1075972867 10:126669961-126669983 TGCTCCAAAGACTACTGAGTTGG - Intronic
1079364215 11:19794998-19795020 TACTCCATAGGGTACTGAGTAGG - Intronic
1081991858 11:47342382-47342404 CGCTCCAGAGGGTACTGAGAGGG - Intronic
1083795975 11:65016932-65016954 CACTCCATCAGGTGCTGAGTGGG + Intronic
1091642449 12:2247627-2247649 TCGTCCATAGGGAACTGAGGAGG - Intronic
1093139600 12:15492965-15492987 TACTCTATTAGGTACTTAGTTGG - Intronic
1094246710 12:28305358-28305380 TACTCCTTATGGCACTGTGTTGG + Intronic
1095919419 12:47514326-47514348 TACTCCAGTGGGGACTGTGTGGG - Intergenic
1096591591 12:52663633-52663655 TACTCCATTGCATACAGAGTAGG + Intergenic
1100138914 12:91591733-91591755 AACTGCATAGGGTACTTAGCAGG + Intergenic
1108974936 13:56428952-56428974 TACTCTATCAGGTACTGAGTAGG - Intergenic
1109806141 13:67445766-67445788 TATTGCATAGTGAACTGAGTTGG + Intergenic
1116167696 14:41354530-41354552 AGCTCCATAGGATACTGAGCAGG + Intergenic
1121899658 14:97682403-97682425 TAGTCCACAGGGTACAAAGTGGG - Intergenic
1127522451 15:59756194-59756216 TATTCCATAAGATACCGAGTTGG + Intergenic
1129100468 15:73257681-73257703 AACTCTATAGGGTACTTAGAGGG + Intronic
1130601690 15:85279435-85279457 TACTCCATGGAGCACTCAGTAGG + Intergenic
1138824782 16:60305916-60305938 TAATATATAAGGTACTGAGTGGG - Intergenic
1139998183 16:71000414-71000436 TACCCCATAGGTAACTGAATTGG - Intronic
1143038051 17:4011599-4011621 TTCTCCAAAGGATATTGAGTTGG - Intronic
1144413554 17:15024099-15024121 TACTCCATAAGGTAATGTGCTGG + Intergenic
1145199246 17:20926516-20926538 CACTCCATAGCGTTCTAAGTAGG + Intergenic
1146032853 17:29381128-29381150 TACTCCAGGGGGTGTTGAGTGGG + Intergenic
1154939127 18:21093433-21093455 TATTTCATGGGGTACTGAGGAGG - Intronic
1156965063 18:43081409-43081431 TACTCTATAGTTTACTGAGATGG - Intronic
1157147685 18:45181291-45181313 TACCCCATAGAGTGTTGAGTGGG - Intergenic
925336718 2:3104016-3104038 TACTCCGATGGGTACTCAGTGGG - Intergenic
928464156 2:31504652-31504674 TACCCAATGGGGTAGTGAGTGGG - Intergenic
929623693 2:43384402-43384424 AACTCAAAAGGGTACTGAGTTGG - Intronic
933904244 2:86874029-86874051 TAATCCATAGGGTGATGTGTTGG - Intergenic
940580051 2:155567457-155567479 TACTCCATAGGGTAGTTAAAAGG - Intergenic
942239706 2:173949583-173949605 TACTCTATCGGGTACTGTTTAGG - Intronic
943535537 2:189144817-189144839 TTCTCCATTTGGTTCTGAGTGGG + Intronic
1169138926 20:3215474-3215496 TACTCCAGAGAGCACTGTGTGGG + Intronic
1174901392 20:54504877-54504899 TTCTCCAATGGGTACTGAGATGG - Intronic
1174959320 20:55137213-55137235 TACTCTATATGCTACTGACTTGG + Intergenic
1177929930 21:27268141-27268163 TCCTCCATTGGGTACACAGTTGG + Intergenic
1178129997 21:29561635-29561657 GACTCCAAAGGTTACGGAGTGGG - Exonic
1183415775 22:37681057-37681079 TCCTCCTTGGGGTACAGAGTAGG + Intergenic
950822987 3:15781913-15781935 TACTCAACTGAGTACTGAGTGGG + Intronic
962482815 3:135812218-135812240 GACTCCATATGGCACTGAGCAGG - Intergenic
964419910 3:156490842-156490864 CACTGTATTGGGTACTGAGTGGG - Intronic
964711515 3:159676474-159676496 TATTACATAGAATACTGAGTTGG + Intronic
967371252 3:188748953-188748975 TAGGACATGGGGTACTGAGTGGG - Intronic
970425897 4:15946050-15946072 AACTCCACTGGGTACTTAGTTGG - Intergenic
970428313 4:15965291-15965313 TACTCCAGGGGCTCCTGAGTTGG - Intronic
977299358 4:95250270-95250292 TACTCCAGAGGATGCTGAGGTGG + Intronic
977597799 4:98902636-98902658 TACTGCATATGGTACTGAAGGGG + Intronic
981029034 4:140105472-140105494 TATTCCATAAGGTACTAAGAAGG - Intronic
982737867 4:159024972-159024994 TACTTCATAGGGTATTTAATGGG - Intronic
983767816 4:171507866-171507888 TACTGCAGAGGGTACAGAGTTGG - Intergenic
986367317 5:7045402-7045424 TACTACATAGGGTTCTAGGTAGG + Intergenic
986830141 5:11568068-11568090 TAGTCCATGGGGCATTGAGTTGG - Intronic
989393254 5:40924523-40924545 TACTCCAGTGGGGACTGTGTGGG + Intronic
990282323 5:54264475-54264497 TACCTCATAGGGTTTTGAGTAGG - Intronic
991913687 5:71585865-71585887 TACTCCATTGGTTGCTTAGTGGG - Intergenic
1004549390 6:16632049-16632071 TACTTCATGGGGTAGTGAGGAGG + Intronic
1006591075 6:35158128-35158150 TACTCAAAAGGGTACTGCCTTGG - Intergenic
1023630595 7:42160110-42160132 TACTTCATAGGGTATTGTGAGGG + Intronic
1024107895 7:46111030-46111052 TACTTCACAGTGAACTGAGTGGG + Intergenic
1024183901 7:46928224-46928246 CACTTCATAGGGCAGTGAGTTGG - Intergenic
1024250097 7:47499753-47499775 TACTCCATACGGTACTGTCATGG + Intronic
1030769285 7:113454241-113454263 CATTCAATAGGGAACTGAGTAGG - Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033728103 7:144143127-144143149 TACTCCATAGAGTTTTCAGTGGG - Intergenic
1039234434 8:35486471-35486493 TACTCCATAGGACACTTAGGAGG + Intronic
1042043712 8:64623817-64623839 TACTCCATATGATACTGTGATGG + Intronic
1056617563 9:88181373-88181395 TCCTTCATAGGGAACTGAGGCGG + Intergenic
1060582398 9:124761448-124761470 TACTCCTTAGGGTAGTTACTAGG - Intronic
1186446626 X:9635404-9635426 TAATCCATATGCTTCTGAGTGGG + Intronic