ID: 1079368764

View in Genome Browser
Species Human (GRCh38)
Location 11:19832220-19832242
Sequence TGCAGAGGGCTGAATGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079368764_1079368767 18 Left 1079368764 11:19832220-19832242 CCTGTCTCATTCAGCCCTCTGCA 0: 1
1: 0
2: 2
3: 34
4: 362
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079368764 Original CRISPR TGCAGAGGGCTGAATGAGAC AGG (reversed) Intronic