ID: 1079368765

View in Genome Browser
Species Human (GRCh38)
Location 11:19832234-19832256
Sequence AAAGCTTCAAAACATGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 1, 2: 5, 3: 27, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079368765_1079368770 20 Left 1079368765 11:19832234-19832256 CCCTCTGCATGTTTTGAAGCTTT 0: 1
1: 1
2: 5
3: 27
4: 329
Right 1079368770 11:19832277-19832299 TTGACGGCAGTCCTCTCAATAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1079368765_1079368771 26 Left 1079368765 11:19832234-19832256 CCCTCTGCATGTTTTGAAGCTTT 0: 1
1: 1
2: 5
3: 27
4: 329
Right 1079368771 11:19832283-19832305 GCAGTCCTCTCAATAGGCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1079368765_1079368767 4 Left 1079368765 11:19832234-19832256 CCCTCTGCATGTTTTGAAGCTTT 0: 1
1: 1
2: 5
3: 27
4: 329
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079368765 Original CRISPR AAAGCTTCAAAACATGCAGA GGG (reversed) Intronic