ID: 1079368767

View in Genome Browser
Species Human (GRCh38)
Location 11:19832261-19832283
Sequence AGTTTTTCCCTGAATCTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079368763_1079368767 19 Left 1079368763 11:19832219-19832241 CCCTGTCTCATTCAGCCCTCTGC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272
1079368766_1079368767 3 Left 1079368766 11:19832235-19832257 CCTCTGCATGTTTTGAAGCTTTC 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272
1079368765_1079368767 4 Left 1079368765 11:19832234-19832256 CCCTCTGCATGTTTTGAAGCTTT 0: 1
1: 1
2: 5
3: 27
4: 329
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272
1079368762_1079368767 20 Left 1079368762 11:19832218-19832240 CCCCTGTCTCATTCAGCCCTCTG 0: 1
1: 0
2: 1
3: 30
4: 327
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272
1079368764_1079368767 18 Left 1079368764 11:19832220-19832242 CCTGTCTCATTCAGCCCTCTGCA 0: 1
1: 0
2: 2
3: 34
4: 362
Right 1079368767 11:19832261-19832283 AGTTTTTCCCTGAATCTTGACGG 0: 1
1: 0
2: 2
3: 20
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079368767 Original CRISPR AGTTTTTCCCTGAATCTTGA CGG Intronic