ID: 1079368770

View in Genome Browser
Species Human (GRCh38)
Location 11:19832277-19832299
Sequence TTGACGGCAGTCCTCTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079368765_1079368770 20 Left 1079368765 11:19832234-19832256 CCCTCTGCATGTTTTGAAGCTTT 0: 1
1: 1
2: 5
3: 27
4: 329
Right 1079368770 11:19832277-19832299 TTGACGGCAGTCCTCTCAATAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1079368766_1079368770 19 Left 1079368766 11:19832235-19832257 CCTCTGCATGTTTTGAAGCTTTC 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1079368770 11:19832277-19832299 TTGACGGCAGTCCTCTCAATAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079368770 Original CRISPR TTGACGGCAGTCCTCTCAAT AGG Intronic