ID: 1079368771

View in Genome Browser
Species Human (GRCh38)
Location 11:19832283-19832305
Sequence GCAGTCCTCTCAATAGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079368766_1079368771 25 Left 1079368766 11:19832235-19832257 CCTCTGCATGTTTTGAAGCTTTC 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1079368771 11:19832283-19832305 GCAGTCCTCTCAATAGGCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1079368768_1079368771 -8 Left 1079368768 11:19832268-19832290 CCCTGAATCTTGACGGCAGTCCT 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1079368771 11:19832283-19832305 GCAGTCCTCTCAATAGGCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1079368765_1079368771 26 Left 1079368765 11:19832234-19832256 CCCTCTGCATGTTTTGAAGCTTT 0: 1
1: 1
2: 5
3: 27
4: 329
Right 1079368771 11:19832283-19832305 GCAGTCCTCTCAATAGGCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1079368769_1079368771 -9 Left 1079368769 11:19832269-19832291 CCTGAATCTTGACGGCAGTCCTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1079368771 11:19832283-19832305 GCAGTCCTCTCAATAGGCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079368771 Original CRISPR GCAGTCCTCTCAATAGGCTA AGG Intronic