ID: 1079370008

View in Genome Browser
Species Human (GRCh38)
Location 11:19844101-19844123
Sequence GTCCCCAGGCTGACATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079370006_1079370008 -4 Left 1079370006 11:19844082-19844104 CCACTTCTTACATAGGAAAGTCC 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG 0: 1
1: 0
2: 0
3: 13
4: 179
1079370003_1079370008 7 Left 1079370003 11:19844071-19844093 CCAAAGACCAACCACTTCTTACA 0: 1
1: 0
2: 0
3: 24
4: 176
Right 1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG 0: 1
1: 0
2: 0
3: 13
4: 179
1079370005_1079370008 0 Left 1079370005 11:19844078-19844100 CCAACCACTTCTTACATAGGAAA 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG 0: 1
1: 0
2: 0
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079370008 Original CRISPR GTCCCCAGGCTGACATCTCA TGG Intronic
900200074 1:1400597-1400619 TTCCCCAGGCTGGTAGCTCAGGG + Exonic
900468460 1:2837706-2837728 GTCCACAGGGTGATTTCTCAAGG - Intergenic
900949699 1:5851505-5851527 GTCCCCAGGCTCCCATCTTCAGG - Intergenic
902330404 1:15728503-15728525 AGCCCCAGGCTCACGTCTCAGGG - Intronic
902786321 1:18734800-18734822 GGCCCCAGGCTGAGAGCTGAAGG - Intronic
902815261 1:18913056-18913078 GTCTCCAGGCTGCCATCCCAGGG + Intronic
905112729 1:35608790-35608812 GTCCCCAGCATGACAACTGAAGG - Intronic
907499509 1:54867919-54867941 GTCTGCAGGCTGATATGTCAGGG + Intronic
907976628 1:59437047-59437069 GTCTCCAGGATGACATCCTAGGG - Intronic
913966683 1:143382695-143382717 GTCTCCAGCATGACGTCTCAGGG + Intergenic
914061060 1:144208302-144208324 GTCTCCAGCATGACGTCTCAGGG + Intergenic
914118090 1:144758067-144758089 GTCTCCAGCATGACGTCTCAGGG - Intergenic
914751312 1:150537036-150537058 GTAGCCAGGCTCACATCTCAGGG - Intergenic
914796771 1:150926455-150926477 GACCCCAGACTCACAACTCAGGG - Exonic
915101726 1:153505910-153505932 GCCCCCAGGCTGACATCCTCTGG - Intergenic
922108180 1:222530635-222530657 GTCCCAAGGCAGCCACCTCATGG + Intronic
922586699 1:226738756-226738778 GTCCCCAGGCTGGGGTCTCGGGG - Intronic
923456857 1:234172160-234172182 GTCCCTAAGCTGAAATCTCAGGG + Intronic
1062763797 10:46542-46564 GTCCCCAGAGTCCCATCTCAGGG - Intergenic
1065786305 10:29218937-29218959 GAGCCCAGGCTGAAAACTCAGGG + Intergenic
1069826191 10:71256636-71256658 GTCCCCAGACTGGCTTCTCCAGG + Intronic
1070571225 10:77640289-77640311 GACCCCAGACTGGCATTTCAGGG - Intergenic
1074315989 10:112362174-112362196 GTCCCCAGGCTGTGAGCCCAGGG + Intergenic
1074867799 10:117555038-117555060 GTCCCCAGCCTCTCACCTCACGG - Intergenic
1075004532 10:118820496-118820518 GTGGCCAAGCTGGCATCTCATGG + Intergenic
1075045231 10:119141074-119141096 GTTCCCAGGCTGGCGTCTCTGGG - Exonic
1075396078 10:122128194-122128216 GTCCCCTGGCTTAGATCCCATGG + Intronic
1075648326 10:124110973-124110995 GTCCCCACACTGACATTTCTTGG - Intergenic
1076317307 10:129551532-129551554 ATCCCCAGTCTGACAACTCGAGG + Intronic
1079091961 11:17487078-17487100 GTCCCCAGGCTAAGGTCCCAAGG + Intergenic
1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG + Intronic
1079464439 11:20715203-20715225 GTCCCCAGGCTGGCATGCAATGG - Intronic
1080741249 11:35066343-35066365 CTCCCCAGTCTGACCTCACATGG + Intergenic
1084118616 11:67056276-67056298 GGCACCAGGGGGACATCTCATGG + Intergenic
1084257462 11:67952748-67952770 GCTCCCAGGCTGAGATCTCGCGG - Intergenic
1084546496 11:69817623-69817645 GTCCCCAGGACGCCCTCTCAGGG + Intronic
1086953464 11:92913586-92913608 TTGCCCAGGCTCACATCTCCTGG + Intergenic
1087171068 11:95050648-95050670 GAACCCAGGCTGACGTCTCCAGG - Intergenic
1089761445 11:120727219-120727241 TTCTCCAGACTGACCTCTCAGGG + Intronic
1091847086 12:3665631-3665653 GACCCTTGGCTGACATCTGAAGG - Intronic
1096637521 12:52970347-52970369 GACCCCAGCCAGACAACTCAAGG - Intergenic
1101356117 12:103978993-103979015 GTGCCCAGGATGACATCTCTGGG - Intronic
1102075867 12:110059747-110059769 GTCGCCAGGCTGAGAGCACATGG + Intronic
1102908703 12:116696557-116696579 GTGCCCAGGCTGATAACTCCTGG + Intergenic
1103614783 12:122145267-122145289 CTCCCCTGGCTGACAGCTCCGGG - Exonic
1104418298 12:128613970-128613992 GACCTCAGGCTGCCATCTCCTGG - Intronic
1104971805 12:132534153-132534175 GCCCCCATGCTGACCTCCCAGGG - Intronic
1108187441 13:47902105-47902127 CTCCCCAGCCTAAAATCTCAGGG + Intergenic
1112488699 13:99842767-99842789 GACCACAGGCTGACACCACATGG - Intronic
1112503233 13:99957719-99957741 GGCCCCAGGCCCGCATCTCAGGG + Intergenic
1113455801 13:110447999-110448021 CTCCCCAGACAGACATCTCAGGG - Intronic
1113617866 13:111693879-111693901 GACCCCAGGCTGACTGCTGACGG - Intergenic
1113623399 13:111779140-111779162 GACCCCAGGCTGACTGCTGACGG - Intergenic
1116143813 14:41037604-41037626 TTCCCCAGGCTGAGATGCCAAGG - Intergenic
1117301464 14:54433104-54433126 GTCCTCAGGCTGAAATCTTTAGG - Intronic
1118738121 14:68717008-68717030 GTCAATTGGCTGACATCTCATGG + Intronic
1120564166 14:86034119-86034141 GGCCCCATGATGACATCTCTGGG + Intergenic
1121937815 14:98036710-98036732 GTTCTAAGGATGACATCTCAAGG + Intergenic
1122789272 14:104177489-104177511 CTCCACTGGCTGACAGCTCATGG - Exonic
1122863752 14:104594362-104594384 GACCCCAGGCTGGCCTCTGAAGG - Intronic
1122871585 14:104641237-104641259 CTCCCCAGCCTGCCTTCTCAGGG - Intergenic
1122977648 14:105177511-105177533 GGCCTCAGGCTGACCCCTCAGGG + Intronic
1126315513 15:47365185-47365207 CTCGCCAGGCTGTCATCTTAAGG - Intronic
1127087517 15:55438309-55438331 GTCCCCAGGCTGGCGTGTGATGG - Intronic
1131067881 15:89445552-89445574 TTCCACAGGCTGACAAATCATGG - Intergenic
1131268332 15:90931967-90931989 AACCCTTGGCTGACATCTCAGGG - Intronic
1132089869 15:98939535-98939557 GTCCCAATGCTGATAGCTCATGG + Intronic
1132509512 16:331361-331383 TTCCCTGGGCTGACAGCTCATGG + Intronic
1132847921 16:2009284-2009306 GTCCCCAGGCTGTCCCCACAGGG + Intronic
1132986589 16:2770624-2770646 GTCCCCACGCTGGCCTCTCCGGG - Exonic
1133271757 16:4613946-4613968 GTCCCCAGGCACACCTCTGAAGG + Intronic
1136239464 16:28935374-28935396 GTCCCAATCCTGAGATCTCAAGG - Intronic
1136516558 16:30772081-30772103 TGCCCCAGGAGGACATCTCACGG + Exonic
1137892720 16:52179457-52179479 ATCCCAGGGCTGACATTTCAGGG - Intergenic
1140858083 16:78995346-78995368 GTCCACAGGCACACTTCTCAGGG - Intronic
1141961240 16:87410909-87410931 GTCCCAACTCTGACAACTCATGG - Intronic
1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG + Intronic
1145998526 17:29117990-29118012 GTCCCCTGGGTGACCTCACAGGG - Intronic
1147389011 17:40098099-40098121 GTTACCAGGCTGAGATCTGAAGG - Intronic
1147553944 17:41464411-41464433 GTCCCCAAGCTGGCATCGAAGGG + Exonic
1149478392 17:56982502-56982524 CTCCCCAGGCTGACATACAAGGG - Intronic
1150364924 17:64573713-64573735 CTCCCCAAGCTGAGAACTCAGGG + Intronic
1151259309 17:72904297-72904319 GTCCCCAGGCTTCCAACTCTGGG - Intronic
1152457788 17:80426035-80426057 GTCCCCAGACTGGCGTCTCTGGG - Intronic
1152956707 18:46875-46897 GTCCCCAGAGTCCCATCTCAGGG - Intergenic
1154006865 18:10537985-10538007 GGCTCCACACTGACATCTCATGG - Intronic
1154940026 18:21103013-21103035 GTCCAAAGTCTGATATCTCAGGG - Intronic
1160846332 19:1167780-1167802 GACCGCAGGCTGAGACCTCATGG - Intronic
1160911310 19:1475022-1475044 CTCCTCAGGCTGACCTCTCGGGG - Exonic
1160985793 19:1837942-1837964 GTCCCAAGGCTTACAGCTCGAGG + Intronic
1162845531 19:13389412-13389434 GTCCCCAGGCATCCATCCCAGGG - Intronic
1162987396 19:14279715-14279737 GTCTCCAGACTGGCTTCTCAGGG - Intergenic
1165953739 19:39489170-39489192 GTCCCCAGGCCCAAATCTCTAGG - Intronic
1165956408 19:39504361-39504383 CTCCCCAGGCTGGTGTCTCATGG - Intronic
1167051278 19:47080267-47080289 GTCCTCAGCCTGACTCCTCAGGG + Intronic
1202700467 1_KI270712v1_random:160190-160212 GTCTCCAGCATGACGTCTCAGGG + Intergenic
929618536 2:43331522-43331544 TTCCTCTGGCTGACATCTGAGGG + Intronic
930283647 2:49401382-49401404 GGCTCCAGGCTGACATATCTGGG + Intergenic
932446507 2:71785078-71785100 GTGCCCAGGCTGAGACATCAGGG - Intergenic
934171395 2:89543663-89543685 GTCTCCAGCATGACGTCTCAGGG + Intergenic
934281704 2:91617981-91618003 GTCTCCAGCATGACGTCTCAGGG + Intergenic
934653322 2:96104438-96104460 GGCCCCAGGCTGCCCCCTCAGGG - Intergenic
938199073 2:129358253-129358275 ATCCCCAGGCAGAGACCTCAGGG - Intergenic
938200606 2:129369522-129369544 GTCCCCAGTGTGAAATCTGAGGG + Intergenic
939682455 2:145155387-145155409 GTCCACAGGTTGAAACCTCAAGG + Intergenic
942251079 2:174048405-174048427 GTTCCCAGACTGACATCTGCTGG + Intergenic
943747798 2:191480221-191480243 ACTCCCAGACTGACATCTCAGGG + Intergenic
944972599 2:205011287-205011309 GTAGCCAAGCTGTCATCTCAAGG + Intronic
945373486 2:209051167-209051189 TTCCTCAGGCTGACATGACAGGG - Intergenic
946904135 2:224399968-224399990 GTGCCCAGGCTCACATACCATGG + Intronic
947485018 2:230540039-230540061 GCTCCCAGGGTGTCATCTCAGGG + Intronic
947797086 2:232901517-232901539 GTCACCAGGGTGACATCTGCGGG + Intronic
1168902877 20:1379891-1379913 TCCCCCAGGCTGACAACTTAGGG - Intronic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1172491140 20:35338982-35339004 GTACCCAGTCTGACATTCCAAGG + Intronic
1173842019 20:46163684-46163706 TTCCCCAGGCTGATTTCCCAGGG - Intergenic
1175408821 20:58752715-58752737 GGCACCAGGCTGTCATCCCAAGG + Intergenic
1175946486 20:62561340-62561362 GTCCCCAGGTCGACATCTGGTGG - Intronic
1175957156 20:62617251-62617273 CTGCCAAAGCTGACATCTCAGGG - Intergenic
1179250433 21:39667227-39667249 ATCACCAGTCTGACCTCTCACGG - Exonic
1180048573 21:45321002-45321024 GTTCCCAGGGTTACATCTTAAGG - Intergenic
1180861741 22:19087135-19087157 GTCCCCAGGCTGACCAACCAGGG + Intronic
1181316065 22:21971536-21971558 GTGCCCAGCGTGACTTCTCAGGG - Intronic
1181330133 22:22084384-22084406 GTCCCCAGCCTGAGAGCTGAGGG + Intergenic
1182942311 22:34288454-34288476 GTCCCCAGTCCTCCATCTCAAGG + Intergenic
1182995235 22:34806081-34806103 GACCCCTGGCTGACACATCAGGG + Intergenic
1183084612 22:35478827-35478849 GTCCCCAGCCTGTCATTTGAAGG - Intergenic
1184032507 22:41903253-41903275 GTCACCAGGCTGACCTCAGAGGG - Intronic
1184233080 22:43168898-43168920 GTCCCCAGGCTGAGATCTTCCGG - Exonic
949637958 3:6004924-6004946 ATCCCCAAACTGACAACTCAAGG + Intergenic
950849418 3:16048545-16048567 GTACCCAGGCTGAGTTCTGAAGG - Intergenic
954413104 3:50379824-50379846 GTCCCCTGCCTGACCTCTCCAGG - Exonic
959434705 3:106300176-106300198 GTCACCAGATTGACATATCAAGG - Intergenic
960046467 3:113203589-113203611 CTCCCCAGGCTGGCTCCTCAGGG - Intergenic
961371779 3:126435833-126435855 TTCCCCAGGCTGCCAGCCCATGG + Intronic
963044387 3:141092049-141092071 GTCCCCATGCTGCCAGCTCTGGG - Intronic
963933077 3:151024507-151024529 CACCCCTGGCTGACATCACATGG - Intergenic
966871167 3:184291336-184291358 GTCCCCAGGCTTACAAAGCATGG + Exonic
968810763 4:2798788-2798810 GTTCCCAGGCTGAGACCTCTAGG + Intronic
969028362 4:4192225-4192247 GTCTCCAGCATGACGTCTCAGGG - Intronic
971588210 4:28432539-28432561 GGCCCCAGAATGACATTTCACGG + Intergenic
973749274 4:53997067-53997089 GTCCGCAGGCTGTCATTTGAGGG - Intronic
975300145 4:72780489-72780511 ATCACCTGGCTGACATCACATGG + Intergenic
976178156 4:82374469-82374491 GGCACAGGGCTGACATCTCAGGG - Intronic
980467690 4:133206177-133206199 GTACCCAGGCTTACACCTCCAGG - Intronic
986470721 5:8071615-8071637 GTGGCCAGACTTACATCTCAGGG + Intergenic
991154951 5:63422785-63422807 TTCCCCAGCCTGAAATCTCAAGG + Intergenic
992381928 5:76246103-76246125 GTCCTCAGGATGAAATCACAGGG - Intronic
992818764 5:80472286-80472308 ATCCCCAGGCAGAGAGCTCAGGG + Intronic
997530913 5:134580520-134580542 GGCCCCAGGGTGATAGCTCAGGG + Exonic
999776757 5:154818064-154818086 CTCCCCAGCATCACATCTCAGGG - Intergenic
1000775889 5:165419003-165419025 CTCCTTAGGCTGACATGTCATGG + Intergenic
1001144171 5:169169536-169169558 CTCCCCAGTTTGACATCTCAAGG - Intronic
1001207879 5:169781033-169781055 GAGCCCATGCTGGCATCTCAGGG + Intronic
1001453938 5:171846618-171846640 ACATCCAGGCTGACATCTCACGG + Intergenic
1002201093 5:177528791-177528813 GTCGCCAGGCGGGCCTCTCATGG - Intronic
1003331511 6:5133126-5133148 GTCCCCGTGCTGCCATCTCACGG + Intronic
1004084043 6:12426651-12426673 GTCCCCTGCTTGTCATCTCATGG - Intergenic
1006946528 6:37788118-37788140 GTACCCATGCTGATATGTCATGG + Intergenic
1006989451 6:38200978-38201000 TTGCCCAGGCTGGCATGTCATGG - Intronic
1007621702 6:43219390-43219412 GTCCCCAGACTGAGATGCCAGGG + Intronic
1007867857 6:44993121-44993143 TTCCCCAGGCTGAAATGCCATGG - Intronic
1012079493 6:94737111-94737133 GTGCCCATGCTGAGCTCTCATGG - Intergenic
1013397984 6:109762393-109762415 ATCCCATGGCTTACATCTCAAGG - Intronic
1014762945 6:125377868-125377890 CTGCTCAGGCTGACTTCTCATGG + Intergenic
1015162585 6:130169834-130169856 GTCCCCAGCCTTAGAACTCAAGG - Intronic
1016703262 6:147077647-147077669 TGCCCCAGGGAGACATCTCAGGG + Intergenic
1017773710 6:157663370-157663392 GTCCCAAGTCTGACATCTCTGGG - Intronic
1017991294 6:159491862-159491884 GTCCCCGGGCAGACATGACATGG - Intergenic
1018573390 6:165233679-165233701 GTACCCAGGCAGGCTTCTCAGGG + Intergenic
1018873363 6:167799618-167799640 GTCCCCGGACTGACATCTCTGGG + Intergenic
1019015491 6:168876990-168877012 GTTCCCAGGCCAACATCTCACGG - Intergenic
1020891526 7:13883959-13883981 GTTCCCAAGCTGCCATATCACGG + Intergenic
1021526714 7:21596201-21596223 GTCCCAAGGCTGCCATGACAAGG + Intronic
1022045925 7:26622386-26622408 GTTTCCAGGCAGACATTTCATGG + Intergenic
1029087637 7:98023683-98023705 GTCACCAGGATGACATTTCTGGG + Intergenic
1030828821 7:114196050-114196072 GTCACCAGGCTGAAATGTGATGG + Intronic
1033440732 7:141375948-141375970 GTCCCCAGGTTGCCAGCTCTGGG - Intronic
1033582487 7:142750304-142750326 GTCACCAGGCTGAAGTCGCAAGG - Intronic
1034386515 7:150745143-150745165 GTCCTCAGTCTGAGAACTCAGGG + Intronic
1035083811 7:156239207-156239229 GTCCCCAGGAAGCCATGTCAGGG + Intergenic
1035346381 7:158202440-158202462 GTCCCCAGGCAGTCATGTCTGGG + Intronic
1043447268 8:80331210-80331232 CTCCCCATGCTGTCATCCCAAGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1051507406 9:17841777-17841799 GTCCCCAGGCTGAAATGTAGTGG - Intergenic
1053363325 9:37505020-37505042 GGGCCCAGTCTCACATCTCAGGG + Intergenic
1056841097 9:89998536-89998558 GTCCCCAGGCTCACCACCCATGG + Intergenic
1059696276 9:116733188-116733210 GTCCCAAGTCTGAGGTCTCAGGG + Intronic
1062228251 9:135465903-135465925 GTCCCCAGGTCCTCATCTCAGGG + Intergenic
1062646989 9:137552840-137552862 CTGCCCAGGCTGAGAACTCATGG + Intergenic
1185469530 X:374157-374179 GTCCCCAGGCTCTCTTCTCGGGG - Intronic
1190650474 X:52563841-52563863 GTCCCCAGGCCCACATCCCCAGG + Intergenic
1196033319 X:111115008-111115030 GCCCCCAAGCTGAGATCACAGGG - Intronic