ID: 1079370875

View in Genome Browser
Species Human (GRCh38)
Location 11:19851200-19851222
Sequence ACAGCTAGTAAGTGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 2, 2: 21, 3: 88, 4: 404}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079370875 Original CRISPR ACAGCTAGTAAGTGGCAAGC TGG Intronic
900732975 1:4274999-4275021 ACAGCTGGTACGTGCCAAACTGG - Intergenic
901840911 1:11953432-11953454 ACAGCTAGTAAATGGTGAGCTGG - Intronic
902825731 1:18972848-18972870 ACAGCTAGTCAGCAGCAAGCAGG + Intergenic
902928094 1:19710612-19710634 ACAGTAAGTAAGTGGCATGGTGG + Intronic
903517361 1:23920471-23920493 ACAGCTATTCAGTGGCAAACTGG - Intergenic
903677198 1:25071860-25071882 TCAGCTAGTTAGTGGCAGGGCGG + Intergenic
903684608 1:25121593-25121615 ACAGTTAATAAGTGGCACTCTGG - Intergenic
903734394 1:25521046-25521068 ACAGCCAATAAGTGGTCAGCTGG - Intergenic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904110977 1:28125819-28125841 ATAGTTAGTAAGTGGCAGGGTGG - Intergenic
904344480 1:29859134-29859156 ACATCTAGTAAGTGGCAGAGTGG + Intergenic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
904810908 1:33162892-33162914 ACAGCTAGAAAATGGCAACTTGG - Intronic
904812322 1:33171440-33171462 ACAGCTAGTAAGAGGCAGAGGGG + Intronic
905231583 1:36517773-36517795 ACAGCCAGTAAGTGGCAGAGTGG + Intergenic
905570118 1:38997064-38997086 ACAGCTAGTAAGAAGCAAAGTGG + Intronic
906274334 1:44505149-44505171 ACAGCTTCTAAGTGGCAGTCAGG + Intronic
906410368 1:45573989-45574011 TCATCTAGAAAGGGGCAAGCAGG + Intergenic
906566877 1:46807181-46807203 ACAGGGAGGCAGTGGCAAGCTGG + Intronic
907473940 1:54692911-54692933 ACAGGTGGCAAGTGGTAAGCTGG - Intronic
907723214 1:56993493-56993515 ACAGCTAGTATGTGCCAGGCAGG - Intergenic
908483473 1:64567127-64567149 ACCTCTAGTAAGTGGTAGGCAGG + Intronic
909518718 1:76542315-76542337 ACAGTTTGTAAGTGGTAATCAGG - Intronic
909720616 1:78765154-78765176 ACAGCATATAAATGGCAAGCAGG - Intergenic
910532689 1:88258130-88258152 ACAGCTAGTAAGAAGGAAGCAGG + Intergenic
911120988 1:94296255-94296277 AGAGCTACTAAGTGACTAGCAGG - Intergenic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
911328038 1:96492382-96492404 ACAGCTAGTACGTGGCAGAGGGG + Intergenic
911514684 1:98852887-98852909 ACAGCTACTAAGTGACTACCAGG - Intergenic
912702848 1:111891070-111891092 ATGGCTAGTAAGTGGAGAGCTGG - Intronic
913109949 1:115648738-115648760 ACAGCTAGGAAGCACCAAGCTGG + Intronic
913283130 1:117204363-117204385 CCAGCTAGGAAGTGGAGAGCTGG + Intronic
915431441 1:155869908-155869930 ACGGCTGGCAAGTGGTAAGCTGG - Intronic
915708517 1:157870865-157870887 ACAGCTAGTAAGTGACAGAGTGG + Intronic
916282666 1:163069454-163069476 ACAGCTTGGAATTCGCAAGCAGG - Exonic
917926337 1:179792053-179792075 ACATCTAGTAAGTGGCAGTCAGG - Intronic
921172230 1:212559873-212559895 ACAGCTAATGAATGGCGAGCTGG + Intergenic
921861270 1:220044843-220044865 ACAACTAGTAAGTGGCAGCCAGG + Intronic
922229271 1:223671647-223671669 ACAGCAAGAAAATGGCAAGAAGG + Intergenic
922474617 1:225898663-225898685 ACAGCTGGTGAGTGGCACACTGG + Intronic
923135639 1:231116054-231116076 ACAGCCAGTGAGTGGCTACCAGG + Intergenic
923435506 1:233964247-233964269 ACGGCTAGTTAGTGCCAAGAGGG + Intronic
924478720 1:244406633-244406655 ACAGCTACTAAGTGACTAACAGG - Intergenic
1063213841 10:3906165-3906187 ACAGCTAGTTAGTGACACGAGGG + Intergenic
1063380409 10:5581987-5582009 ACAGGTAGCAAGTGGCAGCCAGG + Intergenic
1063500156 10:6546106-6546128 ACAGCTAGTAAGTGGGATGGTGG + Intronic
1063738803 10:8794542-8794564 ACATCTAGTAAGTGGGAGGAAGG - Intergenic
1066249025 10:33615090-33615112 AAAGCTAGTAAGAGGCCACCAGG + Intergenic
1067709050 10:48634255-48634277 ACAGCTAGTTAGTGGCAGACAGG - Intronic
1067744147 10:48922314-48922336 ACAGCTACTAAGTGACGAACAGG - Intronic
1069944074 10:71973979-71974001 ACAGCCAGTAAGTGGGGAGTTGG - Intronic
1069948078 10:72001033-72001055 ACAGCTGGGAGGTGGCAGGCAGG + Intronic
1069950656 10:72016092-72016114 GCAGGTAGTAAGTGCCCAGCAGG + Intergenic
1070470037 10:76769517-76769539 ACAGGTAGTAAGTGGCTGGTTGG - Intergenic
1070654694 10:78263278-78263300 ACAGTTAGCAAATGGCAGGCTGG - Intergenic
1071355368 10:84788450-84788472 ACAGCTAGTAAGTGGAAGAATGG - Intergenic
1072250401 10:93577803-93577825 ACAGCTTGTAAGTGGCAATCAGG + Intronic
1072363295 10:94682298-94682320 ACAGCTCATAAATGGCAGGCTGG - Intergenic
1072383925 10:94904340-94904362 ACAGCTCATAAATGGCAGGCTGG - Intergenic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1073564286 10:104521975-104521997 ACAGCTAGTGAGGAGCAGGCTGG + Intergenic
1073749465 10:106507722-106507744 ACAGCTAGTAAATGACAGACTGG + Intergenic
1073838780 10:107474547-107474569 ACAGCTTGTAAGTGGTAAACTGG - Intergenic
1074346424 10:112690625-112690647 ACAGCTTATAAATGGCAAGATGG - Intronic
1074390530 10:113053893-113053915 ACAGCTGGGAGGCGGCAAGCTGG + Intronic
1074394080 10:113082891-113082913 ACAGCTAGTCAGTGGGAGGGTGG + Intronic
1075555834 10:123431210-123431232 ACAGCTAGCAAGTAGGGAGCTGG - Intergenic
1076198254 10:128536381-128536403 ACAGCTACTAAGTGACAAGTGGG + Intergenic
1077461956 11:2715222-2715244 ACAGCTAGAAAGTGGCCAGCTGG + Intronic
1078935968 11:15950435-15950457 TCTGCTAGTAAGTGGTAATCTGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080347818 11:31344481-31344503 ACAGCTTGTAAGTGGGCAGCAGG - Intronic
1080891459 11:36412130-36412152 ACAGCTACTAAGTGGCTGCCAGG + Intronic
1081049993 11:38326967-38326989 ACAACTAGTAAGTCGAAGGCCGG - Intergenic
1081320228 11:41683158-41683180 ACAGCTAGTAACTGGCAGAGGGG - Intergenic
1081351769 11:42062500-42062522 ATAACTAGTAAGTGGCAAACAGG + Intergenic
1081460313 11:43266801-43266823 ACAGGTAGAAAGTGGCAGACTGG - Intergenic
1081739378 11:45427438-45427460 ACAGATATTAATTGGCAACCTGG + Intergenic
1083334053 11:61912635-61912657 ACAGCAAGGAAGTGGCAGGATGG + Intronic
1085395994 11:76207489-76207511 TCAGCTAGGGAGCGGCAAGCCGG + Intronic
1086047130 11:82546462-82546484 ACAGCTACTTAGTGGCAGGAAGG - Intergenic
1086823527 11:91467059-91467081 TCAGGTAATAAGTGGCAAGGTGG - Intergenic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1088760398 11:112923964-112923986 ACAGCTACTAAGAGACAAACAGG + Intergenic
1089299615 11:117490702-117490724 ACAGCTGGTGAGTGGCAGGAAGG + Intronic
1089410563 11:118238210-118238232 ACAACTAGTAAGTGACAAAAGGG + Intronic
1090272417 11:125397536-125397558 ACAGATAGTAAATGACAGGCCGG + Intronic
1090740529 11:129655425-129655447 ACAGGTACAGAGTGGCAAGCCGG + Intergenic
1090766232 11:129878600-129878622 ACAGCTAGTAAAGAGAAAGCAGG - Intronic
1090944063 11:131413989-131414011 ATAGCTAGTTAGGGTCAAGCTGG - Intronic
1091815331 12:3433536-3433558 ACAGCTGGTAAGTGGCAGAGTGG + Intronic
1092970976 12:13694548-13694570 ACAGCTAGTAAGTGACAGACTGG + Intronic
1093446381 12:19264258-19264280 ACAGCTAGTTAGTGTTAGGCAGG + Intronic
1093771743 12:23026026-23026048 ACAAGTAGTAAGTGGTGAGCTGG + Intergenic
1095922576 12:47545430-47545452 GCAGCTAGTAAGTGGCACTGTGG - Intergenic
1095951891 12:47786102-47786124 ACAGCTAGTAAGTGGCAGCAAGG + Intronic
1096181138 12:49551074-49551096 ACAGCTAGGAATCGGCCAGCCGG + Intronic
1097393632 12:59046348-59046370 ACAGCTGGAAAGTGGAGAGCTGG - Intergenic
1097589301 12:61554140-61554162 ACAGCTAGTTAGTGGCAGAATGG - Intergenic
1097685327 12:62685474-62685496 ACAGTTAATAAGTAGCAAGCTGG - Intronic
1098378671 12:69844632-69844654 ACAGCTTGTAAGTGACACACAGG - Intronic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1100732311 12:97485718-97485740 ATAGCTAATAAGTGGCAAAGAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102560006 12:113755126-113755148 ACAGCTAGTGAGTGGCAGAGTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1103125737 12:118420876-118420898 ACAGCCAGTAAATGGCAAGCCGG + Intergenic
1103140362 12:118542701-118542723 ACATCTAATAAGTGACAAGGTGG + Intergenic
1103167153 12:118779622-118779644 ACAACTAGAAAGTGGCAATCTGG - Intergenic
1103686803 12:122738584-122738606 ACAGCTACTAAGTGACTACCAGG + Intergenic
1104800125 12:131548914-131548936 GCAGCTACTAAGTGGCCAGTGGG + Intergenic
1105052622 12:133068055-133068077 ATAGGTAGGAAGTGGCCAGCAGG + Intergenic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1107005702 13:35608556-35608578 ACAACTAGTATGTGCCAAGCAGG - Intronic
1108165663 13:47690395-47690417 CCATCTAGTAAGGGGCAAGGGGG - Intergenic
1109199963 13:59419408-59419430 ACAGCAAGTTAGTGGGAGGCTGG + Intergenic
1110495328 13:76161459-76161481 ACAACTAGTAAATGGCAGGGTGG - Intergenic
1111592228 13:90364273-90364295 ACAGCTACTTAGTGGCAGGTTGG + Intergenic
1113143933 13:107186106-107186128 ACAGCTACTAAGTGACTAACAGG - Intronic
1116053810 14:39838663-39838685 ACAGCTGGTAGGTGGAAAACTGG + Intergenic
1117702086 14:58424406-58424428 ACAGATAGTAACTGGACAGCTGG + Intronic
1118043080 14:61938356-61938378 ACATCTCGTATCTGGCAAGCTGG - Intergenic
1119167340 14:72505687-72505709 ACAGCTGGTAGGTGGCAGCCAGG - Intronic
1119408971 14:74416939-74416961 ACAGCTGGTGAGTGGGGAGCTGG + Intronic
1119656769 14:76422777-76422799 ACAGCGAGTCAGTGACAGGCCGG + Intronic
1119666750 14:76490586-76490608 ACAGCTAGTAAGCGGGAGTCAGG + Intronic
1120904629 14:89609662-89609684 ACAGCTGTTAAGTGGCAGGGAGG + Intronic
1121962085 14:98270215-98270237 ACTGCTAGTTAGAGGCAACCTGG + Intergenic
1122349864 14:101082882-101082904 ACAGCTTCCAAGTGGCAAGCTGG + Intergenic
1122425185 14:101601640-101601662 ACAGCTAGGAAGTGCCCAACAGG - Intergenic
1125067313 15:35503861-35503883 AAAGCTAGTAAGTGGCAGCTGGG + Intronic
1125253370 15:37732510-37732532 ACAGCTACTAAGTGACAAACAGG + Intergenic
1125326338 15:38539449-38539471 ACAGCTAGGAAGTAGCAAGAAGG + Intronic
1126317757 15:47388536-47388558 ACAGCTACTAAGTGACTAACAGG - Intronic
1126653709 15:50953563-50953585 ACAGCTACTAAGTGACTAACAGG - Intronic
1127063684 15:55214648-55214670 ACAGTAACTAAGAGGCAAGCAGG - Intronic
1127094190 15:55496441-55496463 ACAGCTAGTGACTGGCAGCCTGG - Intronic
1127310850 15:57751000-57751022 ACAGCTAGAAAGTGTCAGGACGG - Intronic
1127427963 15:58874571-58874593 ACATCTAGTAAATGGCAGACTGG + Intronic
1127607163 15:60598009-60598031 ACAGCTAGTGAGTGGGATGTAGG - Intronic
1128074371 15:64817022-64817044 ACAGTTAGTGAGTGGCAGCCTGG - Intronic
1128137908 15:65277618-65277640 ACAGCTATTCAGTGGCAGGGTGG + Intronic
1128579148 15:68796739-68796761 ACAGCAAGTTAGCGGCAAGGCGG - Intronic
1129084915 15:73078892-73078914 ATACCTAGTAAATGACAAGCAGG + Intronic
1129746288 15:78023720-78023742 ACAGCTAGTATGGGGTTAGCTGG - Intronic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1131353840 15:91725660-91725682 ACAGCTAGTAAATGGCATTGTGG + Intergenic
1131530245 15:93184803-93184825 ACAGCTAGTGAGTGGAAAGGTGG + Intergenic
1132315673 15:100888675-100888697 ACAGCTAGTAAGTGGCAGAGTGG - Intronic
1133182698 16:4070298-4070320 GCAGCTAGTAACTGGAAAACTGG + Intronic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1133753259 16:8741401-8741423 ACAGCTAGCAAGTGGTTAGCAGG - Intronic
1133836474 16:9372118-9372140 TAAGCTAGTAAGTGGCATGATGG + Intergenic
1133888052 16:9850326-9850348 ACAGCTAGTAAGTGGTACAGTGG - Intronic
1134506224 16:14809479-14809501 ACAGCTAGTGAGTGGAGAGTTGG - Intronic
1134574328 16:15319285-15319307 ACAGCTAGTGAGTGGAGAGTTGG + Intergenic
1134625254 16:15718590-15718612 ACAGCCAGGAAGTGGACAGCCGG + Intronic
1134667277 16:16028008-16028030 ACAGCTAGGAAATGGCAAGCTGG + Intronic
1134685040 16:16152697-16152719 ACAGCTAGTAAGTGGCAGGGCGG + Intronic
1134728089 16:16437013-16437035 ACAGCTAGTGAGTGGAGAGTTGG - Intergenic
1134808940 16:17150640-17150662 ACAGCTGGTGAGTGGCAATGAGG + Intronic
1134884745 16:17780613-17780635 ACAGCTAGTAAATGGCAAGGTGG + Intergenic
1134939347 16:18274813-18274835 ACAGCTAGTGAGTGGAGAGTTGG + Intergenic
1135274437 16:21099592-21099614 ATAGCTACTAAGTGGCAAGGTGG - Intronic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1135792890 16:25414148-25414170 ACAGCTAGTAAATGACAGCCAGG - Intergenic
1137343661 16:47635230-47635252 AAAGCTATTAAGTGGCAACATGG - Intronic
1137492203 16:48942721-48942743 ACAGATAGTAAGTGACAAAGTGG + Intergenic
1137897669 16:52231812-52231834 ACAGGTAATAAGTGGTGAGCTGG - Intergenic
1139363700 16:66419598-66419620 ACAGCAAGTAAGTGGCAGAAGGG + Intergenic
1140782837 16:78312342-78312364 ATTGCTAGTGAGTGGCCAGCTGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1141108814 16:81255292-81255314 ACAGCTAGCGAGTGGTAATCTGG - Intronic
1141401629 16:83752534-83752556 ATAGCTAGTAAGTGGTATGGCGG - Intronic
1141410062 16:83827110-83827132 ACAGCTGGTAAGAGGCGAACTGG + Intergenic
1141760313 16:86024865-86024887 ACAGCCAGTAAGTGGCAGAGTGG + Intergenic
1141843498 16:86590698-86590720 GTAGCTAGTAAGTGGCAGGCTGG + Intergenic
1142554305 17:762761-762783 ACACTGAGTAAGTGGCAGGCAGG - Intronic
1144454091 17:15404728-15404750 AAAGCAAGGAAGTGGCAAGATGG + Intergenic
1144664918 17:17095842-17095864 ACAGCTAGGAGGAGGCAGGCTGG - Intronic
1145783065 17:27576582-27576604 ATAGCTACTAAGTGACAAACAGG + Intronic
1146176893 17:30670880-30670902 ACAGCTAATAACTGTGAAGCCGG - Intergenic
1146350356 17:32086980-32087002 ACAGCTAATAACTGTGAAGCTGG - Intergenic
1147357256 17:39907789-39907811 AGAGCTAGTGAGTGGCAGGGTGG + Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147374604 17:40016229-40016251 ACAGCTTGTAGGTGGCACACTGG - Exonic
1148601357 17:48896591-48896613 AGAGCTAGTAAGTGGCAGATTGG + Intergenic
1148878510 17:50707505-50707527 ACGGCTGGTAAGTGGGGAGCGGG - Exonic
1149646798 17:58246968-58246990 ACAACTAGAAAGTGGCAGTCAGG + Intronic
1150157711 17:62868272-62868294 ATTGTTAGTGAGTGGCAAGCTGG - Intergenic
1150158324 17:62872532-62872554 ACAGCCAGTAAATGGGGAGCTGG - Intergenic
1151216015 17:72576747-72576769 ACAGCAAGTGAGTGACAAGTGGG + Intergenic
1152182650 17:78833591-78833613 ACAGTTACTAAGGGGCAAACTGG + Intronic
1153592938 18:6693539-6693561 ATAGCTAGTAAGTGGCAAAGCGG - Intergenic
1153641214 18:7158681-7158703 ACTGATAGTAAGTGGCAGGGTGG - Intergenic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1155594783 18:27473060-27473082 AAAGCTATTCAATGGCAAGCTGG + Intergenic
1156783849 18:40884642-40884664 ACAGCTAGTAAGGGGCAGAGTGG - Intergenic
1156919823 18:42508126-42508148 ACAGCTACTAAGTGACTAACGGG + Intergenic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1157402072 18:47396898-47396920 ACAGAAAGTCAGTGGCAGGCTGG + Intergenic
1158316367 18:56215051-56215073 ACAGCTAGAAAGGGAGAAGCTGG - Intergenic
1159620907 18:70637210-70637232 ACAGCTACTAAGTGACTAACAGG - Intronic
1162981925 19:14246030-14246052 ACAGCTAATAACTGTGAAGCCGG + Intergenic
1163091542 19:15023383-15023405 ACAGCTTGAAACTGGGAAGCTGG - Intergenic
1163725384 19:18920482-18920504 ACTGCCAGTGAGTGGCAGGCTGG - Intronic
1163774716 19:19211488-19211510 ACAGCTGGTAAGAGGCACGCAGG - Intergenic
1164109903 19:22146482-22146504 AAAACTGGTAAGAGGCAAGCTGG - Intergenic
1165851591 19:38852729-38852751 ACAGCTTGCAAGTGGCATGGCGG + Intergenic
1167035378 19:46992283-46992305 ACCGCTAGGGAGTGGCAAGCCGG + Intronic
1167388161 19:49176878-49176900 ACAGCAAGAAAGGGCCAAGCTGG - Intronic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
1167755898 19:51413563-51413585 ATAGCTAGTAAGTGCCAGGCAGG + Intronic
1167870339 19:52363866-52363888 ACAGCTAATATGTGACAAGATGG - Intronic
1168492023 19:56819007-56819029 ACAGATAGTAAGTGCTAAACGGG + Intronic
925981322 2:9179837-9179859 ACAGCTAGCAAGTGCCTAGCTGG + Intergenic
926114410 2:10203318-10203340 ACAGCTAGTGGGTGGCAGTCGGG - Intronic
926876001 2:17479566-17479588 AGAGCCAGTAAGTGGGAAGAAGG + Intergenic
926951434 2:18247842-18247864 CCAGCAAGAAAGTGGCAGGCTGG - Intronic
927230032 2:20812999-20813021 ACAGCTAGTAAGTTGTAAAGTGG + Intronic
927419076 2:22910712-22910734 ATAGCTAGCAAGTGGCAAATGGG - Intergenic
928405421 2:31010880-31010902 CCAGCAAGGAAGTGGCAAGATGG + Intronic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
929316241 2:40482624-40482646 ACAGCTGGTAAGTGGCAGAGTGG + Intronic
929531988 2:42758515-42758537 CCAGCTAGTAAGTGGCAGTCTGG - Intergenic
930445128 2:51461093-51461115 ACAGCTAGTAAGCAGCAGGTGGG + Intergenic
930736174 2:54781211-54781233 ACAGCTAGTGAGTGGCAGGCTGG + Intronic
932137066 2:69240749-69240771 ACAGCCAGTAAGTGGCAGAGTGG - Intronic
932389990 2:71379443-71379465 ACAGCTATTAAGTGACTAGTGGG - Intronic
932431054 2:71673703-71673725 ATAGCTAGGAAGTGGCAAGCTGG - Intronic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
932608238 2:73178215-73178237 GCAGCTAGTAAGTGGCAGAAGGG - Intergenic
932888773 2:75571863-75571885 ACAACTAGTAAGTGGGAAGTGGG - Intergenic
933014062 2:77102036-77102058 ACAGATAGTAACTGGGAAACAGG - Intronic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
933970365 2:87465061-87465083 ACAGCTAGCAAGAGGAAGGCAGG - Intergenic
934178521 2:89598847-89598869 ACAGCTAAGAAGTGACAAGGTGG - Intergenic
934288816 2:91673132-91673154 ACAGCTAAGAAGTGACAAGGTGG - Intergenic
935108414 2:100068594-100068616 AAAACTAGCAAGTGGCCAGCAGG + Intronic
935341305 2:102062018-102062040 ACAGCTAGTAAATGGCAGAGCGG + Intergenic
936142383 2:109951503-109951525 ACAGCTACTAAGTGACTAGTGGG - Intergenic
936179073 2:110249462-110249484 ACAGCTACTAAGTGACTAGTGGG - Intergenic
936202305 2:110419970-110419992 ACAGCTACTAAGTGACTAGTGGG + Intronic
936249442 2:110856325-110856347 ACAGCTACTAAGTGACTAACGGG - Intronic
936323418 2:111485435-111485457 ACAGCTAGCAAGAGGAAGGCAGG + Intergenic
937135365 2:119547006-119547028 ACACCTGGTAAGTGGAGAGCTGG + Intronic
937840088 2:126516022-126516044 ACAGCAAGTAAGAGGCAGGAAGG - Intergenic
937854061 2:126660128-126660150 ACAGCTTGTATGTGCCAGGCAGG + Intronic
937867417 2:126763394-126763416 ACAGCTAATATGTGGCAGTCTGG + Intergenic
937900066 2:127012999-127013021 ACAGCTAGTAAGTGCTAGACTGG + Intergenic
937916589 2:127102253-127102275 ACAGCTTGTAAGGGACCAGCTGG + Intronic
939154776 2:138511865-138511887 ACAGCTATTAAATGGCAGGGTGG - Intronic
940470822 2:154097977-154097999 ACAGCTAGTCAGTGGCAGACTGG + Intronic
940825214 2:158403952-158403974 ACAGCTAGTAACTGATAAACTGG - Intronic
941347715 2:164390567-164390589 ACACGTATGAAGTGGCAAGCAGG - Intergenic
941808986 2:169737085-169737107 TCAGCAAGTAAGAGGAAAGCAGG - Intronic
941905146 2:170712820-170712842 CCAACTAGAAAGTGGCAAGGCGG + Exonic
942085509 2:172439769-172439791 ACAGCTAGTCAGTGGTAATGTGG + Intronic
942518273 2:176775983-176776005 ATAGCTAGTAGGTGGCAAGCAGG + Intergenic
942745067 2:179222274-179222296 ATAGCTAGTAAGTGGCTGGCCGG - Intronic
943398529 2:187373817-187373839 ACAGCAAGTAAGTGACAAAGTGG + Intronic
943626642 2:190208864-190208886 AGAGCTGGTAAGTGGCAAATGGG - Exonic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
944654935 2:201867966-201867988 AAAGCTCGTAAGTGGCAAAAAGG + Intronic
944879289 2:203994927-203994949 ACAGCTAGGAAGTGGCAGAGTGG + Intergenic
945054613 2:205857560-205857582 ACAGCTAGAAAATGGCACCCTGG - Intergenic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
945560614 2:211335199-211335221 ACAGCCAAAAGGTGGCAAGCTGG + Intergenic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
946458085 2:219845397-219845419 ACAGCCAGTCAGTGGCAAACTGG - Intergenic
946467075 2:219921414-219921436 AAAACTAGTTAGTGGCAACCTGG + Intergenic
946719847 2:222592986-222593008 ACAGCTACTAAGTGACTAACGGG - Intronic
947583276 2:231335195-231335217 ACAGCTGGTCAGTGGCCAGCAGG + Intronic
948035157 2:234852540-234852562 GTAGCTAGCAAGAGGCAAGCTGG + Intergenic
948369164 2:237476386-237476408 ACAGCAAGTATCTGGCAACCAGG - Intergenic
1170196527 20:13694585-13694607 ACAGCTATTGTGTGGCAAGAAGG - Intergenic
1170651391 20:18245656-18245678 CCAGCTAGTAAGTGGCAGAGTGG - Intergenic
1170974713 20:21151162-21151184 ACAGCTAGTAAGTGGCATACTGG + Intronic
1171543385 20:25983673-25983695 ACAGATAGTCACTGGGAAGCTGG + Intergenic
1172772667 20:37390800-37390822 ACAGCCAGCAAGTGGTGAGCTGG + Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1174362286 20:50036534-50036556 ACAGCTAGCAAGTGACAACCAGG + Intergenic
1174732705 20:52933398-52933420 ACAGCCAAGAAGTGGCAAGCGGG + Intergenic
1174999025 20:55606012-55606034 ACAGCTCCTAAGTGGGAAGTTGG - Intergenic
1175497199 20:59423321-59423343 CGAGCTAGCAAGTGGCAGGCAGG - Intergenic
1176938437 21:14894611-14894633 ACAGATAGTAAGTGGCAGACTGG - Intergenic
1178057683 21:28817818-28817840 ACAGCTAGTGAATGGGAAGCTGG - Intergenic
1180627748 22:17205536-17205558 ACAGCTGGTAAATGGCCAGTTGG - Intronic
1181895223 22:26101256-26101278 ACAGCTAGTAGGCAGCATGCAGG + Intergenic
1183009547 22:34933459-34933481 ACAGCCAGTAGGTGGCAAAATGG + Intergenic
1183123633 22:35752987-35753009 ACAGAAAGTAAATGGCTAGCAGG + Intronic
1183198417 22:36369131-36369153 ACAGCTAGTCAATGGCAGGAGGG + Intronic
1183998571 22:41655037-41655059 ACAGCTACTAAGTGACTAACTGG - Intronic
1184101326 22:42343172-42343194 CCGGCTAGCAAGTGGCCAGCCGG - Intronic
1184604844 22:45566529-45566551 AGAACTAGTAAATGGCAAGAAGG - Intronic
1184978381 22:48079229-48079251 ACAGCGAGTAACTGGCAGGCAGG + Intergenic
949926264 3:9044329-9044351 GCAGCTACTAAGTGGCCAGTGGG + Intronic
950236269 3:11323370-11323392 ACAGCTGGTAGGAGGGAAGCTGG - Intronic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
950440119 3:13005586-13005608 ACAGCTAGCAGGTGGAGAGCTGG - Intronic
950888976 3:16386478-16386500 ACAACTAGTAAAGGGCAAGTAGG + Intronic
951745443 3:25972738-25972760 TCAGCTACTAAGTGACTAGCGGG - Intergenic
952005980 3:28842673-28842695 ACAACTAGTAACTGCAAAGCAGG - Intergenic
952152794 3:30610596-30610618 ACAGCCAGTACATGGCAAGTGGG - Intronic
952800635 3:37287599-37287621 ACAGCTTGTAAGAGGTAAGGAGG + Intronic
953419771 3:42745409-42745431 ACAGCTGGTGAGTGGAGAGCTGG + Intronic
953471250 3:43168782-43168804 ACAGCTAGGAAGGGGGAAGCTGG - Intergenic
955326667 3:58013954-58013976 ATAGCTACTTAGTGGCAAGTGGG - Intronic
955740898 3:62090873-62090895 CAAGCCAGTAAGTGGCAAGTTGG - Intronic
956103489 3:65792642-65792664 TCAGCTACTAAGTGGCTAACAGG + Intronic
956248858 3:67214679-67214701 ACAGCTAGTAAGTTGCAGAAAGG + Intergenic
956350092 3:68325166-68325188 ACAACTAGTAAGGGACAAACAGG - Intronic
956875632 3:73459876-73459898 CCAGCTAATACGTGGCAGGCAGG + Intronic
957388448 3:79529612-79529634 ACAGCTAATAAGTGACAAACAGG + Intronic
957727186 3:84082854-84082876 ACAGCTAGTAAGTGACTAAAAGG + Intergenic
957848677 3:85776563-85776585 ACAGCTAGAGAATGGCAAGATGG - Intronic
960517939 3:118623059-118623081 ACAGCTAGTAAACGGCAAAGTGG + Intergenic
960697499 3:120410371-120410393 ACAGCTAGTAATTGGCAGACTGG - Intronic
961143782 3:124577273-124577295 ACAGCTAGAAAGAGGCAAACAGG + Intronic
961706252 3:128788125-128788147 ACAGCTACTAAGTGACTAACGGG - Intronic
961808276 3:129504824-129504846 ATAGCTAGGAAGTGGCAGGGAGG + Intronic
961945266 3:130680283-130680305 ACAGCTAGTAAACAGAAAGCTGG - Intronic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
962426292 3:135271791-135271813 ACAGCCAGGAAGGGGCAAGGCGG + Intergenic
962898026 3:139733537-139733559 ACAGTTAGTTAGTGGCTAGTTGG - Intergenic
965441959 3:168725274-168725296 ACAGCTAGCAGGTGCAAAGCTGG - Intergenic
966892515 3:184417592-184417614 ACAGCTAACAAGTGGCAAGTGGG + Intronic
966920472 3:184608019-184608041 ACAGCTAGAAAGTGGCCAAGCGG + Intronic
966925950 3:184644653-184644675 ACAGCCAGCAAGTGGCAAATGGG - Intronic
967711829 3:192717253-192717275 ACAGCTAGTAAGTTGCAGACTGG - Intronic
967911571 3:194546434-194546456 ACAGCTAGAAGGTGGCCATCCGG + Intergenic
968793235 4:2683768-2683790 ACACCTGGTAAGTGGAATGCTGG - Intronic
969347356 4:6577614-6577636 ACAGCTTGTAAGCGGCAGGTGGG + Intronic
969429234 4:7144676-7144698 ACAGCTAGTAAGTGGCAGAGTGG + Intergenic
969830737 4:9794556-9794578 ACAGCTAAGAAGTGACAAGGTGG + Intronic
970207984 4:13675296-13675318 ACAGTTAGTAAGTGGCAGATTGG + Intergenic
970662481 4:18301585-18301607 ACAGTTGGTAAGTGGTAAACTGG - Intergenic
970682892 4:18531908-18531930 ACAGCTAGTAACAGCCAAGGTGG - Intergenic
971359243 4:25921736-25921758 AGAGATTGTAAGGGGCAAGCTGG + Intronic
972240912 4:37190666-37190688 ACAGCTACTAAGTGACTAACAGG + Intergenic
973680850 4:53317737-53317759 AGAGCTAGTAGGTGGCAAAATGG - Intronic
975433389 4:74321466-74321488 ACAGCTAGTAGGAGTGAAGCTGG - Intergenic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
975912870 4:79289622-79289644 ACAGCTAGTTGGTGGGAAGCTGG + Intronic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
976873608 4:89827161-89827183 ACAGCTGGTAAGGAGTAAGCAGG + Intronic
978198873 4:106001548-106001570 ACAAATGGTAAGTGGCCAGCAGG + Intronic
980417929 4:132517642-132517664 AAAGCTAGTAAGTTGCAGCCTGG - Intergenic
980725291 4:136751046-136751068 ATGGCTATTAAGTGGCCAGCAGG + Intergenic
981453874 4:144931531-144931553 AAAGGCACTAAGTGGCAAGCTGG - Intergenic
983565290 4:169144209-169144231 AAAGCAAGTTAATGGCAAGCTGG - Intronic
985534348 5:455205-455227 ACGGCCAGTGAGTGGGAAGCTGG + Intronic
985654207 5:1121616-1121638 ACAGCCAGTGAGTGGCAGGCAGG + Intergenic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
986746932 5:10753270-10753292 ACAGCTGGCAAGCGGCAAACTGG + Intronic
986985785 5:13499700-13499722 ACAGCAAGCAGGTGCCAAGCAGG + Intergenic
987177566 5:15331297-15331319 ACAGCTACTAAGTGACTAACGGG + Intergenic
987329520 5:16843493-16843515 ACAGTTAGTAAGCAGCAGGCAGG + Intronic
989177235 5:38539993-38540015 ACAGCTAGTAAGGAGCAAAGTGG + Intronic
990366321 5:55074393-55074415 ACAGCTAATAAATGGCAAAGTGG - Intergenic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
992904520 5:81333366-81333388 GTAGCGAGTAAGTGGCAATCTGG - Intronic
994797466 5:104321797-104321819 CCAGCTAGCCAGTGGCAATCTGG + Intergenic
995594432 5:113732849-113732871 ACAGCTGGTAACTGGCATCCTGG - Intergenic
996452332 5:123639709-123639731 ACAGCTAGTTAGTGGCATGAGGG - Intergenic
996467027 5:123814886-123814908 TAAGCGACTAAGTGGCAAGCAGG + Intergenic
997262117 5:132473442-132473464 ATAGCTAGTAAGTGGCAGAGTGG + Intronic
997302683 5:132817929-132817951 ACAGCTAGTAAATGCAGAGCTGG + Intergenic
998390069 5:141781640-141781662 CCAGCAAGTGAGTGGCAGGCAGG + Intergenic
998478778 5:142443942-142443964 ACAGCTAGCAAGTGACAGACTGG - Intergenic
998486818 5:142510137-142510159 ATACTTAGTAAGTGGCAAGCTGG - Intergenic
998859898 5:146432325-146432347 ACAGCTAGTAAGAGGCAGATCGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999442194 5:151611197-151611219 ACAGCTTGTAAATGGTAAGGAGG + Intergenic
999511907 5:152261029-152261051 ACAGCTAGTACGCGTCAAGATGG + Intergenic
999517168 5:152313278-152313300 ACAGTAAGTAAATAGCAAGCTGG - Intergenic
999575823 5:152975338-152975360 ACAGCTAGTGAGTGGCAAATTGG - Intergenic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1000220029 5:159206294-159206316 TTAGCAAGTCAGTGGCAAGCTGG + Intronic
1000334254 5:160230283-160230305 ACAGCTAGTAATTGGTAAAGTGG + Intronic
1000509801 5:162166462-162166484 ACAGGCATAAAGTGGCAAGCTGG + Intergenic
1001073973 5:168610417-168610439 CTAGCTAGTAAGAGGCATGCTGG + Intergenic
1001865038 5:175096576-175096598 AGAGCTCGTGAGTGGCCAGCTGG + Intergenic
1001926689 5:175642303-175642325 ACAGCCAGTAAGTGGCAGAGCGG + Intergenic
1003207077 6:4021986-4022008 AGAGCTAGTCTGTGGCTAGCGGG + Intronic
1003963421 6:11230350-11230372 ACAGCTAGAAAGTGGTGAGCTGG - Intronic
1004473629 6:15950961-15950983 ACAGCTATTAAGTGGTGTGCTGG + Intergenic
1004663529 6:17730504-17730526 ACAGCTACTAAGTGACTAACAGG - Intergenic
1006374864 6:33666230-33666252 ACAGCTAGGAAGCGGCAGCCAGG + Intronic
1006816849 6:36857280-36857302 ATAGCTGGTAAGTGGCAATGTGG + Intronic
1007446268 6:41908762-41908784 ACAGCTGGCAAGTAGGAAGCGGG - Intronic
1007670918 6:43552915-43552937 ACAGCTAATAAATGGCAAAATGG - Intronic
1007812819 6:44498283-44498305 ACAGCTAGGAAGTAGGGAGCTGG + Intergenic
1010674529 6:78725964-78725986 ACAGCTAGTTAGTGGCAGATAGG - Intergenic
1010841844 6:80655643-80655665 ACAGCTACTAAGTGACTAACAGG + Intergenic
1011207826 6:84919726-84919748 ACAGCTAGAAAGTGGCAGAATGG + Intergenic
1011226104 6:85108990-85109012 ACAGCTGGTTAGTGGCAGACTGG - Intergenic
1011397724 6:86927493-86927515 GCAGCCAGTATGTGGCAAACTGG - Intergenic
1011922058 6:92590175-92590197 ACAGCCAGTAAGTGACAAAATGG - Intergenic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1013855751 6:114570082-114570104 ACAAATAGTAAGTGGTAAGAAGG - Intergenic
1013948500 6:115751432-115751454 ACAGCTATTTAGTTGGAAGCTGG + Intergenic
1014173405 6:118304833-118304855 ACAGCAAGGAAGAGGCAAACAGG + Intronic
1014980822 6:127944585-127944607 TCAGCTAGTAGGTGGCAGACAGG + Intergenic
1015585888 6:134775994-134776016 AGAGCTGGTAACTGGCAAGATGG + Intergenic
1016056063 6:139579024-139579046 ACAGCAAGTAGGTGACAAGGAGG - Intergenic
1017273014 6:152531010-152531032 ACAACTATGAAGTGACAAGCAGG - Intronic
1017529838 6:155278672-155278694 ACAGCTAGTAAGTGGGGAGATGG + Intronic
1017541717 6:155409363-155409385 ACAGCTAGTGAGTGGGAGTCAGG + Intronic
1017960451 6:159216758-159216780 ACAGTAAGTAAGAAGCAAGCTGG - Intronic
1018124658 6:160670033-160670055 ACAGCCAGTAAGTGGGAACCAGG + Intergenic
1018361906 6:163079020-163079042 ACAGCTAGTTAGTAGCAAGCTGG - Intronic
1018470461 6:164091960-164091982 ATGGCTACTAAGTGGCTAGCAGG - Intergenic
1018772834 6:166986868-166986890 ACTGTTACCAAGTGGCAAGCTGG - Intergenic
1020491811 7:8795093-8795115 TCAGCTAGCAATTGGCAACCAGG - Intergenic
1021458697 7:20860199-20860221 ACAGCTAGTCAGAGGTGAGCTGG + Intergenic
1021845707 7:24760434-24760456 TCAGCTGGTAAGTGGTAGGCTGG - Intergenic
1021935563 7:25627719-25627741 ACAGCTAGTAATTGAAAACCAGG + Intergenic
1022692765 7:32673505-32673527 AAATCTAGTATGTGGAAAGCAGG - Intergenic
1022915274 7:34943424-34943446 AGAGCTAGTAAGTGGCAGCCAGG + Intronic
1022920442 7:35008039-35008061 AAATCTAGTATGTGGAAAGCAGG - Intronic
1025742720 7:64212257-64212279 ACATCCAGTAAGTGGCAGTCTGG - Intronic
1026407163 7:70078249-70078271 ACAGCTACTAAGTGACTAACAGG + Intronic
1026434069 7:70378601-70378623 ACAGCTAGTATGTGGCAGACAGG + Intronic
1028937645 7:96484156-96484178 ATAGCTAGTAAGTGGCAATGTGG + Intronic
1029710610 7:102297223-102297245 ACAACTCCTAAGTGGCGAGCGGG - Intronic
1031207257 7:118776374-118776396 ACAACTAGTAAGTTGCCAGCTGG + Intergenic
1031697153 7:124872481-124872503 ACAGCTACTAAGTGACAAACAGG - Intronic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1032275861 7:130454772-130454794 ACAGCTTCTCAGTGGCAAGGAGG + Intergenic
1033168233 7:139059976-139059998 ACAGCTAATGGGTGGCAAGGTGG + Intronic
1033880368 7:145874378-145874400 ACAGCTACTAAGTGACCAACAGG - Intergenic
1034613723 7:152396072-152396094 ACAGCTACTAAGTGTGAGGCTGG + Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1036754327 8:11462279-11462301 AGAACTAGTAAGTGGCAGGCTGG - Intronic
1036797346 8:11765880-11765902 AGAGCTAGTAAGTGGAAATCAGG + Intergenic
1037159790 8:15755164-15755186 ACAGCTAGTAACGAGCAGGCTGG - Intronic
1038163514 8:25062935-25062957 ACAGCTAGCAAGTGCCAAATTGG - Intergenic
1038375795 8:27038985-27039007 AAACATATTAAGTGGCAAGCGGG - Intergenic
1038737783 8:30187918-30187940 TCAGCTAGTAAGTGGCATTTTGG + Intergenic
1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG + Intronic
1038868024 8:31460865-31460887 AGAGCTTGTAAGTGGCAAGAGGG - Intergenic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1041958408 8:63583051-63583073 AGAGCTACTAAGAGGTAAGCTGG - Intergenic
1043339078 8:79215530-79215552 ACAGCTAGTAAGTGATAACATGG - Intergenic
1043555542 8:81426815-81426837 ACAGCTAGTAAGTAGCATATTGG + Intergenic
1043927446 8:86053277-86053299 AGAGTCAGCAAGTGGCAAGCTGG - Intronic
1044298711 8:90558190-90558212 ACAGCTAGTAAGTGGGAGGTTGG - Intergenic
1044900918 8:96943580-96943602 ACAGCAAGAAAGTAGCAGGCTGG + Intronic
1045979226 8:108164967-108164989 ATAGCTGGTAAGTGACATGCTGG + Intergenic
1046024925 8:108711229-108711251 AGAGTTATTAAGTGGCCAGCTGG + Intronic
1046857390 8:119048788-119048810 AAAGCTATAGAGTGGCAAGCTGG - Intronic
1047154791 8:122304612-122304634 AGAGCTAGTAAGTGCCAAGTTGG - Intergenic
1047269957 8:123347693-123347715 ACAGCTAGTAAATTACAAACTGG - Intronic
1047286327 8:123490311-123490333 ACAGCTAGGAAGTGGTGGGCTGG + Intergenic
1047612310 8:126533114-126533136 ACAACTAGAAAGTGGCAGTCTGG - Intergenic
1048039884 8:130716988-130717010 CAAGCAGGTAAGTGGCAAGCTGG - Intergenic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1048190547 8:132284426-132284448 ACAGCTAGGAAGTGCCAAGGTGG + Intronic
1049513703 8:143042753-143042775 TCGGCAAGTTAGTGGCAAGCTGG + Intronic
1051260875 9:15263388-15263410 CCAGCCAGTAAATGGCAAACTGG + Intronic
1052028809 9:23605346-23605368 ACAGCTAGTAAATGGAACACTGG + Intergenic
1053035186 9:34821204-34821226 ACAAATAGTAAATGGCAAGATGG - Intergenic
1054936958 9:70698332-70698354 ACAGCTAGTAAGAGACAGGACGG - Intronic
1055557202 9:77487115-77487137 ACAGCTACTAAGTGACTAGTAGG + Intronic
1055690016 9:78819914-78819936 AAAGCTAGTTAGTGGCAAAATGG - Intergenic
1056985286 9:91358400-91358422 ATAGCTAGTAAGCGGCAGACTGG - Intronic
1057584337 9:96315947-96315969 ACAACTAGTAAATGACAAGTAGG + Intergenic
1057914543 9:99045702-99045724 ACAGCTTGTAAGTGGCAGAGTGG + Intronic
1058620511 9:106878138-106878160 AAAGCTAGGAAGTGGCAGGCAGG - Intronic
1058693861 9:107542578-107542600 ACAGCTACTAAGTGGCTAATGGG + Intergenic
1058800533 9:108540834-108540856 AGAGCTGGTAAGTGGCATGGTGG + Intergenic
1058824263 9:108760736-108760758 ACAGCCAGTAATTGGCAGGTAGG + Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1059247521 9:112861473-112861495 ACACCTGGTAAGTGGCAGGTGGG + Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1059553917 9:115259354-115259376 ACAGCTAGTAAATGGCAGCATGG + Intronic
1059816304 9:117919649-117919671 ACAGCTTGTGAGTGGAAAGTCGG - Intergenic
1060297706 9:122354620-122354642 ACAGCTAGTAAGGGCCGAGGCGG + Intergenic
1060334353 9:122707309-122707331 ACAACTAGTAAGTGGCAGCTAGG + Intergenic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1060814817 9:126629485-126629507 ACAGCTAGTAAATGGAACCCAGG + Intronic
1060829663 9:126705712-126705734 ACAGCTGGGAAGCGGCAGGCTGG + Intergenic
1060928700 9:127474123-127474145 ACAGCTTGTGCTTGGCAAGCTGG - Intronic
1061177368 9:129005823-129005845 TCAGCTGGGAAGTGGCAGGCAGG - Intronic
1187725661 X:22199598-22199620 ACAGCTACTAAGTGACTAACAGG - Intronic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1188247913 X:27856550-27856572 ACAGCTAGTAAGTGACAGGATGG + Intergenic
1188483280 X:30655439-30655461 ACAGCTAGTAGCTGCCAAGCAGG + Intronic
1188659630 X:32742950-32742972 ACTGCTAGTAAATGGCAAAATGG + Intronic
1189055356 X:37693951-37693973 ACAGCTAGTATGTGTCAGGAAGG + Intronic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1190559668 X:51674364-51674386 ACAGCTAGTAAGTGGGATCCGGG + Intergenic
1190564623 X:51718957-51718979 ACAGCTAGTAAGTGGGATCCGGG - Intergenic
1190573943 X:51814171-51814193 ACAGCTATTATGTGGCTTGCTGG + Intronic
1190736861 X:53261308-53261330 ACAGCTGGTCAGTGGCAGTCAGG - Intronic
1192187038 X:68954340-68954362 AGAGCTAGAAAGAGCCAAGCTGG - Intergenic
1193073113 X:77327606-77327628 TCAGCTAGCCAGTGGCTAGCTGG + Intergenic
1193459982 X:81778812-81778834 ACAGCCAGTAAGTGTCAAAGCGG + Intergenic
1194340947 X:92704876-92704898 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1194373311 X:93101298-93101320 ACTGCTAGTAAGTGGCCAAATGG - Intergenic
1194690371 X:96976988-96977010 ATATCTAGTAAGTGGCAAAATGG + Intronic
1196046345 X:111260209-111260231 ACAGCAAAGAAGTGGCAAGTGGG + Intronic
1196123635 X:112077159-112077181 ACAGCTAGTAATTCGTGAGCAGG + Intronic
1196480989 X:116147861-116147883 ACAGCTAAGAAGTGGCAAAGCGG - Intergenic
1196694760 X:118599989-118600011 AGAGCTAGTAAGTGACATGTGGG - Intronic
1197300949 X:124779896-124779918 CCAGTTAGTAAGTGGCAAATTGG + Intronic
1199483036 X:148318984-148319006 ATAGCTACTAAGTGGCTAACAGG - Intergenic
1200649301 Y:5821595-5821617 CCAGCTAGTAAGTGACAGGCAGG - Intergenic
1200681348 Y:6215339-6215361 ACTGCTAGTAAGTGGCCAAATGG - Intergenic
1200836682 Y:7739274-7739296 ACAACTAGTAAAGGGCAAGTAGG + Intergenic